Cell line for expressing Fc [gamma] RIIA variant and construction method thereof
By constructing a FcγRIIA variant with partial removal of intracellular domains and stably expressing it in host cells, the debate on the impact of CD32a polymorphism on HIV affinity has been resolved, enabling the application of stable expression cell lines and promoting research on HIV latency mechanisms, antibody display library screening, and CAR-T drug development.
Patent Information
- Application Number
- CN202511099788.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-05-16
- Filing Date
- 2025-08-07
- Publication Date
- 2025-11-18
AI Technical Summary
In the prior art, the polymorphism of CD32a leads to differences in the affinity of CD4+ T cells for HIV, affecting the immune response. The debate over whether CD32a is a marker of the HIV latent infection reservoir remains unclear.
A variant of FcγRIIA with some intracellular domains removed was constructed, and PCR amplification was performed using designed specific primers. The resulting compound was then incorporated into the PLVX-EGFP-puro vector, packaged into a lentivirus, and used to infect host cells, resulting in a 293T cell line that stably expresses ΔCD32a-131H and ΔCD32a-131R.
A cell line stably expressing the FcγRIIA variant was achieved, improving its stability after cryopreservation and thawing. This is suitable for research on HIV latency mechanisms and screening of CD32a phage antibody display libraries, thus promoting the development of anti-CD32a CAR-T drugs.
Smart Images
Figure CN120966831A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of immunological molecular biology, and particularly relates to an Fc gamma RIIA variant with part of intracellular domain removed, a host cell expressing the protein and a construction method thereof. BACKGROUND
[0002] CD32a was discovered as a marker of HIV latent viral reservoir in 2017, however, scientists have found that CD32a only serves as a marker of CD4 + T cell activation. This controversy has not yet reached a clear result so far.
[0003] Recently, it has been reported that the expression of CD32a in cells has polymorphism, which may cause differences in the affinity of CD4 + T cells, monocytes and other immune cells to HIV. Different polymorphisms of CD32a can cause differences in the function of CD4 + T cells, thereby affecting the downstream immune response. Therefore, it is speculated that the controversy over whether CD32a is a marker of HIV latent viral reservoir may be related to the polymorphism of CD32a. SUMMARY
[0004] To solve the above problems, the present application provides an Fc gamma RIIA variant with part of intracellular domain removed, and the coding gene sequence is shown as SEQ ID NO: 1 or 2.
[0005] The present application also provides a method for constructing a cell line expressing the Fc gamma RIIA variant, comprising the following steps:
[0006] S1: constructing a gene expression vector of the Fc gamma RIIA variant, and the coding gene sequence of the Fc gamma RIIA variant is shown as SEQ ID NO: 1 and 2;
[0007] S2: transforming the expression vector into a packaging cell to package into a lentivirus;
[0008] S3: infecting a host cell with the purified lentivirus to obtain a cell line expressing the Fc gamma RIIA variant.
[0009] In one specific embodiment, the Fc gamma RIIA is expressed in fusion with a tag in the gene expression vector.
[0010] In one specific embodiment, the tag is GFP.
[0011] In one specific embodiment, the gene expression vector is a recombinant lentivirus expression vector.
[0012] In one specific embodiment, the host cell is 293T cell, and the packaging cell is 293T cell into which a lentivirus packaging plasmid and an envelope plasmid are introduced.
[0013] The present application also provides the host cell line expressing FcγRIIA constructed by the above method.
[0014] The present application also provides the use of the above host cell line expressing FcγRIIA in the study of the effect of CD32a on HIV infection.
[0015] The present application constructs a stable cell line that can stably express FcγRIIA variants (ΔCD32a-131H and ΔCD32a-131R), and the freeze-thaw recovery experiment shows that the cell line has good passaging ability after freeze-thaw recovery and can be stably passaged. BRIEF DESCRIPTION OF DRAWINGS
[0016] Figure 1 Agarose gel electrophoresis map of the two FcγRIIA amplification products after removal of part of the intracellular domain.
[0017] Figure 2 Vector map of PLVX-EGFP-puro.
[0018] Figure 3 Flow cytometry titer detection results of purified lentivirus Lenti-ΔCD32a-131H (1-741 bp)-EGFP-puro and Lenti-ΔCD32a-131R (1-738 bp)-EGFP-puro.
[0019] Figure 4 Fluorescence microscope pictures (400 times) of ΔCD32a-131H and ΔCD32a-131R stable cell lines. DETAILED DESCRIPTION
[0020] The principles and features of the present application are described below in conjunction with the accompanying drawings, and the examples are only used to explain the present application and are not intended to limit the scope of the present application.
[0021] 1. Amplification of FcγRIIA without intracellular domain
[0022] According to the published human FcγRIIA sequence on NCBI, specific expression primers are designed to construct PLVX-FcγRIIA-EGFP-puro mutant plasmid without intracellular domain.
[0023] The primer sequences are as follows:
[0024] FcγRIIA-EcoRI-F: gtcgtgaggatctatttccggtgaattc ATGACTATGGAGACCCA AATG (SEQ ID NO: 3);
[0025] FcγRIIA-EcoRI-R: tcctcgcccttgctcaccatgaattc TGAAATCCGCTTTTTCCTG (SEQ ID NO: 4).
[0026] Two FcγRIIA variants including extracellular domain, transmembrane domain and partial intracellular domain were obtained by PCR amplification with the above primers: ΔCD32a-131H (SEQ ID NO: 1) and ΔCD32a-131R (SEQ ID NO: 2). The agarose gel electrophoresis map of PCR products is shown in Figure 1
[0027] 2. FcγRIIA expression plasmid without intracellular domain PLVX-FcγRIIA-EGFP-puro
[0028] The FcγRIIA sequence was recombined into the PLVX-EGFP-puro vector (the plasmid map is shown in Figure 2 ) by homologous recombination. The specific method is as follows: the PLVX-EGFP-puro vector was linearized with EcoRI, and then was combined with the FcγRIIA 1-741 bp (ΔCD32a-131H) and FcγRIIA 1-738 bp (ΔCD32a-131R) amplified fragments to perform homologous recombination by using Ultra-Universal OneStep Seamless Cloning Mix. The next day, three colonies were randomly picked for colony PCR identification. The positive colonies were sent for sequencing, and the sequencing results were consistent with the corresponding segments of the FcγRIIA preserved in the laboratory.
[0029] 3. Lentivirus packaging, purification and titer determination
[0030] In order to obtain high-purity lentivirus, the inventors co-transfected 293T cells with the target plasmid and packaging plasmid and envelope plasmid, then purified by ultracentrifugation and performed virus titer determination.
[0031] The specific operation is as follows: 293T cells are inoculated at 5x10^6 cells per dish to 12 10 cm dishes one day in advance, and the next day, the plasmid:GAG:BZ3K is transfected at a ratio of 5:3:2, 10 μg of total plasmid is required for each 10 cm dish, and PEI is 30 μL, to package the lentivirus. After 12 hours, 5 mL of DMEM complete medium is added per dish, and after 72 hours, the supernatant is harvested. The lentivirus Lenti-ΔCD32a-131H (1-741 bp)-EGFP-puro and Lenti-ΔCD32a-131R (1-738 bp)-EGFP-puro are purified by centrifugation at 300xg for 10 min and 25000g for 3h, and are aliquoted and stored at -80°C.
[0032] 5x10^5 cells per well of 293T cells are taken, which are prepared into a 2 mL system and placed in a 6-well plate. To each well of the above cells, 0 μL, 0.5 μL, 1 μL, and 3 μL of the 10-fold diluted lentivirus preparation are added, respectively, and polybrene is added to each well to a final concentration of 4 μg / mL, mixed, and incubated at 37°C in a 5% CO2 incubator for 72 hours. Rabbit serum immunized with CD32a is used as the primary antibody, and 7-AAD is used for restaining. The virus titer is determined by flow cytometry, and the results are as follows Figure 3
[0033] The virus titers are determined to be 1x10^8 Tu / mL and 5x10^7 Tu / mL, respectively.
[0034] 4. Obtaining of ΔCD32a-131H and ΔCD32a-131R 293T stable cell lines
[0035] In order to obtain CD32a-131H and CD32a-131R 293T stable cell lines, the inventors used the packaged and purified lentivirus Lenti-ΔCD32a-EGFP-puro to infect 293T cells, and obtained 293T cell lines stably expressing ΔCD32a-131H and ΔCD32a-131R by puromycin selection.
[0036] The specific steps are as follows: 293T cells are inoculated at a concentration of 2x10^5 cells per well into a six-well plate, and the next day, the lentivirus is inoculated at an MOI of 3, and the wells without lentivirus infection are used as controls. After 72 hours of culture, puromycin is added for selection, and the final concentration is 4 μg / mL, until the control group dies completely. After another 2-3 days of culture, the drug concentration is reduced to half of the original, and the drug is continuously added, and the culture is continued for 5 generations. The obtained stable cell lines are identified by fluorescence microscope and flow cytometry. The fluorescence microscope results are as follows Figure 4 As shown, there is abundant EGFP expression in the stable cell lines. The purity is 98.89% and 99.05% respectively by flow cytometry detection, proving that the stable cell lines capable of stably expressing ΔCD32a-131H and ΔCD32a-131R are obtained.
[0037] After multiple freezing experiments, compared with the previous full-length CD32a-131H (951bp) and CD32a-131R (951bp) Molt4 cell lines, the recovery after freezing is more stable, so as to be used for HIV latent mechanism research, CD32a 131H or 131R phage antibody display library screening, anti-CD32a CAR-T drug research, etc. The full-length CD32a-131H and CD32a-131R Molt4 cell lines appear a large number of deaths after freezing and recovery, and cannot continue to be subcultured.
[0038] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. An FcγRIIA variant with partial intracellular domain deletion, characterized in that, The coding gene sequence is shown as SEQ ID NO: 1 or 2.
2. A method of constructing a cell line expressing a FcyRIIA variant, characterized in that, The method comprises the following steps: S1: constructing a gene expression vector of the FcγRIIA variant, wherein the coding gene sequence of the FcγRIIA variant is shown as SEQ ID NO: 1 or 2; S2: transforming the expression vector into a packaging cell to package into a lentivirus; S3: infecting a host cell with the purified lentivirus to obtain a cell line expressing the FcγRIIA variant.
3. The method of claim 2, wherein, In the gene expression vector, the FcγRIIA variant is expressed in fusion with a tag.
4. The method of claim 3, wherein, The tag is GFP.
5. The method of claim 2, wherein, The gene expression vector is a recombinant lentivirus expression vector.
6. The method of claim 2, wherein, The host cell is a 293T cell, and the packaging cell is a 293T cell into which lentivirus packaging plasmid and envelope plasmid are transformed.
7. A cell line expressing a FcγRIIA variant, characterized in that, The cell line is constructed by the method of any one of claims 2-6.
8. The cell line expressing the FcγRIIA variant of claim 7 is applied in the research of the effect of CD32a on HIV infection.