Cryptocaryon irritans cathepsin L as well as gene, mutant gene and application thereof

Abstract

The invention provides cryptocaryon irritans cathepsin L as well as a gene, a mutant gene and application thereof. Belongs to the field of gene engineering, and more specifically, an amino acid sequence of the cryptocaryon irritans cathepsin L provided by the invention is shown as SEQ ID No.1, a nucleotide sequence of the cryptocaryon irritans cathepsin L gene is shown as SEQ ID No.2, and mutant genes of the cryptocaryon irritans cathepsin L gene are shown as SEQ ID No.3 and SEQ ID No.5. The cryptocaryon irritans cathepsin L and the cryptocaryon irritans cathepsin L gene provided by the invention can be used for preventing and treating cryptocaryon irritans.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, in particular, to stimulating Cryptocaryon irritans cathepsin L, its gene, mutant gene and application. BACKGROUND

[0002] Cryptocaryon irritans, as a specific parasitic ciliate causing white spot disease of marine fish, its life cycle includes four stages of trophont, precyst, cyst and larva, and it can complete a reproductive cycle in 6 days at a suitable temperature. Cryptocaryon irritans larvae can invade the skin and gill tissue of host fish through body surface cilia movement, causing epithelial cell damage and gill filament fusion, leading to death of the host due to respiratory difficulty or secondary infection, and the mortality of economic fish such as Pseudosciaena crocea can reach more than 90%. The cyst wall of Cryptocaryon irritans cyst is composed of chitin, protein and the like, and can resist penetration of conventional drugs, and the infectious larvae released after the division of the cyst inside the worm are easy to cause a new round of infection. However, the commonly used drugs such as copper sulfate and formaldehyde not only easily cause water pollution and ecological toxicity, but also are difficult to break through the protection of the cyst wall and cannot effectively kill the worms, resulting in poor prevention and control effect. Prevention and control has become a worldwide problem, and identifying and studying the genes and functions of Cryptocaryon irritans is a new breakthrough point for screening safe and effective prevention and control targets.

[0003] In the field of gene editing technology, although the existing methods can target key genes, there are problems of low efficiency and poor practicability. For example, traditional plasmid transfection and lentivirus infection technology is easy to cause random insertion of exogenous genes into the host genome, causing immunogenicity risk; RNA interference technology is easy to degrade double-stranded RNA in seawater environment, and needs to be continuously administered, which is complicated and high in cost. Molecular marker technologies such as RAPD and AFLP are used for insect resistance detection, but mainly focus on gene marker analysis rather than direct functional knockout, and are not widely used in gene editing of protozoan parasites. In addition, in the development of anti-parasite vaccines, although there are antigen-based vaccine studies, traditional methods rely on known viral vectors, and the immunogenicity and safety are uncertain, and there is still a lack of efficient gene targeting strategies for Cryptocaryon irritans vaccines. SUMMARY

[0004] The purpose of the present application is to provide a Cryptocaryon irritans cathepsin L, its gene, mutant gene and application, which is used to solve the above problems.

[0005] The first aspect of the present application provides a Cryptocaryon irritans cathepsin L, the amino acid sequence of which is shown in SEQ ID No. 1, or a variant having at least 95% sequence identity with SEQ ID No. 1 and retaining the activity of cathepsin L.

[0006] The application provides a cysteine protease L of Cryptocaryon irritans for the first time, the cysteine protease L of Cryptocaryon irritans is a key functional protein of the cyst development of Cryptocaryon irritans, participates in protein degradation and cyst formation, and the hatching mechanism of Cryptocaryon irritans can be specifically blocked by knocking out or inactivating the protein, so that the larvae cannot be normally released.

[0007] The application provides a cysteine protease L gene of Cryptocaryon irritans, the cysteine protease L gene encodes the cysteine protease L of Cryptocaryon irritans in claim 1, and the nucleotide sequence of the cysteine protease L gene is shown in SEQ ID No. 2 or a variant having at least 90% sequence identity and encoding the same functional protein.

[0008] The application provides a mutant gene of the gene in the second aspect, and the nucleotide sequence of the mutant gene is shown in SEQ ID No. 3.

[0009] The application provides an sgRNA for producing the mutant gene in the third aspect, the sgRNA is named C1-sgRNA, and the nucleotide sequence of the C1-sgRNA is shown in SEQ ID No. 4.

[0010] The application provides a mutant gene of the gene in the second aspect, and the nucleotide sequence of the mutant gene is shown in SEQ ID No. 4.

[0011] The application provides an sgRNA for producing the mutant gene in the fifth aspect, the sgRNA is named C2-sgRNA, and the nucleotide sequence of the C2-sgRNA is shown in SEQ ID No. 6.

[0012] The cysteine protease L gene of Cryptocaryon irritans is used as an editing target, the activity of the cysteine protease L encoded by the gene directly affects the life history of the worm body, the CRISPR / Cas9 RNP technology can induce efficient knockout by targeting the gene, causes a gene fragment to be deleted or a frame shift mutation, can cause the mRNA expression level to be greatly reduced, and thus further blocks protein expression, and the effect solves the problem of low editing efficiency of Cryptocaryon irritans.

[0013] The application provides a use of the mutant gene in the third aspect or the fifth aspect in preparation of an anti-Cryptocaryon irritans vaccine or an anti-Cryptocaryon irritans drug.

[0014] When the mutant gene is used for preparing a vaccine or a drug, the infectivity of the worm body can be destroyed by making the worm body express a defective protein, so that the prevention and treatment of the sea white spot disease are achieved. Meanwhile, the vaccine or the drug used in the application is free of copper sulfate, adopts a non-chemical intervention means, and is more friendly to the environment.

[0015] The eighth aspect of the present application provides a kit for detecting the expression level of the Cathepsin L gene of Cryptocaryon irritans according to the second aspect, and is characterized in that the kit comprises a primer pair shown in SEQ ID No. 7-SEQ ID No. 8, wherein, SEQ ID No. 7: ACAAAGGTGCTGTTACTCCAAT; SEQ ID No. 8: CATAGTCCATCAAACCTCCCTC.

[0016] Compared with the prior art, the present application has the following beneficial effects: 1. The present application directly destroys the function of the key protein of the cyst development of Cryptocaryon irritans by stimulating the mutant gene of the Cathepsin L gene of Cryptocaryon irritans, thereby solving the problem of strong resistance of Cryptocaryon irritans in the cyst stage. 2. The existing chemical method needs repeated administration, which is not only complicated to operate but also causes environmental pollution; the traditional biological technology (such as a virus carrier) is complex and high in cost, and the mutant gene provided by the present application can be quickly introduced, is simple to operate, and reduces the side effects on fish. Meanwhile, the mutant gene provided by the present application does not need copper sulfate and formaldehyde in the use process, and is friendly to the environment.

[0017] 3. The prior art lacks precise gene targets for Cryptocaryon irritans, which limits the development of vaccines or drugs, and the mutant gene provided by the present application can be directly used for preparing attenuated live vaccines or screening inhibitors, and induces host immunity or blocks infection by expressing defective proteins. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 It is the nucleic acid electrophoresis verification result in the embodiment 1 of the present application; Figure 2 It is the detection result of the mRNA expression level of CiCatL gene in each group in the embodiment 2 of the present application; Figure 3 It is the WB detection result of the CiCatL protein expression amount in each group in the embodiment 2 of the present application; Figure 4 It is the statistical result of the cyst hatching rate and the larva hatching amount in the S1 group in the embodiment 3 of the present application; Figure 5 It is the statistical result of the cyst hatching rate and the larva hatching amount in the S2 group in the embodiment 3 of the present application. DETAILED DESCRIPTION

[0019] In order to make the above objectives, features and advantages of the present application more apparent, specific embodiments of the present application are described in detail below. It should be noted that the following embodiments are only used to illustrate the implementation method and typical parameters of the present application, and are not used to limit the parameter range described in the present application, and the reasonable changes derived therefrom are still within the protection scope of the claims of the present application.

[0020] It should be noted that the endpoints of the ranges and any values disclosed herein are not limited to the precise values stated. The ranges and values should be interpreted as approximately between the stated values. For ranges, the endpoints are included between the stated values, and the stated values are included within the stated ranges. For example, a range from 1 to 10 should be interpreted to include from 1 to 10, and 1 to 10, and 1 to 10, etc.

[0021] Unless otherwise defined, all terms, symbols and other scientific terminology used herein are intended to have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to mean that the terms are in any way being redefined or reinterpreted in a manner that would depart from the generally accepted and understood meanings of the terms. Technical methods described or referenced herein are generally well known to those skilled in the art and are employed by conventional methods unless otherwise stated. Unless otherwise stated, the use of commercially available kits and reagents, and instruments are performed according to the protocols and parameters given by the manufacturer.

[0022] In the following examples, unless otherwise specified, Cryptocaryon irritans cathepsin L has the same meaning as CiCatL, and Cryptocaryon irritans cathepsin L gene has the same meaning as CiCatL gene.

[0023] Example 1 Discovery of CiCatL gene Total RNA was extracted from the cysts, and total RNA was extracted using a reverse transcription kit to synthesize cDNA. The specific primer CA-10 of CiCatL gene was designed by prime5 to amplify the gene, wherein the sequence of the upstream primer is shown in SEQ ID No. 9, and the sequence of the downstream primer is shown in SEQ ID No. 10.

[0024] SEQ ID No. 9: CAGTGTCAGTTTATGATTCCTA; SEQ ID No. 10: ATCCTTCCTCACCCCAGTATGT.

[0025] Reaction program: 1 cycle × (95℃ pre-denaturation, 2 min) + 35 cycles × (95℃ denaturation, 30 s, 53℃ annealing, 30 s, 72℃ extension, 30 s) + 1 cycle × (72℃ extension, 5 min).

[0026] The amplified product was ligated with pMD19-T cells and transformed into DH5α competent cells. Positive clones were then used for sequence verification. The verification results are as follows: Figure 1 As shown, Figure 1 In the sequence, lane M is the Maker, lane 1 is the negative control, and lane 2 is the positive clone. The nucleic acid in lane 2 was recovered by gel extraction and sequenced. The sequencing results are shown in SEQ ID No. 2.

[0027] Example 2 Validation of CiCatL gene editing effect In response to the CiCatL gene discovered in Example 1, two sgRNAs were designed in this example, named C1-sgRNA and C2-sgRNA, respectively. The nucleotide sequence of C1-sgRNA is shown in SEQ ID No. 4, and the target sequence of C1-sgRNA is 5'-TAATAATGTGGATCATGTGC-3'. The nucleotide sequence of C2-sgRNA is shown in SEQ ID No. 6, and the target sequence of C2-sgRNA is 5'-TCTAATGAACCTTCGTGTAG-3'.

[0028] SEQ ID No.4: 5'-GATCACtaatacgactcactataggTAATAATGTGGATCATGTGCGTTTTAGAGCTAGAAATAGCAAGT-3'; SEQ ID No. 6: 5'-GATCACtaatacgactcactataggTCTAATGAACCTTCGTGTAGGTTTTAGAGCTAGAAATAGCAAGT-3'.

[0029] The Cas9 protein (10 μg) was mixed with C1-sgRNA (15 μg) to form an RNP complex, which was labeled Cas9C1. The Cas9 protein (10 μg) was mixed with C2-sgRNA (15 μg) and labeled Cas9C2.

[0030] The Cas9C1 is transformed into the stimulated Cryptocaryon irritans cysts by electroporation, recorded as experimental group 1 (S1), the Cas9C2 is transformed into the stimulated Cryptocaryon irritans cysts by electroporation, recorded as experimental group 2 (S2), the blank treatment is taken as control group 1 (D1), the Cas9 is transformed into the stimulated Cryptocaryon irritans cysts by electroporation, recorded as control group 2 (D2), the C1-sgRNA is transformed into the stimulated Cryptocaryon irritans cysts by electroporation, recorded as control group 3 (D3), the C2-sgRNA is transformed into the stimulated Cryptocaryon irritans cysts by electroporation, recorded as control group 4 (D4). All the control groups and experimental groups are set with 4 parallels, and the electroporation parameters are as follows: voltage 1200V, capacitance 25uF, resistance 200Ω, pulse interval time 5ms, and after electroporation, the stimulated Cryptocaryon irritans cysts are transferred into seawater and cultured in a constant temperature incubator at 27°C until the larva stage. Under normal circumstances, the in vitro culture can grow to the 4th day, and the larvae are completely hatched 72h after electroporation. The genomic DNA of all the experimental groups and control groups is extracted, and the qPCR method is used to compare the target gene expression difference of the larvae in all the experimental groups and control groups. The upstream primer used in the qPCR is shown as SEQ ID No. 7, and the downstream primer used in the qPCR is shown as SEQ ID No. 8.

[0031] SEQ ID No. 7: ACAAAGGTGCTGTTACTCCAAT; SEQ ID No. 8: CATAGTCCATCAAACCTCCCTC.

[0032] The qPCR reaction program is as follows: 1 cycle x (95℃ pre-denaturation, 1min) + 40 cycles x (95℃ denaturation, 30s, 60℃ annealing, 30s), and the final CiCatL gene mRNA expression level detection result is shown as Figure 2 Figure 2 It can be seen that the C1-sgRNA and C2-sgRNA provided by the application can effectively reduce the expression level of the CiCatL gene.

[0033] The WB analysis is performed on the CiCatL protein expression of the control group 1, the experimental group 1 and the experimental group 2, and the result is shown as Figure 3 Figure 3 It can be seen that the CiCatL protein expression in the experimental group 1 and the experimental group 2 is significantly reduced compared with the control group, which proves that the C1-sgRNA and C2-sgRNA provided by the application can effectively reduce the expression amount of the CiCatL protein.

[0034] Example 3 Worm body test On the basis of example 2, the cysts of all the control groups and experimental groups are cultured at 27°C until the cysts are completely hatched, the cyst hatching rate and the number of larvae hatched in each group are counted, and the result is as follows:​​Figures 4-5 A in the table is the statistical result of the cyst hatching rate of D1, D2 and S1 groups, Figure 4 B in the table is the statistical result of the number of larvae hatched of D1, D2 and S1 groups, Figure 4 A in the table is the statistical result of the cyst hatching rate of D1, D2, D4 and S2 groups, Figure 5 B in the table is the statistical result of the number of larvae hatched of D1, D2, D4 and S2 groups. Figure 5 It can be seen that after corresponding RNP treatment, the cysts basically no longer develop by hatching, and the number of hatched larvae is significantly reduced, wherein the hatching rate of S1 group is 17%, and the hatching rate of S2 group is 5%, both of which are significantly lower than those of the control group. This proves that the CiCatL gene, CiCatL protein and sgRNA provided by the application have great potential in stimulating the control of cryptosporidium. Figures 4-5

[0035] Although the present disclosure is disclosed as above, the protection scope of the present disclosure is not limited to this. Those skilled in the art can make various modifications and changes without departing from the spirit and scope of the present disclosure, and these modifications and changes shall fall within the protection scope of the present disclosure.​

Claims

1. A cathepsin L stimulant from Cryptocaryon worms, characterized in that, The amino acid sequence of the Cryptocaryon cathepsin L stimulator is as shown in SEQ ID No. 1, or a variant having at least 95% sequence identity with SEQ ID No. 1 and retaining cathepsin L activity.

2. Stimulation of the Cryptocaryon cathepsin L gene, characterized in that, The Cryptocaryon stimulant cathepsin L gene encodes the Cryptocaryon stimulant cathepsin L of claim 1, wherein the nucleotide sequence of the Cryptocaryon stimulant cathepsin L gene is as shown in SEQ ID No. 2, or a variant having at least 90% sequence identity with it and encoding the same functional protein.

3. The mutated gene of claim 2, characterized in that, The nucleotide sequence of the mutated gene is shown in SEQ ID No.

3.

4. An sgRNA for producing the mutant gene of claim 3, characterized in that, The sgRNA is named C1-sgRNA, and the nucleotide sequence of the C1-sgRNA is shown in SEQ ID No.

4.

5. The mutated gene of claim 2, characterized in that, The nucleotide sequence of the mutated gene is shown in SEQ ID No.

5.

6. An sgRNA for producing the mutant gene of claim 5, characterized in that, The sgRNA is named C2-sgRNA, and the nucleotide sequence of the C2-sgRNA is shown in SEQ ID No.

6.

7. The use of the mutated gene as described in claim 3 or 5 in the preparation of anti-irritant Cryptocaryon var. irritans vaccines or anti-irritant Cryptocaryon var. irritans drugs.

8. A kit for detecting the expression level of the Cryptocaryon cathepsin L gene as described in claim 2, characterized in that, Includes the primer pairs shown in SEQ ID No. 7 to SEQ ID No. 8, wherein, SEQ ID No.7: ACAAAGGTGCTGTTACTCCAAT; SEQ ID No. 8: CATAGTCCATCAAACCTCCCTC.

Images