TLR4 agonist based on divalent nucleic acid aptamer

Abstract

The invention belongs to the technical field of biomedicine, and discloses a TLR4 agonist based on a divalent nucleic acid aptamer. The invention discloses a DNA (deoxyribonucleic acid) agonist. The DNA agonist comprises two sections of TLR4 (toll-like receptor 4) aptamer sequences and a connecting chain for connecting the two sections of TLR4 aptamer sequences. The invention provides a brand new DNA agonist based on a nucleic acid aptamer for a homodimeric TLR4 receptor. Compared with a traditional TLR4 agonist (which is relatively strong in immunogenicity, relatively low in safety and relatively high in artificial synthesis cost), the DNA agonist provided by the invention can realize obvious TLR4 receptor dimerization signal activation, and can well generate downstream signal transduction to cause phosphorylation activation of NF-kb and erk proteins, so that the DNA agonist can be used for preparing the TLR4 receptor. Therefore, the cell can be promoted to generate inflammatory factors so as to regulate and control immune cell behaviors, and the method has potential application in the fields of cell therapy and regenerative medicine.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a TLR4 agonist based on a bivalent nucleic acid aptamer. Background Technology

[0002] With the deepening interdisciplinary collaboration between chemistry and life sciences, research using chemical tools to analyze biological problems is increasingly penetrating the forefront of life science research. Nucleic acid molecules serve as a crucial bridge between chemistry and life sciences. Functional nucleic acids, in addition to their traditional genetic information storage function, possess other special functions such as specific recognition and efficient catalysis. They mainly include aptamers and DNAzymes. Generally obtained through in vitro screening, they can specifically recognize target molecules and perform corresponding functions, while exhibiting good biocompatibility, sequence designability, and structural stability. Therefore, they are widely used as artificial molecular recognition units in fields such as chemical biosensing. With the rapid development of bioanalytical chemistry and biomedicine, functional nucleic acids such as aptamers are of great significance for the research of novel cell receptor agonists.

[0003] Nucleic acid aptamers, as functional nucleic acids, are composed of single-stranded DNA or RNA and exhibit high specificity and affinity for their targets, representing a novel type of recognition ligand. Generally, nucleic acid aptamers are derived through systematic evolution of ligands using exponential enrichment techniques. Ligands are screened using Exponential Enrichment (SELEX) to target a wide range of molecules, including small molecules, biomacromolecules, bacteria, stem cells, and cancer cells. Nucleic acid aptamers, often called "chemists' antibodies," possess a binding ability comparable to antibodies in many respects. The dissociation constant (Kd) of most nucleic acid aptamer-target complexes is in the nM range, while the dissociation constant of most antibodies is between 1 and 10 nM. Furthermore, because nucleic acid aptamers are synthesized chemically, they can be chemically modified to achieve different experimental purposes, making them highly cost-effective compared to antibodies.

[0004] Toll-like receptors (TLRs) constitute the largest family of pattern recognition receptors. They recognize pathogen-associated molecular patterns (PAMPs) or damage-associated molecular patterns (DAMPs), activating innate immune responses and subsequently promoting adaptive immune responses, acting as a bridge between these two immune responses. TLR4 (Toll-like receptor 4) is an important member of the Toll-like receptor family, playing a crucial role in the innate immune system. It recognizes pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS), causing homodimerization and activating downstream pathways. Through MyD88-dependent and MyD88-independent pathways, it activates NF-κB and IRF3, regulating inflammatory responses and antiviral immunity. TLR4 is widely involved in the pathological mechanisms of infectious diseases, chronic inflammation, metabolic disorders, and cancer, making it an important target for immunomodulation and targeted therapy.

[0005] Lipopolysaccharide (LPS), as a natural TLR4 agonist, has several drawbacks. Its main problem is poor safety, potentially triggering strong inflammatory responses such as cytokine storms, fever, hypotension, and even shock. Long-term exposure may also lead to immune paralysis and immune tolerance. Furthermore, LPS activation of the immune system lacks specificity, failing to precisely target pathogens or tumor cells, limiting its clinical application. While existing synthetic TLR4 agonists, such as lipid monophosphate A (MPLA) and glucopyranolipase A (GLA), have improved immunogenicity, they still suffer from low specificity, easily activating other TLRs, unclear induced signaling pathways and immune responses, complex manufacturing processes, high production costs, insufficient specificity in immune responses, difficulty in precisely activating immune responses against pathogens or tumors, and the potential to induce immune tolerance. Therefore, developing a novel TLR4 agonist is of great significance in the field of immunomodulatory biomedicine. Summary of the Invention

[0006] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a DNA agonist of the TLR4 receptor, which can induce homodimerization activation of the TLR4 receptor and further trigger downstream signal transduction of the TLR4 receptor, generating corresponding inflammatory factors and regulating cellular immunity, and has potential applications in the fields of cell therapy and regenerative medicine.

[0007] The first aspect of the present invention is to provide a DNA agonist.

[0008] The second aspect of this invention is to provide a method for preparing the DNA agonist of the first aspect of this invention.

[0009] A third aspect of the present invention aims to provide the use of the DNA agonist of the first aspect of the present invention in activating the TLR4 receptor, preparing a product that activates the TLR4 receptor, activating downstream signal transduction of the TLR4 receptor, or preparing a product that activates downstream signal transduction of the TLR4 receptor.

[0010] The fourth aspect of the present invention aims to provide the use of the DNA agonist of the first aspect of the present invention in promoting cell proliferation, preparing products that promote cell proliferation, promoting cell migration, and preparing products that promote cell migration.

[0011] The fifth aspect of this invention aims to provide a product.

[0012] The sixth aspect of this invention aims to provide a method for promoting cell proliferation or migration.

[0013] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0014] In a first aspect, the present invention provides a DNA agonist comprising two TLR4 aptamer sequences and a linker strand for connecting the two TLR4 aptamer sequences.

[0015] In some embodiments of the present invention, the nucleotide sequence of the TLR4 aptamer sequence is shown in SEQ ID NO:8.

[0016] In some embodiments of the present invention, the connecting chain includes connecting chain 1 and connecting chain 2, wherein the sequences of connecting chain 1 and connecting chain 2 are reverse complementary.

[0017] In some embodiments of the present invention, the nucleotide sequence of the linker chain 1 is ACAGTCATTGAATAGCCTACGTC (SEQ ID NO:9) or a partial sequence thereof.

[0018] In some embodiments of the present invention, the nucleotide sequence of the linker chain 1 is ACAGTCATTGAATAGCCTAC (SEQ ID NO:10), ACAGTCATTGAATAGCCTG (SEQ ID NO:11), ACAGTCATTGAATAGC (SEQ ID NO:12), ACAGTCATTGAA (SEQ ID NO:13), ACAGTCATTGA (SEQ ID NO:14), or ACAGTCATTG (SEQ ID NO:15).

[0019] In some embodiments of the present invention, the nucleotide sequence of the linker strand 2 is GACGTAGGCTATTCAATGACTGT (SEQ ID NO:16) or a partial sequence thereof.

[0020] In some embodiments of the present invention, the nucleotide sequence of the linker chain 2 is GTAGGCTATTCAATGACTGT (SEQ ID NO:17), TAGGCTATTCAATGACTGT (SEQ ID NO:18), GCTATTTCAATGACTGT (SEQ ID NO:19), TTCAATGACTGT (SEQ ID NO:20), TCAATGACTGT (SEQ ID NO:21), or CAATGACTGT (SEQ ID NO:22).

[0021] In some embodiments of the present invention, the nucleotide sequence of the DNA agonist is shown in any one of SEQ ID NO:1-SEQ ID NO:7.

[0022] This invention, based on the monovalent DNA aptamer (i.e., the TLR4 nucleic acid aptamer), constructs a series of bivalent aptamers for screening to identify the optimal DNA agonist that activates TLR4. By adjusting the thermodynamic stability through base complementarity pairing, an effective stem-loop structure is formed in the TLR4 nucleic acid aptamer within the DNA agonist. Figure 1 Simulations using AlphaFold 3 software showed that the stem-loop structure of the DNA agonist can bind well to the TLR4 receptor and cause TLR4 receptor dimerization. Figure 2 It can better bind to the receptor and cause receptor dimerization to activate downstream signaling pathways.

[0023] The DNA agonist according to embodiments of the present invention has at least the following beneficial effects:

[0024] The DNA agonist of this invention possesses good sequence designability and structural stability, is easy to synthesize, inexpensive, and has good versatility. This DNA agonist can specifically induce TLR4 dimerization activation, further triggering downstream signal transduction in the TLR4 pathway, and inducing cell proliferation and migration, producing corresponding inflammatory factors, and regulating cellular immunity (cell behavior regulation, such as cell migration), thus having potential applications in cell therapy and regenerative medicine.

[0025] The term "agonist" refers to a drug that binds to a target (e.g., a receptor) and activates or increases the biological activity of the target.

[0026] The terms "nucleic acid aptamer," "DNA aptamer," or "nucleic acid aptamer sequence" are interchangeable and refer to a single-stranded oligonucleotide that can specifically bind to a target molecule. In this invention, the target molecule refers to TLR4.

[0027] A second aspect of the present invention provides a method for preparing the DNA agonist of the first aspect of the present invention, comprising the following steps: ligating two TLR4 aptamer sequences to linker strand 1 and linker strand 2 respectively to obtain two DNA sequences: TLR4 aptamer sequence-linker strand 1 and linker strand 2-TLR4 aptamer sequence; diluting, mixing, denaturing, annealing and cooling the two DNA sequences respectively to obtain the DNA agonist.

[0028] In some embodiments of the present invention, the denaturation conditions are high-temperature denaturation at 94–98°C for 4–8 min; more specifically, high-temperature denaturation at 94–96°C for 4–6 min.

[0029] In some embodiments of the present invention, the annealing cooling is performed by placing the annealed material at room temperature and allowing it to slowly anneal and cool, folding it to form a stable state.

[0030] In some embodiments of the present invention, the mixing ratio (concentration) is 1:(1-2); more specifically, it is 1:1.

[0031] A third aspect of the invention provides the use of the DNA agonist of the first aspect of the invention in any one of (a1)-(a4):

[0032] (a1) Activates TLR4 receptor;

[0033] (a2) Prepare products that activate the TLR4 receptor;

[0034] (a3) Activates downstream signal transduction of the TLR4 receptor;

[0035] (a4) Prepare products that activate downstream signal transduction of the TLR4 receptor.

[0036] In some embodiments of the present invention, the product includes reagents, kits, or drugs.

[0037] A fourth aspect of the invention provides the use of the DNA agonist of the first aspect of the invention in any one of (b1)-(b4):

[0038] (b1) Promotes cell proliferation;

[0039] (b2) Prepare products that promote cell proliferation;

[0040] (b3) Promotes cell migration;

[0041] (b4) Prepare products that promote cell migration.

[0042] In some embodiments of the present invention, the cells include macrophages.

[0043] In some embodiments of the present invention, the product includes reagents, kits, or drugs.

[0044] A fifth aspect of the invention provides a product comprising the DNA agonist of the first aspect of the invention.

[0045] In some embodiments of the present invention, the product includes reagents, kits, or drugs.

[0046] In some embodiments of the present invention, the product has at least one of the following functions: activation of TLR4 receptor dimerization signal, activation of downstream signal transduction of TLR4 receptor, and regulation of cell behavior (such as proliferation, migration, etc.).

[0047] In some embodiments of the invention, the product further includes pharmaceutically acceptable excipients and / or diluents. The pharmaceutically acceptable excipients and / or diluents should be miscible with the DNA agonist. The diluent may be a phosphate buffer solution, water, etc. The excipients are selected from one or any combination of binders, fillers, plasticizers, flow aids, disintegrants, and lubricants. The excipients and / or diluents can be formulated using well-known conventional methods.

[0048] A sixth aspect of the present invention provides a method for promoting cell proliferation or migration, comprising the step of contacting a DNA agonist of the first aspect of the present invention or a product of the fifth aspect of the present invention with cells.

[0049] In some embodiments of the present invention, the cells include macrophages.

[0050] In some embodiments of the present invention, the effective dose of the DNA agonist in the method is 10-300 nM; more specifically, it is 10-200 nM.

[0051] The beneficial effects of this invention are:

[0052] This invention provides a novel nucleic acid aptamer-based DNA agonist for the homodimeric TLR4 receptor. Compared to traditional TLR4 agonists (which have strong immunogenicity, low safety, and high synthetic costs), the DNA agonist provided by this invention can significantly activate TLR4 receptor dimerization signals and effectively generate downstream signal transduction, inducing phosphorylation activation of NF-κB and erk proteins, thereby promoting the production of inflammatory factors and regulating immune cell behavior. This DNA agonist holds promise for providing a new approach to regulating the body's immune capacity in the biomedical field, such as in cancer treatment and enhancing vaccine efficacy. This DNA agonist has promising potential applications in biomedicine and other fields and holds promise for the development of novel nucleic acid drugs. Attached Figure Description

[0053] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0054] Figure 1 This is a schematic diagram of the structure of the DNA agonist (left figure) or TLR4 aptamer sequence (middle and right figures) of the present invention.

[0055] Figure 2 This is a simulation result of the DNA agonist of the present invention using AlphaFold 3 software.

[0056] Figure 3 This document describes the optimization of DNA agonist truncation and the characterization of TLR4 homodimerization activation. Specifically: a) Immunoblotting characterization of optimized DNA aptamer linker strand truncation; b) Schematic diagram of TLR4 homodimerization activation; c) Laser confocal imaging characterization of TLR4 homodimerization induced by the DNA agonist AF16; d) Flow cytometry characterization of TLR4 homodimerization induced by the DNA agonist AF16; e) Immunoblotting characterization of TLR4 homodimerization activation induced by the DNA agonist AF16.

[0057] Figure 4 This diagram illustrates the downstream signal transduction of TLR4 homodimerization activated by DNA agonists. Specifically: a) Schematic diagram of downstream signaling activation of TLR4 homodimerization induced by DNA agonist AF16. b) Immunoblot characterization of IKK, NF-κB, and Erk1 / 2 phosphorylation activated by DNA agonist AF16. c) Characterization of RAW264.7 cell proliferation induced by DNA agonist using the CCK8 assay. d) RAW264.7 cell migration assay induced by DNA agonist AF-16, scale bars = 10 μm. e) Statistical analysis of the relative migration of RAW264.7 cells induced by DNA agonist AF16. Data are expressed as SD ± mean, *** represents P < 0.001, **** represents P < 0.0001. Detailed Implementation

[0058] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0059] Unless otherwise specified in the examples, the procedures should be performed under standard conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available products.

[0060] Experimental materials:

[0061] DNA strands: purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0062] PBS: Purchased from Guangzhou Zhuanyan Biotechnology Co., Ltd., brand: SRB (product number SRB003-500ML);

[0063] Bovine serum albumin V: Purchased from Guangzhou Zhuanyan Biotechnology Co., Ltd., brand: Solarbio (item number A8020);

[0064] PVDF membrane (0.45μm): purchased from Guangzhou Zhuanyan Biotechnology Co., Ltd., brand: Merck (item number IPVH00010);

[0065] p-IKK antibody: purchased from Univita Biotechnology, brand: Cell Signaling Technology (catalog number 2697S);

[0066] p-NFKB antibody: purchased from Univita Biosciences, brand: Affinity Biosciences (catalog number AF2006);

[0067] p-erk antibody: purchased from Unimicron Biotechnology, brand: Cell Signaling Technology (catalog number 4370S);

[0068] TLR4 antibody: purchased from Univita Biosciences, brand: Affinity Biosciences (catalog number AF7017);

[0069] MYD88 antibody: purchased from Univita Biotechnology, brand: Cell Signaling Technology (item number 4283S);

[0070] TRAF6 antibody: purchased from Univita Biosciences, brand: Affinity Biosciences (catalog number AF5006);

[0071] FDbio-Pico ECL chemiluminescence solution: purchased from Hangzhou Fude Biotechnology Co., Ltd., brand: Fude Bio (product number FD8000).

[0072] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0073] Example 1

[0074] This embodiment provides a TLR4 agonist based on a bivalent nucleic acid aptamer, designated as F16 (or AF-16), F10, F12, F14, F18, F20, and F23. The nucleotide sequences of these TLR4 agonists are shown in SEQ ID NO:1 to SEQ ID NO:7, and detailed sequence information is shown in Table 1. The underlined portion represents the TLR4 nucleic acid aptamer sequence (GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATA CGAG, SEQ ID NO:8). Nucleotides 60-75 of the TLR4 aptamer sequence are anticomplementary to nucleotides 1-16 of the TLR4 aptamer sequence, forming a stem-loop structure. The bolded and italicized portions are connecting strands, and their sequences are anticomplementary.

[0075] The preparation method of the above-mentioned TLR4 agonist includes the following steps: the two synthesized DNA strands (taking F16 as an example, the two DNA strands are GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAGACAGTCATTGAATAGC (SEQ ID NO:23) and GCTATCAATGACTGTGGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCG GTTGGCCCTAAATACGAG (SEQ ID NO:24)) are respectively added to deionized water and diluted to a suitable concentration, vortexed for 3 min, mixed at a concentration ratio of 1:1, denatured at 95°C for 5 min, and then placed at room temperature for slow annealing and cooling to fold into a stable state.

[0076] Table 1. Nucleotide sequences of TLR4 agonists

[0077]

[0078]

[0079] Effect Example

[0080] The TLR4 agonist in Example 1 was characterized and its ability to activate the homodimer receptor and induce downstream signal transduction of the TLR4 homodimer receptor was verified using confocal cell imaging, flow cytometry, Western blotting, and cell proliferation assays.

[0081] 1. Experimental Methods

[0082] (1) Laser confocal cell imaging

[0083] Because RAW264.7 cells highly express the TLR4 receptor, they were selected as model cells for experiments, and the TAMRA group was modified onto the TLR4 agonist. First, the cells (RAW264.7 cells) were seeded in 35 mm confocal dishes and cultured for 12 h in a 37°C incubator containing 5% CO2. Then, they were washed twice with PBS buffer, and 1 mL of serum-free 1640 medium containing 300 nM fluorescent aptamer (i.e., the TAMRA-modified TLR4 agonist) was added. After incubation for 10 min, the serum-free 1640 medium containing the fluorescent aptamer was removed and replaced with serum-free 1640 medium. Real-time live-cell imaging was performed using a laser confocal scanning microscope (CLSM, Zeiss) at a 40× oil immersion lens. The excitation wavelength was 560 nm, and the emission collection filter was 560-620 nm. Fluorescence intensity was quantitatively analyzed using ImageJ. The difference between the control group and the experimental group was that the TLR4 agonist was not added.

[0084] (2) Flow cytometry

[0085] RAW264.7 cells were seeded in 100 mm cell culture dishes and, when they reached 80% confluence, were washed twice with PBS, digested with enzyme-free digestion solution for 15 min, aliquoted into 2 mL centrifuge tubes, and centrifuged at 4°C for 5 min (650 rcf). The supernatant was discarded. Cells were incubated for 20 min at 37°C on a shaker with PBS containing a fluorescent aptamer (i.e., a TAMRA-modified TLR4 agonist). After incubation, the supernatant was discarded, cells were washed twice with PBS, resuspended in PBS containing 2% serum, and analyzed via membrane filtration. The control group differed from the experimental group in that the TLR4 agonist was not added.

[0086] (3) Preparation of protein samples for immunoblotting experiments

[0087] RAW264.7 cells were seeded in 35 mm cell culture dishes and starved for 24 h when they reached 80% confluence. The culture medium was then changed from 1640 medium containing 10% FBS to 1640 medium containing 0.2% FBS. After 24 h of starvation, the culture medium was aspirated, and the corresponding concentration of DNA strand (i.e., the TLR4 agonist from Example 1) solution (PBS containing 5 mM MgCl2) was added. The cells were co-incubated at 37°C for 12 min, then aspirated. The cells were washed twice with pre-cooled PBS solution, and lysed with RIPA lysis buffer (containing 1% phosphatase inhibitor and protease inhibitor). The lysed cells were scraped off with a cell scraper and placed in a 1.5 mL centrifuge tube. The cells were centrifuged at 4°C for 10 min (10000 rcf), and the supernatant was collected and stored at -20°C for later use. This step was performed entirely on ice.

[0088] (4) Immunoblotting assay

[0089] In a new 1.5 mL centrifuge tube, protein loading buffer (i.e., the supernatant obtained in (3)) and RIPA lysis buffer were premixed at a ratio of 1:4. The mixture was denatured at 95 °C for 5 min, centrifuged at 4 °C for 5 min (speed 10000 rcf), and 20 μL of the supernatant was loaded onto the sample. Electrophoresis was performed on an 8% SDS-PAGE gel at a constant voltage of 80 V for 1 h, and then the voltage was increased to 120 V for 30 min. After electrophoresis, a transfer experiment was performed to transfer the protein onto a 0.45 μm PVDF membrane. The wet transfer method was used. After transferring the membrane at a constant current of 300 mA for 2 h in the transfer buffer, the PVDF membrane was blocked in 5% BSA-TBST solution for 2 h. After blocking, the PVDF membrane was cut into different fragments according to molecular weight, and the corresponding primary antibody was added. The reaction was carried out overnight at 4 °C. The next day, the membrane was washed three times with TBST for 10 minutes each time, then the fluorescent secondary antibody was added and reacted at room temperature for 1 hour. After that, it was washed three times with TBST for 10 minutes each time, and then immersed in TBST for color development using a multifunctional imaging system. The difference between the control group and the experimental group was that no TLR4 agonist was added.

[0090] (5) Cell proliferation experiment

[0091] After resuscitating and passaged RAW264.7 cells for at least three generations, approximately 5000 cells per well were seeded into 96-well plates. After 24 hours of adherence, 0, 10 nM, 20 nM, 50 nM, 100 nM, and 200 nM of the TLR4 agonist solution from Example 1 (solvent: PBS containing 5 mM MgCl2) were added to each well, with six auxiliary wells for each concentration. After incubation at 37°C for 24 hours, serum-free 1640 medium containing 10% CCK-8 reagent was added, and the cells were incubated at 37°C in the dark for 30 minutes. The OD value at 450 nm was measured using a microplate reader. The control group differed from the experimental group in that no TLR4 agonist was added.

[0092] Calculate cell viability using the following formula:

[0093] Cell viability (%) = [A(drug-treated) - A(blank)] / [A(0-drug-treated) - A(blank)] × 100%

[0094] A (drug addition): OD values ​​of the pores containing cells, CCK-8 solution, and drug solution;

[0095] A(0 drug added): OD value of the well containing cells and CCK-8 solution but no drug solution;

[0096] A (blank): OD value of pores without cells.

[0097] (6) Cell scratch test

[0098] RAW264.7 cells were suspended in 1640 medium containing 10% fetal bovine serum and added to 96-well plates to maintain a cell concentration of 1*10⁻⁶ cells / well. 5 / well, placed in an incubator for adherent culture. After 24 hours, the medium was replaced with medium containing 0.2% serum. After 12 hours of starvation culture, a horizontal line was drawn along the midline of the cells using a 200μL pipette tip, ensuring the tip was vertical and not tilted. The cells were washed twice with PBS to remove the drawn cells. Medium containing 0.2% serum was added, and DNA agonists were added to treat different groups. Samples were taken and photographed under a microscope at 0 hours, 12 hours, and 24 hours.

[0099] All of the above experiments were repeated three times.

[0100] 2. Experimental Results

[0101] (1) Activation and characterization of TLR4 aptamer homodimerization

[0102] To characterize whether the nucleic acid aptamer-based DNA agonist of this invention (i.e., the TLR4 agonist AF-16 of Example 1) can successfully and specifically bind to the TLR4 receptor, RAW264.7 cells were selected as model cells for the experiment because they highly express the TLR4 receptor. First, a TAMRA group was modified onto AF-16 (denoted as AF16-TAMRA), and characterization was performed using confocal cell imaging experiments. The results of the confocal cell imaging experiments showed that the cells treated with AF16-TAMRA exhibited significantly higher fluorescence signals compared to the cells treated with Control. Figure 3 (c). Flow cytometry experiments also showed that the fluorescence intensity of the AF16-TAMRA group was higher than that of the CON group ( Figure 3 (d). Confocal cell imaging and flow cytometry experiments demonstrated that the TLR4 agonist AF16 can successfully and specifically bind to the TLR4 receptor.

[0103] After characterizing the successful binding of the DNA agonist to the TLR4 receptor, the inventors then used Western blotting to analyze whether the DNA agonist could activate the high expression of proteins such as TLR4 and MYD88, as well as IKK phosphorylation. The results showed that treatment with 10 nM of the DNA agonist AF-16 significantly increased the expression levels of MYD88, TRAF6, and PIKK in cells. Figure 3 (a and b). And it exhibits a concentration gradient dependence in the range of 10 nM to 200 nM ( Figure 3 (e). This indicates that the DNA agonist successfully induced the activation of the homodimer receptor signaling.

[0104] To further verify the effect of the linker strand on the DNA agonist in this invention, DNA agonists with linker strands of different lengths (i.e., F10, F12, F14, F18, F20, and F23 in Example 1) were designed. Western blotting analysis showed that F10, F12, F14, F18, F20, and F23 could all activate the high expression of proteins such as TLR4 and MYD88, as well as IKK phosphorylation. Figure 3 (a and b).

[0105] (2) DNA agonists successfully activated downstream signaling of the TLR4 homodimer receptor;

[0106] To assess the ability of the DNA agonist AF-16 to induce TLR4 homodimerization and activate downstream signaling pathways of the receptor, the inventors used Western blotting to evaluate the activation of NF-κB and Erk1 / 2 kinases by the DNA agonist AF-16. Figure 4(a) These molecules are phosphorylated after activation by upstream p-Ikk and Traf6. NF-kb and Erk1 / 2 are phosphorylated at 10 nM of DNA agonist. Figure 4 (b) shows a good gradient response between 10-200 nM. This indicates that the DNA agonist AF-16 successfully induced downstream signal transduction of the TLR4 homodimer receptor.

[0107] After TLR4 receptor signaling is activated and transduced, cells produce inflammatory factors, thereby stimulating immune cells to produce corresponding behaviors. The inventors further investigated whether the DNA agonist AF-16 could elicit a cellular behavioral response. Cell proliferation and migration were characterized using CCK8 and cell scratch assays. The CCK8 assay showed that cells treated with the DNA agonist AF-16 significantly promoted cell proliferation compared to the control group, and exhibited a good concentration gradient response within the 10-100 nM range. Figure 4 (c). Furthermore, cell scratch assays showed that cells treated with the DNA agonist AF-16 exhibited a higher (20%) cell migration rate compared to the control group. Figure 4 (d and e). The above results demonstrate that the DNA agonist AF-16 successfully induced macrophage proliferation and migration.

[0108] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. A DNA agonist, characterized in that, The DNA agonist comprises two TLR4 aptamer sequences and a linker strand for connecting the two TLR4 aptamer sequences.

2. The DNA agonist according to claim 1, characterized in that, The nucleotide sequence of the TLR4 aptamer is shown in SEQ ID NO:

8.

3. The DNA agonist according to claim 1, characterized in that, The connection chain includes connection chain 1 and connection chain 2, and the sequences of connection chain 1 and connection chain 2 are inversely complementary.

4. The DNA agonist according to claim 3, characterized in that, The nucleotide sequence of linker 1 is ACAGTCATTGAATAGCCTACGTC or a partial sequence thereof; and / or, the nucleotide sequence of linker 2 is GACGTAGGCTATTCAATGACTGT or a partial sequence thereof.

5. The DNA agonist according to any one of claims 1-4, characterized in that, The nucleotide sequence of the DNA agonist is shown in any one of SEQ ID NO:1-SEQ ID NO:

7.

6. A method for preparing the DNA agonist according to claim 3 or 4, comprising the following steps: Two TLR4 aptamer sequences were ligated to linker strand 1 and linker strand 2, respectively, to obtain two DNA sequences: TLR4 aptamer sequence-linker strand 1 and linker strand 2-TLR4 aptamer sequence. The two DNA sequences were then diluted, mixed, denatured, annealed, and cooled to obtain the DNA agonist.

7. The use of the DNA agonist according to any one of claims 1-5 in any one of (a1)-(a4): (a1) activating the TLR4 receptor; (a2) Prepare products that activate the TLR4 receptor; (a3) Activates downstream signal transduction of the TLR4 receptor; (a4) Prepare products that activate downstream signal transduction of the TLR4 receptor.

8. The use of the DNA agonist according to any one of claims 1-5 in any one of (b1)-(b4): (b1) promoting cell proliferation; (b2) Prepare products that promote cell proliferation; (b3) Promotes cell migration; (b4) Prepare products that promote cell migration.

9. A product comprising the DNA agonist according to any one of claims 1-5.

10. A method for promoting cell proliferation or migration, comprising the step of contacting a cell with a DNA agonist of any one of claims 1-5 or a product of claim 9.

Images