TaFRPs gene and its application in increasing wheat folic acid content

By knocking out the TaFRP gene in wheat using gene editing technology and increasing the folic acid content of wheat using the CRISPR-Cas9 system, the problem of low folic acid content in wheat has been solved, and high-folic acid wheat has been cultivated.

CN120966847BActive Publication Date: 2026-03-06THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511516136.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-23
Publication Date
2026-03-06
Estimated Expiration
2045-10-23

AI Technical Summary

Technical Problem

Wheat has a low folic acid content, which is insufficient to meet the nutritional needs of the human body. Furthermore, the utilization efficiency of chemically synthesized folic acid varies depending on the genotype of the population. No research has been reported on gene editing technology to increase the folic acid content of wheat.

Method used

By knocking out the TaFRP-1A-1, TaFRP-1A-2, TaFRP-1B-1, TaFRP-1B-2, and TaFRP-1D genes in wheat using gene editing technology, sgRNA targets were designed using the CRISPR-Cas9 system, gene editing vectors were constructed, and five homozygous edited plants were obtained, significantly increasing folic acid content.

Benefits of technology

It significantly increases the folic acid content in wheat grains, creating high-folic acid wheat that meets the nutritional needs of the human body.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120966847B_ABST
    Figure CN120966847B_ABST
Patent Text Reader

Abstract

This invention discloses TaFRPs Genes and their application in increasing wheat folic acid content. TaFRPs Genes include TaFRP‑ 1A‑1 , TaFRP‑1A‑2 , TaFRP‑1B‑1 , TaFRP‑1B‑2 , TaFRP‑1D The nucleotide sequences of the samples are shown in SEQ ID NO: 1-SEQ ID NO: 5. By simultaneously knocking out five homologous proteins of TaFRP in wheat, five homozygous edited plants with five mutations were obtained. Analysis of the folic acid content in the mature grains of the edited plants revealed a significant increase in total folic acid content, indicating that this method can effectively increase the folic acid content in wheat grains and is an effective strategy for creating high-folate wheat.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically involving TaFRPs Genes and their application in increasing wheat folic acid content. Background Technology

[0002] Folic acid belongs to the B vitamins (B9) and includes tetrahydrofolate and various derivatives such as 5-methyltetrahydrofolate and 5-formyltetrahydrofolate. Folic acid participates in important biological processes such as nucleic acid, amino acid, and pantothenic acid synthesis and methylation modification, and is an essential substance for maintaining normal life activities in all living organisms. Plants and microorganisms can synthesize folic acid de novo, but the human body lacks the ability to synthesize folic acid itself and mainly relies on dietary intake. Insufficient folic acid intake can lead to various diseases, such as megaloblastic anemia in pregnant women, neural tube defects in newborns, and increases the risk of cardiovascular disease and cancer. Ensuring adequate daily dietary folic acid intake is of great significance for improving population health.

[0003] Wheat is an important food crop; however, its folic acid content is low, making it difficult to meet the body's nutritional needs. Some Western countries have attempted to alleviate folic acid deficiency by forcibly adding chemically synthesized folic acid to flour. However, chemically synthesized folic acid is in an oxidized form, which needs to be metabolized and reduced to its reduced form, 5-methyltetrahydrofolate, in the body before it can be absorbed and utilized. The enzymes responsible for folic acid metabolism and reduction exhibit genotypic differences and significantly varying enzyme activities among different populations, leading to some individuals' inability to effectively utilize chemically synthesized folic acid. In contrast, plants primarily synthesize 5-methyltetrahydrofolate, which can be directly absorbed and utilized by the body. Therefore, cultivating wheat varieties rich in naturally occurring folic acid is a crucial way to ensure adequate folic acid intake for the human body.

[0004] Gene editing technology, utilizing the CRISPR-Cas9 gene editing system, enables precise modification of specific target genes in the genome, playing a crucial role in improving wheat quality and disease resistance. However, research on using gene editing technology to increase wheat folic acid content has not yet been reported. Therefore, creating folic acid-rich wheat varieties through gene editing technology is essential for ensuring the folic acid nutritional needs of the population. Summary of the Invention

[0005] The purpose of this invention is to provide TaFRPs Genes and their application in increasing wheat folic acid content.

[0006] TaFRPs Genes, including TaFRP-1A-1 , TaFRP-1A-2 , TaFRP-1B-1 , TaFRP-1B-2 , TaFRP-1DTheir nucleotide sequences are shown as SEQ ID NO:1-SEQ ID NO:5, respectively.

[0007] TaFRPs proteins include TaFRP-1A-1, TaFRP-1A-2, TaFRP-1B-1, TaFRP-1B-2, and TaFRP-1D, whose amino acid sequences are shown in SEQ ID NO: 6-SEQ ID NO: 10, respectively.

[0008] The TaFRPs Application of the gene or the TaFRPs protein in increasing wheat folic acid content.

[0009] A method to increase wheat folic acid content using gene editing technology, simultaneously knocking out the... TaFRP-1A-1 , TaFRP-1A-2 , TaFRP-1B-1 , TaFRP-1B-2 and TaFRP-1D Gene.

[0010] The two specific targets of the gene editing are sgRNA1 and sgRNA2, whose nucleotide sequences are shown in SEQ ID NO: 11-SEQ ID NO: 12, respectively.

[0011] The beneficial effects of this invention are as follows: By simultaneously knocking out five homologous proteins of TaFRP in wheat, five-mutant homozygous edited plants were obtained. Analysis of the folic acid content of mature grains from the edited plants revealed a significant increase in total folic acid content, indicating that this method can effectively increase the folic acid content in wheat grains and is an effective strategy for creating high-folic acid wheat. Attached Figure Description

[0012] Figure 1 For wheat TaFRP A schematic diagram of the coding region sequence of homologous genes and the location of target sites.

[0013] Figure 2 Five genes were found in the gene-edited wheat plant KO-TaFRP-7. TaRFP Results of homologous gene target gene sequence identification.

[0014] Figure 3 Total folic acid content in grains of gene-edited wheat plant KO-TaFRP-7; WT, wild type. Detailed Implementation

[0015] To facilitate understanding of the present invention, a more comprehensive description will be given below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0016] Example 1: Construction of wheat gene editing vector and wheat genetic transformation

[0017] Using gene editing technology, five homologous genes of wheat folate-associated protein (TaFRP) were simultaneously knocked out. The five genes are... TraesCS1A01G310400 ( TaFRP-1A-1 ), TraesCSC1A01G400600 ( TaFRP-1A-2 ), TraesCS1B01G321700 ( TaFRP-1B-1 ), TraesCS1B02G321600 ( TaFRP-1B-2 )and TraesCS1D01G309900 ( TaFRP-1D Based on the conserved coding sequences of the five TaFRP homologous genes, two specific target sites were designed: sgRNA1: AGGTTTTGCTCCGACCATGG and sgRNA2: AGGTTTAGCTCCGACCATGG. These target sites were ligated into the pWMB110 vector containing a CRISPR / Cas9 editor to construct an editing vector that simultaneously knocks out all five TaFRP homologous genes. The constructed vector was then introduced into Agrobacterium tumefaciens strain GV3101.

[0018] Using immature embryos of wheat variety Jimai 22 as explants, two Agrobacterium engineered strains containing the target were mixed to infect the explants, and T0 generation positive transformed wheat plants were obtained through tissue culture.

[0019] Obtained through wheat genetic transformation TaFRPs Gene-edited strains, after multiple generations of screening and identification, were obtained. TaFRP 5 The stable line KO-, in which all homologous gene genome sequences have been edited. TaFRP -7, in this strain TaFRP-1A-1 There is a 1bp deletion at the target location. TaFRP-1A-2 There is a 1bp deletion at the target location. TaFRP-1B-1 There is a 2bp deletion at the target location. TaFRP-1B-2 There is a 1bp deletion at the target location. TaFRP-1D There is a 1bp deletion at the target location ( Figure 1 These base deletions cause changes in the amino acid sequence of the proteins encoded by the five homologous genes at the target site, prematurely terminating the protein's structure. Figure 2 ).

[0020] Example 2: Genotyping and Folic Acid Content Detection of Gene-Edited Wheat

[0021] DNA sequences extracted from T0 generation positive transformed wheat plants were used as templates to design specific primers for amplification. TaFRPs Genomic sequence, PCR product sequencing analysis TaFRPGene editing process. The PCR reaction was performed using the specific upstream primers listed in Table 1 and the universal reverse primer TaFRP-ABDR. The reaction mixture consisted of: 10 μL of 2×Taq Master Mix, 0.5 μL of upstream primer (10 μM), 0.5 μL of downstream primer TaGFT-ABDR (10 μM), approximately 100 ng of genomic DNA, and ddH2O to a total volume of 20 μL. The reaction program was as follows: pre-denaturation at 95℃ for 5 min; followed by 35 cycles of amplification (denaturation at 95℃ for 15 seconds, annealing at 58℃ for 20 seconds, extension at 72℃ for 45 seconds); and a final extension at 72℃ for 3 minutes.

[0022] Table 1 TaFRPs Gene sequence-specific amplification primers

[0023]

[0024] After screening and identification, lines with edited sequences at all five homologous gene target sites were obtained. T1 generation seeds were harvested for subsequent planting. T1 generation seedlings were treated with glufosinate (1.5‰ concentration) on their leaves. Plants with yellowing leaves (indicating the absence of T-DNA insertion cassettes) were selected for further DNA extraction to identify gene editing at the five homologous gene target sites. Lines with edited target genes were selected, and T2 generation seeds were harvested. Genotyping of T2 and T3 generation seedlings was continued to obtain stable homozygous edited lines. Folic acid content was determined from the harvested T3 generation seeds. Thirty mature seeds were randomly selected, ground into a uniform powder, and folic acid derivatives were extracted using phosphate buffer and rat serum. The supernatant was filtered to remove impurities and then analyzed by high-performance liquid chromatography-mass spectrometry.

[0025] Compared with the total folate content of wild-type control wheat (26.24±3.51 μg / 100 g grain), the total folate content of gene-edited wheat KO-TaFRP-7 grain was significantly increased (120.99 ± 21.21 μg / 100 g grain), indicating that knocking out five homologous genes of TaFRP can effectively increase the total folate content of wheat.

[0026] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. Knocking out TaFRPs application of the gene or TaFRPs protein in increasing folate content in wheat, characterized in that, The TaFRPs Genes include TaFRP-1A-1 , TaFRP-1A-2 , TaFRP-1B-1 , TaFRP-1B-2 and TaFRP-1D , the nucleotide sequences of which are shown in SEQ ID NO: 1-SEQ ID NO: 5, respectively; the TaFRP proteins include TaFRP-1A-1, TaFRP-1A-2, TaFRP-1B-1, TaFRP-1B-2 and TaFRP-1D, the amino acid sequences of which are shown in SEQ ID NO: 6-SEQ ID NO: 10, respectively.

2. A method of increasing folate content in wheat, characterized by, using gene editing techniques, while knocking out the genes of claim 1 TaFRP-1A-1 , TaFRP-1A-2 , TaFRP-1B-1 , TaFRP-1B-2 and TaFRP-1D .

3. The method of increasing folate content in wheat of claim 2, wherein, The two specific targets of the gene editing are sgRNA1 and sgRNA2, and the nucleotide sequences thereof are shown in SEQ ID NO: 11-SEQ ID NO: 12, respectively.