Application of peony leaf extract and functional components thereof in preparation of medicine for treating endometriosis with anxiety or depression

Abstract

The invention belongs to the technical field of traditional Chinese medicines, and particularly relates to application of peony leaf extract and functional components thereof in preparation of medicines for treating endometriosis with anxiety or depression. A preparation method of the peony leaf extract comprises the following steps: taking dry peony leaves, refluxing for three times at 90 DEG C by using 70% ethanol, 2 hours each time, concentrating, and spray-drying, so as to obtain the peony leaf extract. The peony leaf extract, the apigenin, the paeoniflorin and the gallic acid as the functional components thereof and combined administration of the apigenin, the paeoniflorin and the gallic acid can slow down the growth speed of EMs lesion, and inhibit neuroinflammation and relieve EMs-related pain and anxiety / depression behaviors by inhibiting microglial cell M1 polarization and promoting M2 polarization, so that the invention has the advantages of simple preparation process and low cost. And further, support can be provided for preparing medicines for treating endometriosis with anxiety or depression.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of traditional Chinese medicine, and particularly relates to application of peony leaf extract and its functional components in preparation of a medicine for treating endometriosis with anxiety or depression. BACKGROUND

[0002] Endometriosis (EMs) is a common chronic inflammatory disease in gynecology, characterized by the growth of endometrial tissue outside the uterine cavity. About 10% of women of childbearing age worldwide suffer from EMs, and its main features are menstrual disorders, dysmenorrhea, pelvic pain and infertility. Severe EMs symptoms reduce the quality of life of patients and damage their mental and spiritual health. Anxiety and depression are the most common mental complications of endometriosis, and women with EMs are more likely to develop mental illness than the general population. A cohort study showed that about 87.5% of EMs patients with obvious pelvic pain were diagnosed with anxiety symptoms, and 86.5% were diagnosed with depression symptoms. Clinical guidelines recommend hormone therapy as the main treatment for EMs, but hormone therapy is more suitable for patient groups without fertility needs, and this treatment method mainly relieves pain and cannot cure the disease. About 25-34% of patients have recurrent pelvic pain symptoms within 12 months after stopping medication. For EMs patients with anxiety / depression, the clinic often combines mental drugs, such as selective serotonin reuptake inhibitors (SSRIs), with EMs treatment drugs, but long-term use of the drug can cause side effects such as nausea, vomiting, headache, insomnia, etc. Therefore, there is an urgent need for a safe and effective drug to treat EMs while relieving mental complications caused by EMs.

[0003] Traditional Chinese medicine has the characteristics of "multiple components, multiple targets and multiple pathways", and has remarkable effects in the treatment of difficult and complicated diseases. Traditional Chinese medicine believes that the pathogenesis of EMs is blood stasis blocking the chong and ren channels and the uterus, and the most common clinical manifestation is the combination of heat and blood stasis, so products such as peony bark, red peony root and herbaceous peony are often used to clear heat and promote blood circulation. Peony leaf (Paeonia suffruticosa Andrews, PSL) is the dried leaf of peony, which has the effects of clearing heat and cooling blood and promoting blood circulation to remove blood stasis. Peony leaf contains various active ingredients such as total glycosides, flavonoids and polyphenols, etc., such as paeoniflorin, oxidized paeoniflorin, apigenin, gallic acid, etc. Studies have shown that apigenin (Api), paeoniflorin (PF) and gallic acid (GA) have neuroprotective effects. However, there is currently no report on the effects of PSL, Api, PF and GA on endometriosis with anxiety / depression. Paeonia × suffruticosa

[0004] ​The information disclosed in this Background section is only for the purpose of increasing an understanding of the general context of the present application and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art. SUMMARY

[0005] The present application aims to provide the application of peony leaf extract and its functional ingredients in the preparation of drugs for treating endometriosis with anxiety or depression.

[0006] To achieve the above-mentioned purpose, the present application provides the following technical solutions. The first purpose of the present application is to provide a peony leaf extract, the preparation method of which is as follows: taking dry peony leaves, refluxing them with 70% ethanol at 90℃ for three times, each time for 2h, and then spray drying after concentration, to obtain the peony leaf extract.

[0007] The present application also provides the application of the peony leaf extract and its functional ingredients in the preparation of drugs for treating endometriosis with anxiety or depression.

[0008] The present application also provides the application of the peony leaf extract and its functional ingredients in inhibiting M1 polarization of microglial cells, promoting M2 polarization, and inhibiting neuroinflammation.

[0009] Further, the functional ingredients of the peony leaf extract include apigenin, paeoniflorin and gallic acid.

[0010] Compared with the prior art, the present application has the following beneficial effects: The peony leaf extract of the present application, its functional ingredients apigenin, paeoniflorin and gallic acid, and the combined administration of the three can slow down the growth rate of EMs lesions, and further inhibit neuroinflammation by inhibiting M1 polarization of microglial cells and promoting M2 polarization, thereby reducing EMs-related pain and anxiety / depression-like behavior, and thus providing support for the preparation of drugs for treating endometriosis with anxiety or depression. BRIEF DESCRIPTION OF DRAWINGS

[0011] Figure 1 The PSL and its functional ingredient group can inhibit the growth of EMs lesion tissues; Figure 2 The PSL and its functional ingredient group can inhibit the growth of EMs lesion tissues; Figure 3 The PSL and its functional ingredient group can improve anxiety / depression-like behavior of EMs mice; Figure 4 The PSL and its functional ingredient group can improve brain damage (H&E staining) of EMs mice; Figure 5 The PSL and its functional ingredient group can improve brain damage (Nissl staining) of EMs mice; Figure 6 PSL and its active ingredients can reduce the expression of cytokines in serum and HPC tissues; Figure 7 PSL and its active ingredients can reduce the expression of cytokines in PFC tissues; Figure 8 PSL and its active ingredients inhibit M1 polarization in microglia and promote M2 polarization; Explanation of key figure labels: Figure 1 In the table, A: changes in ectopic EM tissue; BC: changes in weight and volume of ectopic EM tissue; D: H&E staining of ectopic EM tissue; all data were analyzed using one-way ANOVA, and p-values ​​reflect differences between experimental groups, *P<0.05, **P<0.01 compared to the model group ( n =3); Figure 2 In the table, A: Immunofluorescence staining of ectopic EM tissues; B: Ki67 staining of ectopic EM tissues; C: Mean gray value of Ki67 in ectopic EM tissues. All data were analyzed using one-way ANOVA. P-values ​​reflect differences between experimental groups. ## P < 0.01 compared with the control group; **P < 0.01 compared with the model group ( n =3); Figure 3 In the table, A: Effect of PSL and its active ingredient on the mechanical pain threshold of the right foot in mice; B: Effect of PSL and its active ingredient on the thermal pain threshold in mice; C: Total distance traveled by mice in an open field; D: Average speed of mice in an open field; E: Time spent by mice in the central area of ​​an open field; F: Distance traveled by mice in the central area of ​​an open field; G: Number of marbles buried by mice; H: Immobility time of mice in the tail suspension test; I: Immobility time of mice in the forced swimming test. Mechanical pain threshold was analyzed using the Kruskal-Wallis test, and other data were analyzed using one-way ANOVA. P-values ​​reflected differences between experimental groups. # P < 0.05 ## P < 0.01 compared with the control group; *P < 0.05, **P < 0.01 compared with the model group ( n =8); Figure 4 In the image, A: H&E staining of mouse HPC; B: H&E staining of mouse PFC tissue; n =3); Red arrows indicate condensation of the nerve cell nucleus; Blue arrows indicate the disappearance of the nerve cell nucleolus; Figure 5In the middle, A: Nissl staining of mouse PFC; B-C: the number of neurons in mouse CA1 and CA3 regions; D: Nissl staining of mouse PFC; E. The number of neurons in mouse PFC; all data using one-way ANOVA, P value reflects the difference between experimental groups, ## P<0.01 compared with the control group; **P<0.01 compared with the model group n =3); Red arrow indicates pyknosis of nerve cell nucleus; Blue arrow indicates disappearance of nerve cell nucleolus; Figure 6 In the middle, A-C: IL-1β, IL-6 and TNF-α levels in mouse serum; D-F: IL-1β, IL-6 and TNF-α mRNA expression in mouse HPC tissue; H: IL-1β, IL-6 and TNF-α protein expression in mouse HPC tissue; I-K: Gray scale analysis of IL-1β, IL-6 and TNF-α in mouse HPC tissue; all data using one-way ANOVA, P value reflects the difference between experimental groups, # P<0.05, ## P<0.01 compared with the control group; *P<0.05, **P<0.01 compared with the model group n =3); Figure 7 In the middle, A-C: IL-1β, IL-6 and TNF-α mRNA expression in mouse PFC tissue; D: IL-1β, IL-6 and TNF-α protein expression in mouse PFC tissue; E-G: Gray scale analysis of IL-1β, IL-6 and TNF-α in mouse PFC tissue; all data using one-way ANOVA, P value reflects the difference between experimental groups, # P<0.05, ## P<0.01 compared with the control group; *P<0.05, **P<0.01 compared with the model group n =3); Figure 8 In the middle, A-C: IL-1β, IL-6 and TNF-α mRNA expression in mouse PFC tissue; D: IL-1β, IL-6 and TNF-α protein expression in mouse PFC tissue; E-G: Gray scale analysis of IL-1β, IL-6 and TNF-α in mouse PFC tissue; all data using one-way ANOVA, P value reflects the difference between experimental groups, # P<0.05, ### P<0.001 compared with the control group; *P<0.05, **P<0.01 compared with the model groupn =3). DETAILED DESCRIPTION

[0012] The technical solutions of the patent application will be described below in a clear and complete manner. Obviously, the described embodiments are part of the embodiments of the patent application, rather than all the embodiments. Based on the embodiments in the patent application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the patent application.

[0013] 1. Materials and methods 1.1 Instruments See Table 1.

[0014] Table 1. Instruments and manufacturers used in the experiment Instrument Manufacturer Table top low speed centrifuge (TDZ4) Huxi Instrument and Equipment Co., Ltd. of Hunan, China Refrigerated centrifuge (Centrifuge 5418R) Eppendorf Co., Ltd. of Germany Ultrasonic cleaner Kunshan Ultrasonic Instrument Co., Ltd. Electronic analytical balance (ME235S) Sartorius Co., Ltd. of Germany Ultrapure water system (Synergy® UV) Merck Millipore Co., Ltd. of Germany Microplate reader (Multiskan FC) Thermofisher Co., Ltd. of the United States Constant temperature water bath (J-HH-4A) Shanghai Haizhong Instrument Co., Ltd. Rotary evaporator (N-1100) EYELA Co., Ltd. of Japan Electrophoresis instrument (Mini-Protean®) Bio Rad Co., Ltd. of the United States Wet transfer tank (Mini-Trans-Blot®) Bio Rad Co., Ltd. of the United States Full-automatic ice maker (IMS-100) Changshu Xueke Electrical Equipment Co., Ltd. Chemiluminescence imager (SCG-W3000 PLUS) Wuhan Saivier Biological Co., Ltd. Optical microscope (Nikon Eclipse E100) Nikon Co., Ltd. of Japan Fluorescence microscope (Nikon Eclipse C1) Nikon Co., Ltd. of Japan Spray dryer (HSD-8) Shanghai Jinqiao Spray Dryer Equipment Factory Von frey filament (Aesthesio) Danmic Global Co., Ltd. of the United States Hot plate instrument (RB-200) Chengdu Tailian Software Co., Ltd. Open field device (JLBehv) Shanghai Jiliang Software Technology Co., Ltd. Tail suspension device (TST-100) Chengdu Tailian Software Co., Ltd. Fluorescent quantitative PCR instrument (CFX Connect) Bio-rad Co., Ltd. of the United States 1.2 Reagents See Table 2.

[0015] Table 2. Reagents and manufacturers used in the experiment Reagent Manufacturer GA (purity ≥98%) Chengdu Pusibo Co., Ltd. PF (purity ≥98%) Chengdu Pusibo Co., Ltd. Api (purity ≥98%) Chengdu Pusibo Co., Ltd. Paroxetine hydrochloride (PAR) Shanghai Yuanye Biological Technology Co., Ltd. Dienogest (DIE) Shanghai Yuanye Biological Technology Co., Ltd. Estradiol benzoate injection Chengdu Jingke Biochemical Products Co., Ltd. Olive oil Shanghai Maikelin Biochemical Technology Co., Ltd. IL-1β detection kit Wuhan Elabscience Biotechnology Co., Ltd. IL-6 detection kit Wuhan Elabscience Biotechnology Co., Ltd. TNF-α detection kit Wuhan Elabscience Biotechnology Co., Ltd. Total protein extraction kit Jiangsu Keygen Biotechnology Co., Ltd. BCA protein quantification kit Wuhan Elabscience Biotechnology Co., Ltd. 5× Loading buffer Leagen Biotech Co., Ltd. of Beijing, China 4% Paraformaldehyde Leagen Biotech Co., Ltd. of Beijing, China Glycine Bio Froxx, Germany Tris Bio Froxx, Germany SDS Bio Froxx, Germany TBST Sino Biological, Wuhan, China Protein-free fast blocking solution Sino Biological, Wuhan, China PVDF membrane Merck Millipore, Germany Anti-E-cadherin (AF0131) Affinity Biological Technologies, USA Anti-vimentin (AF7013) Affinity Biological Technologies, USA Anti-p-JAK2 (AF3024) Affinity Biological Technologies, USA Anti-p-STAT3 (AF3293) Affinity Biological Technologies, USA Anti-IL-1β (AF5103) Affinity Biological Technologies, USA Anti-IL-6 (DF6087) Affinity Biological Technologies, USA Anti-TNF-α (GB115726) Sino Biological, Wuhan, China Anti-JAK2 (GB11325) Sino Biological, Wuhan, China Anti-STAT3 (GB11176) Sino Biological, Wuhan, China Reagent Manufacturer Anti-IL-1β (AF5103) Affinity Biological Technologies, USA Anti-IL-6 (DF6087) Affinity Biological Technologies, USA Anti-TNF-α (GB115726) Sino Biological, Wuhan, China Anti-JAK2 (GB11325) Sino Biological, Wuhan, China Anti-STAT3 (GB11176) Sino Biological, Wuhan, China Anti-ki67 (GB111499) Sino Biological, Wuhan, China Anti-iNOS (18985-1-AP) Proteintech, USA Anti-Arg-1 (16001-1-AP) Proteintech, USA Anti-Iba-1 (81728-1-RR) Proteintech, USA Anti-β-actin (AT0001) Engibody, USA Anti-rabbit secondary antibody Proteintech, USA Anti-mouse secondary antibody Proteintech, USA iF488-Tyramide (G1231) Sino Biological, Wuhan, China iF555-Tyramide (G1233) Sino Biological, Wuhan, China RNA extraction kit (G3013) Sino Biological, Wuhan, China SweScript All-in-One RT SuperMix for qPCR (One-Step gDNA Remover, G3337) Saviv Biological Technology Co., Ltd. 2x Universal Blue SYBR Green qPCR Master Mix (G3326) Saviv Biological Technology Co., Ltd. 1.3 Preparation of peony leaf extract Peony leaf P. suffruticosa Andrew was provided by a Chinese peony garden in Heyang, Weinan, Shaanxi Province. The dried PSL (1.01 kg) was refluxed with 70% ethanol at 90°C for three times, each for 2 h, and then spray-dried after concentration to obtain the PSL extract.

[0016] 1.4 Experimental animals 161 female C57BL / 6J (6-week-old) mice were purchased from the Experimental Animal Center of the Air Force Military Medical University in Xi'an, China. The animal experiment (SYXK-2024-003) was approved by the Ethics Committee of the Air Force Military Medical University.

[0017] The mice were adapted to an environment with 12 h light / 12 h dark (lights on at 8:00 am and lights off at 8:00 pm), a temperature of 23±2°C, and a humidity of 60% for one week. All animal experiments were approved by the Experimental Animal Welfare and Ethics Committee of the Air Force Medical University (No. 20241460).

[0018] 1.5 Establishment of endometriosis anxiety / depression model and drug administration The mice were synchronized with their estrus cycle by subcutaneous injection of 100 μg / kg of estradiol twice one week before the operation. The 147 mice were divided into donors and recipients at a ratio of 1:2.

[0019] After the donor mice were anesthetized with anesthetic ventilator in oxygen with vaporized isoflurane (4% V / V for induction), the uterine horns on both sides were removed after euthanasia by cervical dislocation, longitudinally cut open, and cut into uterine fragments of the same size using a 3-mm skin biopsy punch. After the recipient mice were anesthetized with 4% isoflurane, the operation was performed in 2% isoflurane / oxygen. The anesthetic level was evaluated by pain reflex (squeezing the toes) before and during the operation. After the mice were anesthetized, two pieces of endometrial tissue were sutured to the peritoneum of 98 recipient mice with 6-0 silk thread, two pieces of fat tissue were sutured to the peritoneum of the remaining 14 mice, and after the peritoneum was closed with 4-0 silk thread, the mice were returned to their respective cages for recovery for one week.

[0020] One week after the operation, the sham-operated mice were the Sham group, and the model mice were randomly divided into the Model group, the positive control group (DIE+PAR), the PSL (400 mg / kg) treatment group, the GA (19.8 mg / kg) treatment group, the PF (2.6 mg / kg) treatment group, the Api (0.1 mg / kg) treatment group, and the Com (GA+PF+Api) treatment group.

[0021] The DIE+PAR group of mice were given 0.31 mg / kg of DIE dissolved in 5% sodium carboxymethyl cellulose solution by gavage and 10 mg / kg of PAR for drinking, the PSL group, the GA group, the PF group, and the Api group were given 400 mg / kg of peony leaf extract, 19.8 mg / kg of GA aqueous solution, 2.6 mg / kg of PF aqueous solution, and 0.1 mg / kg of Api aqueous solution by gavage, respectively, and the Com group of mice were given a mixed solution of 19.8 mg / kg of GA+2.6 mg / kg of PF+0.1 mg / kg of Api by gavage; the Sham group of mice were given the same volume of deionized water by gavage.

[0022] The mice in each group were evaluated for anxiety / depression behavior 6 weeks after the operation. After the behavioral evaluation was completed, the mice were anesthetized, and blood was taken from the orbital plexus. The blood was allowed to stand at room temperature for 2 h, then centrifuged at 3500 r for 15 min at 4°C, and the supernatant was taken and stored in a -20°C refrigerator. After the mice were bled, they were euthanized by inhaling 5% isoflurane vaporized in air, and the abdominal EMs tissue and peritoneum, whole brain, HPC, and PFC were isolated and stored in 4% paraformaldehyde or -80°C refrigerator, respectively.

[0023] 1.6 Behavioral testing One week before the operation, the mice underwent open field and pain tests to bring each group to the same baseline. Before each behavioral test, the mice needed to enter the laboratory 0.5-1 h in advance to adapt to the experimental environment. All behavioral experiments were performed between 9:00 and 18:00, and each group of mice was measured in parallel to reduce differences caused by time.

[0024] 1.6.1 Mechanical pain threshold test Before testing the mechanical withdrawal threshold (MWT), mice were acclimated to the test environment by placing them in a plastic chamber with a wire mesh floor for 30 min. The right hind paw of the mice was then subjected to von frey filament stimulation starting from 0.07 g. If the mouse lifted or licked the tested paw, the filament force was decreased; otherwise, the filament force was increased, for a total of 5 tests with 20 s intervals and 3 s stimulation each time. The MWT was the filament force when the mouse had three positive responses in five tests (with 20 s intervals). After each test, the wire mesh floor was wiped with 75% ethanol to reduce the impact of odor on subsequent tests.

[0025] 1.6.2 Thermal pain threshold test Mice were placed on a hot plate preheated to 53°C, and the time for the mouse to first jump or lick the paw was recorded and taken as the paw withdrawal latency (PWL). To avoid tissue burning of the mice, the observation time should not exceed 40 s. After each test, the hot plate was wiped with 75% ethanol.

[0026] 1.6.3 Marble burying test (MBT) A 5 cm thick fresh bedding was laid in a standard mouse cage (40 x 27 x 18 cm), and 20 clean marbles (1.5 cm in diameter) were placed in the cage in a 5 x 4 array. The test mouse was gently placed in the cage from a corner without marbles, allowing it to freely move for 30 min. After the test, the mouse was removed from the cage without changing the position of the marbles, and the number of marbles buried in the cage was recorded. A marble was considered buried if it was covered by more than 2 / 3 of the bedding. After each test, the bedding in the cage was replaced, and the marbles were wiped with 75% ethanol.

[0027] 1.6.4 Open field test (OFT) The mouse was gently placed in the center of the open field (25 x 25 x 25 cm) to freely move for 10 min, and the behavior of the mouse was recorded and analyzed in real time using JLBehv software, including average speed, total travel distance, and time and distance of activity in the central area of the open field. After the experiment, the mouse was removed from the open field, and the equipment was wiped with 75% ethanol.

[0028] 1.6.5 Tail suspension test (TST) The tail of the mouse was fixed with adhesive tape on the fixed rod on the top of the tail suspension test box, and the head of the mouse was about 1 cm away from the ground to prevent the mouse from touching the bottom of the test box. The behavior of the mouse within 6 min was recorded using TST-100 tail suspension software, and the immobility time of the mouse in the last 4 min was analyzed.

[0029] 1.6.6 Forced swimming test (FST) A 5000 mL cylindrical beaker with a diameter of 20 cm and a height of 28 cm was filled with water to a height of 18 cm, and the water temperature was 23±1°C. The mouse was placed in the beaker to swim in the water for 6 min, and the immobility time of the mouse in the water in the last 4 min was recorded. The immobility time refers to the mouse floating on the water surface only for breathing and balance. After the experiment, the mouse was taken out of the water and dried with a clean towel.

[0030] 1.7 Detection of IL-1β, IL-6 and TNF-α in serum The content of IL-1β, IL-6 and TNF-α in serum was detected according to the steps of mouse IL-1β, IL-6 and TNF-α detection kit. After the required reagents and samples were restored to room temperature, 100 μL of serum or prepared control was added to the pre-coated 96 well, incubated at 37°C for 90 min, then the liquid in the plate was removed, 100 μL of prepared biotinylated antibody working solution was added, and incubated at 37°C for 1 h. After incubation, the plate was washed with washing buffer for 3 times, 100 μL of prepared HRP enzyme conjugate working solution was added, and incubated at 37°C for 30 min. The plate was washed 5 times, 90 μL of substrate solution was added, and incubated in the dark for 15 min. After the reaction was completed, 50 μL of stop solution was added to each well, and the absorbance of each well at 450 nm was measured using a microplate reader.

[0031] 1.8 Hematoxylin and eosin staining (H&E) EMs tissues and brain tissues were fixed in 4% paraformaldehyde for 48 h, and then embedded in paraffin. The paraffin tissue was cut into 4 μm thick sections, and deparaffinized with xylene, and deparaffinized to water with gradient ethanol (100%→95%→80%→70%). The deparaffinized tissue sections were stained with hematoxylin for 5 min and eosin for 2 min, respectively. These images were taken by Nikon Eclipse E100 microscope (Nikon, Japan) to show the histopathological changes of EMs, HPC and PFC.

[0032] 1.9 Nissl staining The paraffin sections of brain were deparaffinized with xylene, deparaffinized to water with gradient ethanol, and then stained with toluidine blue for 15 min, rapidly dehydrated with anhydrous ethanol, and then permeabilized in xylene for 5 min before mounting. The sections were observed under an optical microscope to visualize the Nissl bodies of HPCs and PFC tissues.

[0033] 1.10 Immunohistochemical staining After deparaffinization and hydration of the 4 μm thick paraffin sections of EMs tissues, antigen retrieval was performed in EDTA (pH 8.0) using a microwave. After blocking the sections with 10% rabbit serum for 30 min at room temperature, incubation was performed overnight at 4°C in anti-ki67 (1 :800). After incubation with the primary antibody, the sections were incubated with HRP-labeled secondary antibody for 1 h at room temperature and incubated in DAB staining solution for 2 min. The sections were counterstained with hematoxylin to stain the nuclei. After optimal dehydration, permeabilization, and sealing, the sections were observed under a microscope to analyze the pathological changes in the EMs tissues.

[0034] 1.11 Immunofluorescence staining After deparaffinization to water, the paraffin sections of EMs and brain tissues were placed in EDTA (pH 8.0) and subjected to antigen retrieval by heating in a microwave oven. The sections were blocked with 10% rabbit serum for 30 min at room temperature, incubated overnight at 4°C in anti-Vimentin (1 :2000), and then incubated with HRP-labeled secondary antibody for 50 min at room temperature, incubated in iF488-Tyramide (1 :500) for 10 min at room temperature in the dark. After antigen retrieval and blocking again, the sections were incubated in anti-E-cadherin (1 :200) overnight at 4°C, incubated with HRP-labeled secondary antibody for 50 min at room temperature, and incubated in iF555-Tyramide (1 :500) for 50 min at room temperature in the dark. The nuclei were incubated in DAPI for 10 min at room temperature in the dark. After anti-quenching mounting, visualization was performed using a fluorescence microscope.

[0035] 1.12 Real-time quantitative PCR analysis (RT-qPCR) Total RNA was extracted from HPC and PFC tissues using TRIzol (Invitrogen) according to the manufacturer's protocol. 4 μL of 5x SweScript All-in-One RT SuperMix and 1 μL of gDNA Remover were added to 10 μL of total RNA, and the system was configured to 20 μL using enzyme-free water, and reverse transcription was performed to obtain cDNA. qPCR was performed using 2x Universal Blue SYBR Green qPCR MasterMix, and PCR amplification was completed on a fluorescent quantitative PCR instrument. Three replicate wells were prepared for each sample. The mRNA expression level was calculated using 2 -ΔΔCTMethod analysis; wherein the primer sequences are shown in Table 3.

[0036] Table 3 Primer sequences for RT-qPCR Gene name Primer sequence IL-1β F: TGCCACCTTTTGACAGTGATG R: AAGGTCCACGGGAAAGACAC IL-6 F: TGTGACTCCAGCTTATCTCTTG R: ACAAAGCCAGAGTCCTTCAGAG TNF-α F: CCCTCACACTCAGATCATCTT R: GCTACGACGTGGGCTACAG INOS F: CACCTTGGAAGAGGAGCAACTAC R: GAGCAAAGGCGCAGAACTGA IL-4 F: GGTCTCAACCCCCAGCTAGT R: GCCGATGATCTCTCTCAAGTGAT CD163 F: TGCCTCTGCTGTCACTAACG R: CAAACCACGGACACTTCATTCA Arg-1 F: AGGAAAGCTGGTCTGCTGGAAR: ATTTGAAAGGAGCTGTCATTAGGG β-actin F: GTGACGTTGACATCCGTAAAGAR: GCCGGACTCATCGTACTCC 1.13 Western blotting Proteins in HPC and PFC tissues were extracted using a total protein extraction kit, and after the tissue proteins were quantified to the same concentration according to the BCA protein quantification method, 5x loading buffer was added to the sample, which was heated at 95°C for 10 min and stored at -20°C. The proteins in the sample were separated by 10% SDS-PAGE and transferred to a PVDF membrane, which was blocked with protein-free blocking solution at room temperature for 20 min, and then incubated with primary antibodies anti-IL-1β, anti-IL-6, anti-TNF-α, anti-JAK2, anti-STAT3, anti-pJAK2, anti-pSTAT3, anti-INOS, anti-Arg-1 and anti-β-actin at 4°C overnight. Subsequently, the PVDF membrane was incubated with HRP-labeled secondary antibody at room temperature for 1 h, imaged under a chemiluminescence imager, and analyzed using Image J software.

[0037] 1.14 Statistical analysis All data are expressed as mean ± standard deviation (mean ± SD) and analyzed using SPSS 27.0 (IBM SPSS Statistics, Armonk, NY, USA). One-way ANOVA was used to analyze multiple samples with normal distribution, and post-hoc test was performed using LSD (homoscedastic) or Dunnett's T3 test (heteroscedastic). For non-normally distributed numerical data, the Kruskal-Wallis test was used, and the Mann-Whitney U test was used for post-hoc test. The level of significance was set at P < 0.05. 2. Results and analysis 2.1 Peony leaf extract and its functional ingredients can inhibit the growth of EMs lesion tissue The results are shown in Figure 1-2 .

[0038] It can be seen from Figure 1 and Figure 2 that after 6 weeks of surgical modeling, the abdomen of the Sham group mice was normal abdominal muscle layer, and no ectopic tissue was found; compared with the sham operation group, the Model group mice showed swollen and protruding proliferative tissue, with a weight of about 28.91 mg and a volume of 30.05 mm 3 ( Figure 1 A and B); HE staining found that the proliferative tissue had an endometrial structure, and single-layer columnar epithelial cells were arranged, and there were scattered uterine glands in the endometrial stroma, confirming that it was endometrial ectopic tissue ( Figure 1C); further detection found that EMs of Model group mice were visible Vimentin and E-cadherin labeled uterine stromal cells and epithelial cells, and the single-layer columnar epithelial proliferation of ki67 positive was significant (P<0.01, Figure 2 )。

[0039] Compared with Model group, the ectopic tissue weight and volume of PSL, GA, Api and Com group mice were reduced (P<0.05 or P<0.01), and the ectopic tissue weight of PF group mice was significantly lower than that of Model group, and the volume had a decreasing trend (P>0.05, P >0.05, Figure 1 A and B). Pathological detection found that the reduced ectopic tissue in the abdomen of PSL, GA, PF, Api and Com group and positive control group mice was endometriosis, and uterine stromal cells and epithelial cells were visible, and the fluorescence of Vimentin and E-cadherin in Api group and Com group mice was significantly weakened, and uterine stromal cells and epithelial cells gradually disappeared (Fig. Figure 2 A). Consistent with the fluorescence staining results, Ki67 staining showed that PSL, GA, PF and Api administration and efficacy ingredient combination administration could inhibit EMs cell proliferation, especially in PF and Api administration group, which was more significant, and the effect was equivalent to that of the positive control group (P<0.01, Figure 2 B and C).

[0040] 2.2 Peony leaf extract and its efficacy ingredients can improve the anxiety-like and depression-like behavior of EMs mice Results are shown in Figure 3 .

[0041] From Figure 3 It can be seen that the behavior of the mice was evaluated by the use of behavioral tests to evaluate whether peony leaf extract and its efficacy ingredients can treat anxiety and depression associated with EMs. Before surgery, Von Frey and hot plate tests were used to assess the pain response of mice. One week after surgery, compared with Sham group, MWT and PWL of Model group, PSL group, GA group, PF group, Api group, Com group and positive control group mice were significantly reduced, and MWT of Model group mice continuously decreased to 6 weeks after surgery, and PWL still did not recover at 6 weeks after surgery (P<0.05 or P<0.01, Figure 3 A and B); one week after surgery, PSL group GA group, PF group, Api group, Com group and positive control group had no significant difference in MWT and PWL with Model group (P>0.05, Figure 3 A and B); at 3 weeks after surgery, MWL and PWL of PSL group were significantly higher than those of Model group, and PWL of GA group and Api group mice was significantly increased (P<0.05, Figure 3(A and B); At week 6 post-surgery, the positive control group, PSL group, and active ingredient group all significantly increased PWL in mice; however, only PSL, GA, and Api administration reduced MWL in mice (P < 0.01). Figure 3 (A and B).

[0042] Open field and marble burial tests were used to assess anxiety-like behaviors in mice. The results showed that EMs (extracorporeal membrane oxygenation) did not affect the mice's motor abilities; the distance and speed of movement in the open field were not significantly different between the Model group and the Sham group (P < 0.05). Figure 3 (C and D). Compared with the Model group, mice in the PSL group, GA group, PF group, Api group, Com group, and positive control group had increased activity time and distance in the center of the open field. The marble burial experiment validated the results of the open field experiment; mice in the PSL group, GA group, PF group, Api group, Com group, and positive control group all showed reduced marble burial (P < 0.05 or P < 0.01). Figure 3 E-G) indicates that PSL and its active ingredient can improve anxiety-like behavior induced by EMs. Assessment of depressive-like behavior in mice revealed that, 6 weeks post-surgery, the immobility time of mice in the Model group increased during tail suspension and swimming (P < 0.01). Figure 3 H and J), PSL group, GA group, PF group, Api group, Com group and positive control group all reduced the immobility time of EMs mice in tail suspension and swimming, indicating that PSL and its active ingredients can improve the depressive-like behavior associated with EMs.

[0043] 2.3 Peony leaf extract and its active ingredients can improve hippocampal and prefrontal cortex damage in EMs mice. See results Figure 4-5 .

[0044] Depend on Figure 4-5 It is known that atrophy and reduction in the number of HPC and PFC neurons are important pathological manifestations of anxiety / depression. Six weeks post-surgery, in the Sham group mice, the CA1, CA3, DG regions and PFC neurons in the HPC tissue were abundant, neatly arranged, and had clear cell outlines with clearly visible nucleoli. In contrast, in the Model group mice, the CA1, CA3 regions and PFC neurons in the HPC tissue were loosely and disordered, with condensed or absent nuclei, and a significant reduction in the number of neurons in the DG region. This indicates that both the HPC and PFC neurons in the Model group mice atrophied. Figure 4 ).

[0045] Nissl staining ( Figure 5Further investigation revealed that in the Model group mice, Nissler bodies condensed in the cytoplasm of neurons in the CA1, CA3, and PFC regions of the HPC tissue, and the number of neurons was reduced (P < 0.05 or P < 0.01). Compared with the Model group, the PSL, PF, Api, and Com groups showed a reduction in neurons with pyknosis and nucleolar disappearance in the CA1 and CA3 regions of the HPC tissue, with more orderly cell arrangement and a significant increase in neurons in the DG region. The GA group reduced neuronal damage in the CA1 and CA3 regions of the HPC tissue, but did not improve the loose and disordered cell arrangement in the CA3 region, and the number of neurons in the DG region did not increase. Figure 5 A); and the PSL group, PF group, Api group and Com group significantly improved neuronal damage in PFC, and the number of cells with nuclear pyknosis and nucleolar disappearance was significantly reduced ( Figure 5 D).

[0046] Nissell staining showed that the number of Nissell bodies in the CA1 and CA3 regions and PFC of HPC tissues in mice from the PSL group, GA group, PF group, Api group, Com group, and positive control group was significantly increased compared with that in the Model group (P < 0.05 or P < 0.01). Figure 5 (B, C, and E). This result indicates that PSL, GA, PF, and Api treatment can improve HPC and PFC atrophy and neuronal reduction caused by EMs, and the combined treatment of PSL, PF, Api, and GA+PF+Api is significantly effective.

[0047] 2.4 Peony leaf extract and its active ingredients can reduce the expression of inflammatory factors in EMs mice. See results Figure 6-7 .

[0048] Depend on Figure 6-7 It is known that the inflammatory response induced by EMs, which releases inflammatory factors that are transported to the central nervous system, is considered an important factor triggering anxiety / depression. Detection of inflammatory factor levels in mouse brain tissue revealed that the serum levels of IL-1β, IL-6, and TNF-α in the Model group mice were higher than those in the Sham group. Further examination of inflammatory factor expression in mouse HPC and PFC showed that the Model group mice had higher mRNA levels and protein expression of IL-1β, IL-6, and TNF-α in their brains (P < 0.05 or P < 0.01). Figure 6 and Figure 7 PSL, GA, PF, Api, and Com all reduced serum IL-1β and IL-6 levels in EMs mice, while only PSL, GA, Api, Com, and the positive control group reduced serum TNF-α levels (P < 0.05 or P < 0.01). Figure 6A-C), and PSL, GA, PF, Api, Com, and the positive control group all reduced the mRNA levels and protein expression of IL-1β, IL-6, and TNF-α in HPC (P < 0.05 or P < 0.01). Figure 6 D─K).

[0049] Further investigation revealed the effects of PSL and its active ingredients on inflammatory factors in the pulmonary fibrotic cells (PFC) of EMs mice. The results showed that PSL, GA, PF, Api, Com, and the positive control group reduced the mRNA levels of IL-1β, IL-6, and TNF-α, and the protein expression of IL-1β and IL-6. Furthermore, except for PF, all other treatment groups reduced the protein expression of TNF-α in the PFC (P < 0.05 or P < 0.01). Figure 7 The results above show that PSL and its active ingredient groups can reduce the levels of inflammatory factors in EMs mice.

[0050] 2.5 Peony leaf extract and its active ingredients inhibit M1 polarization of microglia in EMs mice See results Figure 8 .

[0051] Depend on Figure 8 It is known that continuous stimulation by inflammatory factors can promote microglial M1 polarization and promote neuroinflammation. Detection of microglial polarization in the brain revealed that, compared with the Sham group, the Model group showed increased mRNA and protein expression of iNOS in brain tissue (P < 0.01 or P < 0.05). Figure 8 A, E, G, and K), while the mRNA expression of the anti-inflammatory M2 marker CD163 and the M2 immunomodulatory factor IL-4 was decreased (P < 0.01 or P < 0.05). Figure 8 (B, C, H, and I), Arg-1 protein expression decreased (P < 0.01 or P < 0.05, Figure 8 The F and L values ​​indicate that M1 polarization of microglia in the brains of Model group mice is activated while M2 polarization is inhibited, which is consistent with the increase of IL-1β, IL-6 and TNF-α in the brain tissue of EMs mice.

[0052] Following treatment with PSL, GA, PF, Api, and Com, the mRNA levels of the M2 biomarkers CD163 and IL-4 in HPC increased, Arg-1 protein expression was upregulated, and except for the PF group, all other groups showed a decrease in the mRNA level and protein expression of the M1 biomarker iNOS (P < 0.01 or P < 0.05). Figure 8A-F); in addition, PSL, Api and Com could simultaneously increase the expression of CD163, IL-4 and Arg-1, and decrease the expression of iNOS in PFC, GA and PF also had a trend of decreasing M1 markers and increasing M2 markers (P<0.01 or P<0.05, Figure 8 G-L). The above results showed that the peony leaf extract and its functional ingredient group could inhibit the M1 polarization of microglial cells in EMs mice and promote the M2 polarization.

[0053] In summary, this study showed that PSL and its functional ingredients GA, PF, Api and their combination could slow down the growth rate of EMs lesions, inhibit microglial cell M1 polarization, promote M2 polarization, and thus inhibit neuroinflammation, reduce EMs-related pain and anxiety / depression-like behavior, which could provide support for the preparation of drugs for treating endometriosis with anxiety or depression.

[0054] The foregoing description of specific exemplary embodiments of the application is intended to be illustrative only and is not intended to limit the scope of the application. Many changes and modifications can be suggested by those skilled in the art, and it is intended that the scope of the application be limited only by the scope of the appended claims. The exemplary embodiments have been chosen and described in order to explain the principles of the application and the practical application. The selection and description of these exemplary embodiments are not intended as limitations on the application, and many modifications and variations are possible in light of the above teachings without departing from the spirit of the application. It is intended that the scope of the application be defined solely by the claims appended hereto.

Claims

1. A peony leaf extract, characterized in that, The preparation method of the peony leaf extract is as follows: dried peony leaves are refluxed with 70% ethanol at 90°C three times for 2 hours each time, concentrated and then spray-dried to obtain the peony leaf extract.

2. The use of the peony leaf extract and its active ingredients as described in claim 1 in the preparation of a drug for treating endometriosis accompanied by anxiety or depression.

3. The application of the peony leaf extract and its active ingredients as described in claim 1 in inhibiting microglial M1 polarization, promoting M2 polarization, and inhibiting neuroinflammation.

4. The application according to claim 2 or claim 3, characterized in that, The active ingredients in the peony leaf extract include apigenin, paeoniflorin, and gallic acid.

Images