MRNA (messenger ribonucleic acid) expression vector and application thereof

Abstract

The invention provides an mRNA expression vector and application thereof, and belongs to the technical field of mRNA vaccines. The 5 'UTR of the three groups of mRNA expression vectors provided by the invention is from alpha-globin or human beta-globin, and the 3' UTR is from alpha 1 or beta-globin of human chromosome 16. The norovirus GII.4VP1 gene sequence of an epidemic strain in China is respectively connected to the three groups of mRNA expression vectors, and results show that the three groups of mRNA vaccines constructed by the invention can express the norovirus VP1 protein, and the expression quantity of pcDNA-GII.4-m1 is high. The bivalent vaccines of the pcDNA-GII.4-m1 and the pcDNA-GI.1-m1, which are constructed by using the pcDNA-m1 vector, can be used for inducing good body fluid and cellular immunity in a mouse body.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of mRNA vaccine, and particularly relates to an mRNA expression vector and application thereof. BACKGROUND

[0002] Human norovirus (NoV) belongs to Caliciviridae and Norovirus genus, is a single-stranded positive-strand RNA virus, has a diameter of 26-35 nm, has no envelope, is spherical, has a full-length of about 7.5-7.7 Kb, encodes three reading frames, ORF2 encodes the main capsid protein VP1, and 90 VP1 dimers constitute the icosahedral capsid protein (about 55 kDa). According to the diversity of VP1 amino acid sequence, NoV can be divided into 10 gene groups and 49 genotypes, wherein GI, GII, GIV, GVIII and GIX gene groups can infect humans; in the past few decades, GII.4 genotype has been prevalent globally, and six GII.4 variants have caused global pandemics.

[0003] Norovirus is one of the main pathogens causing global non-bacterial gastroenteritis, and the human population is generally susceptible. However, the development of vaccines is hindered by the following factors: multiple genotypes of norovirus, fast mutation speed, weak cross-protection between genotypes, lack of small animal models and in vitro cell culture systems, etc. At present, there is no norovirus vaccine on the market globally, and the vaccines in the clinical experiment stage include virus-like particle (VLP) vaccines, adenovirus vector vaccines and mRNA multivalent vaccines expressed by different systems. There are also various norovirus vaccines in clinical trials in China, such as the norovirus vaccines (GI.1, GII.3, GII.4 and GII.17 genotypes) of Anhui ZhiFei LongKeMa Biopharmaceutical Co., Ltd. and the norovirus vaccines (GII.4, GI.1 genotypes) of Lanzhou Institute of Biological Products Co., Ltd., which are all VLP injection type vaccines.

[0004] In mRNA vaccine research, vaccine vector and antigen design are core links. They are not only related to the expression level and duration of antigen in vivo, but also affect the type of antibody response and its affinity and other key immune parameters. The main elements of non-replicative mRNA vaccine include 5' cap, 5' untranslated region (UTR), open reading frame (ORF), 3' untranslated region and polyadenine nucleotides [poly (A) tail structure. Non-coding region (UTR) plays an important role in mRNA recognition, initiation, correct translation and stabilization of mRNA. Among them, 5' UTR promotes mRNA small ribosome subunit scanning and positioning of start codon and binding of ribosome to start its translation, and its structural characteristics and functional characteristics can affect protein expression efficiency. After capping, it can inhibit the degradation of RNA by exonuclease, and stabilize mRNA. 3' UTR usually contains cis elements and regulatory motifs of RNA binding protein (RBP), which can regulate mRNA translation, stability, and tissue and cell localization. The polyA structure after 3' UTR can protect the mRNA coding region from the action of de-adenylation and degradation enzymes, so as to produce more stable mRNA, which can prolong the mRNA translation time in the cell and improve the expression amount. Usually, 100-150 bp is designed.

[0005] Therefore, at present, human alpha and beta-globin-derived UTR sequences with high expression efficiency in human cells or natural UTRs of pathogen mRNAs are selected and optimized for mRNA vaccine vector development. The development of mRNA vaccine technology provides a new idea for the development of norovirus vaccine research. SUMMARY

[0006] The purpose of the present application is to study and design mRNA vaccine expression vectors, taking GII.4 VP1 gene as the research object, and screening the optimal expression vector on cells, so as to lay a foundation for further research and development of norovirus mRNA vaccine.

[0007] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0008] The present application provides an mRNA expression vector, wherein the 5' UTR of the mRNA expression vector is derived from alpha-globin or human beta-globin, and the 3' UTR is derived from alpha 1 or beta-globin of human chromosome 16.

[0009] Preferably, the mRNA expression vector comprises three combinations of m1, m2 and m3, the 5' UTR of m1 is from alpha-globin, and the 3' UTR is from alpha 1 of human chromosome 16; the 5' UTR of m2 is from alpha-globin, and the 3' UTR is from beta-globin; the 5' UTR of m3 is from human beta-globin gene, and the 3' UTR is from beta-globin.

[0010] Preferably, the 5' UTR sequence of m1 is shown in SEQ ID NO: 1, and the 3' UTR sequence is shown in SEQ ID NO: 2; the 5' UTR sequence of m2 is shown in SEQ ID NO: 3, and the 3' UTR sequence is shown in SEQ ID NO: 4; the 5' UTR sequence of m3 is shown in SEQ ID NO: 5, and the 3' UTR sequence is shown in SEQ ID NO: 6.

[0011] Preferably, the mRNA expression vector further comprises a T7 promoter, a restriction enzyme site, a KOZAK sequence and a polyA, and the GCATATGAC sequence is added at the 31A position of the polyA.

[0012] Preferably, the nucleotide sequence of m1 is shown in SEQ ID NO: 7, the nucleotide sequence of m2 is shown in SEQ ID NO: 8, and the nucleotide sequence of m3 is shown in SEQ ID NO: 9.

[0013] Preferably, the basic expression vector for constructing the mRNA expression vector is a pcDNA3.1(+) vector.

[0014] Preferably, the mRNA expression vector is used to express norovirus VP1 protein, and the genotype of the norovirus VP1 protein comprises GII.4 VP1 and GI.1 VP1.

[0015] The application also provides the use of the mRNA expression vector in improving the expression amount of norovirus genes.

[0016] The application also provides the use of the mRNA expression vector in preparing a norovirus mRNA vaccine.

[0017] The three mRNA expression vectors in the application are optimized in the UTR of human alpha or beta protein, wherein the 5'UTR sequence of the pcDNA-GII.4-m1 vector with higher translation efficiency is derived from the human alpha-globin gene, and the sequence is optimized by engineering, removing inhibitory elements and adjusting the secondary structure to enhance the translation efficiency. The three mRNA vectors in the present study have different protein expressions on cells, which may be due to the differences in the arrangement of 5'UTR and 3'UTR sequences, the structure of mRNA, UTR recognition, the difference in the overall design of the vector, experimental cells, transfection reagents and other factors, which affect the mRNA translation efficiency and protein expression.

[0018] The GI.1 recombinant plasmid is constructed based on the GII.4 preferred plasmid, and the verification results show that with the extension of the transfection time, the synthesis of GI.1 VP1 protein in the cells is further increased.

[0019] The mouse experiment shows that: 1. The monovalent and bivalent norovirus LNP-mRNA vaccines of GII.4 and GI.1 genotypes both show good immunogenicity, and can simultaneously stimulate good humoral immunity and cellular immunity; compared with the monovalent vaccine, the bivalent vaccine can induce higher and sustained IgG antibodies and blocking antibodies in mice. And the high-dose group (5 μg) of the bivalent norovirus LNP-mRNA vaccine can induce stronger IgG antibodies, blocking antibodies and IFN-γ, IL-4 and IL-2 cytokine levels. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 It is a schematic diagram of pcDNA3.1(+) recombinant plasmid map;

[0021] Figure 2 It is the double enzyme digestion identification result of recombinant plasmid pcDNA-GII.4-m1 / m2 / m3;

[0022] Figure 3 It is the single enzyme digestion identification result of recombinant plasmid pcDNA-GII.4-m1 / m2 / m3;

[0023] Figure 4 It is the Western Blot identification and gray value analysis of Cap-GII.4-m1 / m2 / m3 protein expression;

[0024] Figure 5 It is the confocal immunofluorescence identification result of Cap-GII.4-m1 / m2 / m3 protein expression;

[0025] Figure 6 It is the ELISA identification result of Cap-GII.4-m1 / m2 / m3 protein expression;

[0026] Figure 7Identification results of recombinant plasmid pcDNA-GI.1-m1;

[0027] Figure 8 Identification results of expression of Cap-GI.1-m1 protein;

[0028] Figure 9 Detection results of capillary electrophoresis;

[0029] Figure 10 Schematic diagram of animal immunization program and sample collection;

[0030] Figure 11 BALB / c mouse GII.4 antigen-specific IgG / IgG1 / IgG2a antibody titers;

[0031] Figure 12 BALB / c mouse GI.1 antigen-specific IgG / IgG1 / IgG2a antibody titers;

[0032] Figure 13 Blocking antibody titer level of BALB / c mouse;

[0033] Figure 14 IgG / IgG1 / IgG2a antibody titers of serum of mice induced by bivalent vaccine

[0034] Figure 15 IgG / IgG1 / IgG2a antibody titers of serum of mice induced by bivalent vaccine;

[0035] Figure 16 Blocking antibody titers of serum of mice induced by bivalent vaccine;

[0036] Figure 17 Number of T lymphocytes in spleen induced by bivalent vaccine to express and secrete IFN-γ, IL-4 and IL-2 cytokines. DETAILED DESCRIPTION

[0037] The technical solutions provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0038] Example 1

[0039] Materials and methods

[0040] 1. Materials

[0041] Vero E6 cells, pc-DNA3.1(+) vector were preserved in our laboratory. TaKaRa LA Taq enzyme (TaKaRa, Japan), gel recovery extraction kit, PCR product recovery extraction kit, plasmid extraction kit (Kangjer, Germany), homologous recombination cloning kit (Yixingbio, Shanghai), Top 10 competent (Kangwei Century, Jiangsu), DNA Marker (Quanshijin, Beijing), restriction endonuclease Not I, Pac I, CLa I (NEB, USA), T7 High Yield RNA Transcription Kit, Vaccinia Capping Enzyme, mRNA Cap 2'-O-Methyltransferase, VAHTS RNA Clean Beads (Novagen, Nanjing), fetal bovine serum (Sigma, USA), DMEM cell culture medium (Gibco, USA), RIPA lysis buffer (Bi Yun Tian, Shanghai), PMSF (Solebao, Beijing), Lipofectamine 3000 transfection reagent (Invitrogen, USA), anti-GII.4 monoclonal antibody prepared in our laboratory, HRP labeled sheep anti-mouse monoclonal antibody (Huaxingbochuang, Beijing), chemiluminescence developing solution ECL (Thermo, USA), ELISA kit (Norovirus 3rd Generation kit, USA).

[0042] 2. Method

[0043] 2.1 Design of three mRNA vaccines

[0044] Three different modes of 5'UTR-MCS-3'UTR-A(120) sequences were designed Figure 1 , CIa I and Pac I enzyme digestion sites were set at both ends of MCS to facilitate the introduction of foreign genes, and three 5'UTR-MCS-3'UTR-A(120) sequences were connected into pcDNA3.1(+) vector respectively. The 5'UTR of m1 / m2 / m3 was derived from alpha or beta globin, and the 3'UTR was also derived from human chromosome alpha or beta globin. After sequence analysis design:

[0045] m1:

[0046] TAATACGACTCACTATAG (T7 promotor)

[0047] GGGAAAGAATAGAGAGAACAGAAGAGTAAGAAGAAAGATAAGACCCC GGCGCCGCCACCATCGAT (5' UTR, alpha-globin, SEQ ID NO: 1) ATCGAT (Cla I) GCCACC (KOZAK) — — TTAATTAA (Pca I)

[0048] GCTGGAGCCTCGGTGGCCTAGCTTCTTGCCCCTTGGGCCTCCCCCCAG

[0049] CCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAAAGT CTGAGTGGGCGGC (3' UTR, alpha 1 of human chromosome 16, SEQ ID NO: 2)

[0050] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAA

[0051] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA (poly A);

[0052] m2:

[0053] TAATACGACTCACTATAG (T7 promotor)

[0054] GGGGAAATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGACCCC

[0055] GCGCCGCCACCATCGATGCCACCATGAAGATGGCTAGCAGCGACGTGA ACCCTAGCCACCATCGAT (5' UTR, alpha-globin, SEQ ID NO: 3) ATCGAT (Cla I) GCCAACC (KOZAK) — — TTAATTAA (Pca I)

[0056] CAAGCACGCAGCAATGGTGGCCTAGCTTCTTGCGCCTTGGGCCTCCCC

[0057] CCAGCCCCTCCTCCGCTTCCTGCACCCGTACCCCCGTGGTCTATGAATA AAGTCTGAGTGGGCGGC (3' UTR, beta-globin, SEQ ID NO: 4) AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA (polyA);

[0058] It should be noted that the inventors modified the ATG at positions 59-61 of the 5' UTR of m2 to ATC, which prevents the synthesis of non-target proteins and improves translation efficiency.

[0059] m3:

[0060] taatacgactcactatag (T7 promotor)

[0061] gggatccgagaataaactagtattcttctggtccccacagactaagaccccggcgccc (5' UTR, human beta-globin gene, SEQ ID NO: 5)

[0062] ATCGAT (Cla I) GCCAACC (KOZAK) - - - TTAATTAA (Pcai)

[0063] CTGGTACTGGatatcctcgagctggtactgcatgcacgcaatgctagctgcgccgtcctgggtaccccgag

[0064] tctccggcgacctcggagtcccaggtatgctcccacctccacctgccccactcaccacctctgctagttccagacac

[0065] ctcccaagcacgcagcaatgcagctcaattagcctagccacaccggcacgggaaacagcagtgattaacctttagcaataaacgaaagtttaactaagctatactaaccccagggttggtcaatttcgtgccagccacaccctggagctagc (3' UTR, beta-globin, SEQ ID NO: 6)

[0066] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCATATGACTAAAAA

[0067] AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA(polyA).

[0068] A KOZAK sequence was added behind the 5'UTR; polyA was 100 As, to prevent the loss of polyA when amplified in bacteria, a GCATATGACT sequence was inserted behind the 31 As; restriction enzyme sites (Cla I and Pac I) were designed on both sides of the multiple cloning region, to facilitate cloning of the target sequence. Gene synthesis was synthesized by Nanjing Kingsun Science & Technology Co., Ltd. The synthesized m1 / m2 / m3 sequences were SEQ ID NO: 7-9.

[0069] 2.2 Design and synthesis of primers

[0070] According to the inserted target gene GII.4 VP1 sequence (SEQ ID NO: 10), specific primers were designed using SnapGene software (Table 1, SEQ ID NO: 11-16), and the primers were synthesized by Beijing Tianyi Huiyuan Science and Technology Co., Ltd.

[0071] Table 1 GII.4 VP1 amplification primers

[0072]

[0073] 2.3 Amplification and purification of GII.4 VP1 gene

[0074] The GII.4 VP1 full-length gene sequence (as shown in SEQ ID NO: 10) was amplified using specific primers (Table 1) with GII.4 VP1 gene-containing plasmid as template. The PCR reaction system was: Premix Taq 25 uL, 2 uL of each upstream and downstream primer, 2 ug of template, 19 uL of Nuclease-free Water, and a total volume of 50 uL; the reaction conditions were: 98°C for 10 s, 55°C for 30 s, 72°C for 1 min, 30 cycles. The PCR amplification product was identified by 1% agarose gel electrophoresis, 180V, 25min. The target band was recovered and purified using a gel recovery kit, and was named GII.4-m1 / m2 / m3 (the amplification products were named separately because the primers contained different homologous arms of the vector).

[0075] 2.4 Construction and identification of recombinant plasmid

[0076] The gel-recovered products GII.4-m1 / m2 / m3 were ligated with the recovered products after double digestion of the vector backbone using ClaI and PacI (the three vectors commissioned for synthesis in section 2.1), respectively, to construct the recombinant plasmid pcDNA-GII.4-m1 / m2 / m3. Recombination system: 2×Hieff 10 μL of MultiS Enzyme Premix, 3 μL of linearized vector, and 1 μL of gel-recovered product were added, with the final volume made up to 20 μL with nuclease-free water. Reaction conditions: 50 °C for 40 min. The ligation product was transformed into Top 10 competent cells and cultured at 37 °C for 14 h. Single colonies were then picked for colony PCR identification and sequencing. The correctly sequenced colonies were then expanded and cultured, and plasmids were extracted using a plasmid extraction kit.

[0077] The recombinant plasmid pcDNA-GII.4-m1 was double-digested with restriction endonucleases CIa I and PacI, and pcDNA-GII.4-m2 / m3 was double-digested with CIa I and Not I. The plasmids were identified by electrophoresis using 1% agarose gel.

[0078] Double enzyme digestion results: The three groups of recombinant plasmids pcDNA-GII.4-m1 / m2 / m3 were digested with restriction endonucleases, and electrophoresis results showed that each group had an electrophoretic band of the expected target gene size at positions between 2000bp and 3000bp. Figure 2 This indicates that the GII.4VP1 gene fragment has been ligated into the pcDNA3.1(+) vector. Figure 2 In the image, 1, 3, and 5 represent the electrophoresis bands of the pcDNA-GII.4-m1 / m2 / m3 plasmid, respectively; 2, 4, and 6 represent the electrophoresis bands of the pcDNA-GII.4-m1 / m2 / m3 double enzyme digestion, respectively; M—DNA Marker.

[0079] 2.5 Linearization of Recombinant Plasmids

[0080] Single enzyme digestion system: 3 μL restriction endonuclease NotI, 3 μg each of recombinant plasmid pcDNA-GII.4-m1 / m2 / m3, 5 μL 10×CutSmart Buffer, and Nuclease-free Water to a final volume of 50 μL. Incubate at 37℃ for 4 h. After the reaction, identify the enzymes by electrophoresis on a 1% agarose gel at 180V for 25 min.

[0081] Single enzyme digestion identification results: pcDNA-GII.4-m1, pcDNA-GII.4-m2, and pcDNA-GII.4-m3 all yielded clear single bands of the expected size after Not I digestion. Figure 3), which proved the success of the single enzyme digestion. This product can be used for subsequent in vitro transcription experiments. Figure 3 In the figure, 1, 3, 5 are respectively the electrophoresis bands of pcDNA-GII.4-m1 / m2 / m3 plasmid; 2, 4, 6 are respectively the electrophoresis bands of pcDNA-GII.4-m1 / m2 / m3 digested by NotI; M—DNA Marker.

[0082] 2.6 In vitro transcription, purification and capping

[0083] The linearized product in 2.5 was subjected to in vitro transcription. The transcription system: N1-Me-Pseudo UTP, ATP Solution, CTP Solution, GTP Solution, T7 RNA Polymeraase Mix, 10x Transcription Buffer, each 2 μL, linearized product 1 μg; reaction conditions: 37℃, 4h. After the reaction was completed, 2 μL DNase I was added to the reaction system and placed at 37℃ for 15 min. After the completed transcription RNA was purified using the VAHTS RNA Clean Beads kit, capping reaction was performed. The capping system: VCE: Vaccinia Capping Enzyme, VP39: 2’-O-Methyltransferase, SAM, GTP, 10x Capping Buffer, each 2 μL, RNA 10 μL; reaction conditions: 37℃, 1h, the product obtained was named Cap-GII.4-m1 / m2 / m3.

[0084] 2.7 In vitro mRNA transfection experiment

[0085] Vero E6 cells were seeded in a 6-well plate at 2x10 5 When the cell density reached 80%-90%, the transfection reagent Lipofectamine 3000 was mixed with mRNA at a volume to mass ratio of 1 μL:2 μg, and then incubated at room temperature for 20 min before being slowly dropped into the cell well and placed in the incubator for further culture.

[0086] 2.8 Western blot verification

[0087] The cell and cell supernatant after Cap-GII.4-m1 / m2 / m3 transfection Vero E6 cells for 24, 48, 96h were collected respectively, 200μL / well RIPA cell lysis solution (100:1 adding protease inhibitor PMSF) was added to the cells to lyse the cells on ice for 30min, collected into 1.5mL EP tube, 13000rpm centrifuged for 15min to collect the supernatant, added 5×Loading Buffer, denatured by boiling at 100℃ for 10min, then collected the sample for 10% SDS-PAGE electrophoresis, 160V, 45min; the proteins in the gel were transferred to NC membrane by wet transfer method, 0.45A, 30min; the NC membrane was blocked with 5% skimmed milk powder at 37℃ for 2h, washed with PBST for 5 times; the mouse GII.4 VP1 (1:2000) and GAPDH antibody (1:5000) were diluted with 2% skimmed milk powder, incubated with the first antibody at 4℃ overnight, washed with PBST for 5 times, 1 time / 5min; the HRP labeled goat anti-mouse IgG (H+L) antibody (1:5000) was diluted with 2% skimmed milk powder, incubated at 37℃ for 40min, after washing, the chemiluminescence developing liquid ECL was added for photography.

[0088] The Western Blot experiment results showed that the three groups of Cap-GII.4-m1, Cap-GII.4-m2 and Cap-GII.4-m3 successfully expressed GII.4 VP1 protein with a molecular weight of about 55kDa and the internal reference protein GAPDH with a molecular weight of 37kDa at 24h, 48h, 96h time points Figure 4 A-C). The gray value analysis of the target band in Western Blot by using Image J software showed that the GII.4 VP1 protein expression level of Cap-GII.4-m1 group was significantly higher than that of Cap-GII.4-m2 / m3 at 3 time points, and the difference of protein expression amount had statistical significance. The results showed that different 5'UTR sequences and 3'UTR sequences had different effects on the target mRNA coding sequence.

[0089] Figure 4 A—transfection 24h protein band; B—transfection 48h protein band; C—transfection 96h protein band; D—Image J gray value analysis; 1~3—Cap-GII.4-m1; 4~6—Cap-GII.4-m2; 7~9—Cap-GII.4-m3; 10—GII.4 VP1 positive; 11—negative; M—protein Marker; ***P<0.001, ****P<0.0001.

[0090] 2.9 Indirect immunofluorescence verification

[0091] Vero E6 cells were transfected with Cap-GII.4-m1 / m2 / m3, respectively, and the cell supernatant was discarded 48 h after transfection. 100 μL of 4% paraformaldehyde was added to each well, and the cells were fixed at 4°C for 30 min, followed by 3 times of PBST washing. 100 μL of 5% Triton X-100 was added to each well, and the cells were incubated at room temperature for 10 min, followed by 3 times of PBST washing. 5% BSA was used for blocking at 37°C for 1 h, followed by 5 times of PBST washing. 100 μL of mouse GII.4 VP1 antibody diluted with 2% BSA (1:2000) was added to each well, and the cells were incubated at 4°C overnight, followed by 5 times of PBST washing. 100 μL of FITC-labeled goat anti-mouse IgG (H+L) antibody diluted with 2% BSA (1:5000) was added to each well, and the cells were incubated at 37°C for 1 h, followed by 5 times of PBST washing. DAPI staining solution was added for nuclear staining, and the cells were incubated at room temperature in the dark for 5 min, followed by 2 times of PBST washing. The results were observed under a microscope.

[0092] 3 Vero E6 cells were transfected with Cap-mRNA-m1 / m2 / m3, and immunofluorescence was performed 48 h after transfection. Cap-GII.4-m1 / m2 / m3 in the three groups could express the target protein, and green fluorescence and DAPI restained blue fluorescence of the cell nucleus were observed under an inverted confocal microscope. Only the cell nucleus showed blue fluorescence in the control group.

[0093] 2.10 Verification by enzyme-linked immunosorbent assay (ELISA)

[0094] Vero E6 cells transfected with Cap-GII.4-m1 / m2 / m3 were collected at 24 h, 48 h, and 96 h, respectively, and Norovirus 3rd Generation kit was used for the experiment. The reagents and microplates were recovered at room temperature before the experiment, and the washing solution was diluted with distilled water at 1:9. 100 uL of samples and Conjugate 1 were added to each well, and the cells were incubated at room temperature for 1 h. After 5 times of washing with 300 uL of buffer and drying, 100 uL of Conjugate 2 was added and incubated at room temperature for 30 min. After 5 times of washing with 300 uL of buffer and drying, 100 uL of substrate was added to fill all the wells, and the cells were incubated at room temperature in the dark for 15 min. Subsequently, 50 uL of stop solution was added to fill all the wells to terminate the reaction, and the extinction value was measured at 450 nm.

[0095] Three groups of Cap-GII.4-m1, Cap-GII.4-m2 and Cap-GII.4-m3 have protein expression at three time points of 24h, 48h and 96h, and the protein expression level shows an increasing trend with the extension of transfection time. The protein expression level of Cap-GII.4-m1 at all time points (24h, 48h, 96h) is higher than that of Cap-GII.4-m2 and Cap-GII.4-m3 (P<0.05). With the extension of time, the protein expression level of Cap-GII.4-m1 shows an increasing trend, and the protein expression of Cap-GII.4-m2 and Cap-GII.4-m3 groups also shows a certain growth, but the growth rate is slightly lower compared with Cap-GII.4-m1 group.

[0096] In this embodiment, three mRNA expression vectors are designed, and the GII.4 VP1 gene sequence of the prevalent strain in China is connected to three different mRNA expression vectors by homologous recombination method to construct recombinant plasmids pcDNA-GII.4-m1, pcDNA-GII.4-m2 and pcDNA-GII.4-m3. mRNA is obtained by single enzyme linearization, in vitro transcription, capping and purification; then VeroE6 cells are transfected, and cells and supernatant are collected at 24, 48 and 96 hours after transfection. Western blot, indirect immunofluorescence test and enzyme-linked immunosorbent assay are used to identify the expression amount of norovirus VP1 protein. The results show that the three mRNA vaccines are successfully constructed and can express the target protein. Western blot results show that the 55kDa target protein is detected at different time points, indirect immunofluorescence shows that the green fluorescent labeled GII.4 VP1 protein is detected in the transfected cells; ELISA detection shows that the OD value of the GII.4 VP1 protein expressed by the pcDNA-GII.4-m1 vector can reach more than 3, and the detection results of the three methods show that the protein expression amount of the pcDNA-GII.4-m1 vector is higher. In addition, pcDNA-GII.4-m1 is selected as the optimal expression vector. This embodiment proves that different UTR sequences affect the translation efficiency of the in vitro transcribed mRNA system.

[0097] Example 2

[0098] Construction of GI.1 Recombinant Plasmid Based on GII.4 Preferred Plasmid

[0099] The optimal vector pcDNA-m1 selected from Example 1 is introduced into the GI.1 VP1 gene to construct a recombinant plasmid named pcDNA-GI.1-m1; the GI.1 VP1 sequence is downloaded from GenBank (MT008453.1), and the codon optimization and synthesis are completed by Nanjing Kingsway Biotech Co., Ltd.

[0100] According to the inserted target gene GI.1 VP1 sequence (SEQ ID NO: 17), specific primers were designed using SnapGene software (Table 2, SEQ ID NO: 18-19) with 15 bp of homologous sequence to the linearized vector end introduced at both ends of the upstream and downstream primers.

[0101] Table 2 GI.1-VP1 amplification primers

[0102]

[0103] The pcDNA-m1 vector was linearized using restriction endonuclease CIa I and Pac I for double enzyme digestion reaction, and the reaction conditions were the same as in Example 1. The reaction product was detected by 1% agarose gel electrophoresis, and the specific steps for recovery were the same as in Example 1. The product was named pcDNA-m1-cut. The NoV GI.1 VP1 amplified by PCR was reacted with the linearized vector pcDNA-m1-cut using a homologous recombination kit, and the reaction conditions and subsequent experimental steps were the same as in Example 1. The recombinant plasmid pcDNA-GI.1-m1 prepared in large quantities was adjusted to a concentration of 1 μg / μL, and a single enzyme digestion reaction was performed using restriction endonuclease Not I, and the reaction system and detailed experimental steps, subsequent experimental steps were the same as in Example 1.

[0104] Results

[0105] 1. Identification of recombinant plasmid pcDNA-GI.1-m1

[0106] The target gene GI.1 VP1 was amplified using specific primers, and the GI.1 target gene was obtained and identified by 1% agarose electrophoresis. The electrophoretic band of the NoV GI.1 VP1 was about 1593 bp, which was consistent with the expected size of the target gene ( Figure 7 A). The recombinant plasmid pcDNA-GI.1-m1 was double-digested using restriction endonucleases CIa I and Not I, and identified by 1% agarose gel electrophoresis. There was an electrophoretic band of the expected size of the target gene at 2000-3000 bp ( Figure 7 B), indicating that the GI.1 VP1 gene fragment had been connected to the pcDNA3.1(+) vector; the recombinant plasmid was sequenced by Beijing Tianyi Huiyuan Co., Ltd., and the results were correct. The recombinant plasmid pcDNA-GI.1-m1 was single-digested using restriction endonuclease Not I to obtain a linearized product, which was identified by 1% agarose gel electrophoresis. The band of the target gene was consistent with the expected size, and the band was clear and single ( Figure 7 C), proving the success of linearization of the recombinant plasmid. This product can be used as a template for in vitro transcription. Figure 7A—GI.1-VP1 target gene PCR amplification, 1—GI.1-m1; B—double enzyme digestion identification of recombinant plasmid pcDNA-GI.1-m1 2—pcDNA-GII.4-m1, 3—pcDNA-GII.4-m1 double enzyme digestion; C—single enzyme digestion identification of recombinant plasmid pcDNA-GI.1-m1 4—pcDNA-GII.4-m1, 5—pcDNA-GI.1-m1-Not I; M in A, B and C figures is DNA Maker.

[0107] 2. Identification of Cap-GI.1-m1 protein expression

[0108] The experimental process of transcription and capping of GI.1 is the same as that of GII.4. Cap-GI.1-m1 was transfected into Vero E6 cells, and cell protein collection was performed at 24h, 48h, 96h, respectively. Immunoblotting test was performed to detect the expression of GI.1 VP1 protein using mouse-derived GI.1 VP1 and reference GAPDH as primary antibodies, and HRP-labeled goat anti-mouse IgG as secondary antibody. Western Blot results show that the target protein band appears at 24h, 48h, 96h after transfection of the cells, and the size of GI.1 VP1 protein is about 55kd, and the size of reference protein GAPDH is 37kd Figure 8 A). Gray value analysis of GI.1 VP1 protein using Image J software found that the protein expression was higher after 24h of transfection Figure 8 B). Cap-GI.1-m1 was transfected into Vero E6 cells, and immunofluorescence test was performed at 48h after transfection. The expression of GI.1 VP1 protein in cells was detected using mouse-derived GI.1-VP1 antibody as primary antibody and FITC-labeled goat anti-mouse IgG(H+L) antibody as secondary antibody. The results were observed under an inverted confocal microscope, and the results showed that Cap-GI.1-m1 could observe fluorescence in Vero E6 cells. The cell nucleus was stained with DAPI and showed blue fluorescence Figure 8C). Thus it is proved that Cap-GI.1-m1 transfected Vero E6 cells can express GI.1 VP1 protein in cells. By transfecting Cap-GI.1-m1 into Vero E6 cells, the protein expression in cell supernatant at different time points (24h, 48h and 96h) was evaluated. The cell supernatant was collected at these three time periods respectively, and the protein in the cell supernatant was detected using Norovirus 3rd Generation kit. It was found that the expression of GI.1 VP1 protein was detected in the cell supernatant at 24h, 48h and 96h, and the protein expression gradually increased with the extension of culture time. The expression of GI.1 VP1 protein in the cell supernatant at 24h was low, and the OD value gradually increased at 48h and 96h, indicating that the synthesis of GI.1 VP1 protein in cells was further increased with the extension of transfection time Figure 8 D). At the same time, it is shown that GI.1 is more inclined to express in cells than GI.4, and is not easy to be secreted out of cells.

[0109] Example 3

[0110] 1. LNP-mRNA preparation

[0111] The product Cap-GII.4-mRNA / Cap-GI.1-mRNA after transcription and cap purification was quantitatively detected by Qubit 4.0 fluorescence instrument, and the integrity and purity of mRNA were detected by capillary electrophoresis device.

[0112] The concentration of Cap-GII.4-mRNA after purification was 1.28 mg / mL, and the capillary electrophoresis peak chart result of Cap-GII.4-mRNA showed a single sharp peak, and the purity was 85.9% (A); the concentration of Cap-GI.1-mRNA was 1.13 mg / mL, and the capillary electrophoresis peak chart result of Cap-GI.1-mRNA showed a single sharp peak, and the purity was 86.4% (B). Figure 9 Figure 9

[0113] 2. Liposome nanoparticle (LNP) preparation and encapsulation

[0114] Liposome nanoparticles were prepared using microfluidic technology, Cap-GII.4-mRNA / Cap-GI.1-mRNA was mixed with liposomes in a certain proportion to obtain LNP-mRNA vaccine, and was encapsulated by Nearshore Protein Technology Co., Ltd.

[0115] 2.1 LNP-mRNA vaccine quality detection

[0116] ​​LNP encapsulation efficiency and quality were detected using Ribogreen fluorescence method; LNP-mRNA particle size (nm), charge (mV) and dispersion coefficient (Polydispersity Index, PDI) were detected using nanoparticle size potential analyzer (Brookhaven 90Plus).

[0117] Results

[0118] The concentration of GII.4-LNP-mRNA was 0.3 mg / mL measured by fluorescence quantification method, and the encapsulation rate was 95.49% measured by Ribogreen fluorescence method. The particle size was 81.63 nm measured by dynamic light scattering method, the potential size was 4.42 mV measured by potential meter, and the PDI value was 0.14, indicating that the particle size was uniform. The concentration of GI.1-LNP-mRNA was 0.27 mg / mL measured by fluorescence quantification method, and the encapsulation rate was 95.3% measured by Ribogreen fluorescence method. The particle size was 83.18 nm measured by dynamic light scattering method, the potential size was 3.23 mV measured by potential meter, and the PDI value was 0.11, indicating that the particle size was uniform. The LNP-encapsulated bivalent mRNA candidate vaccine capable of stably expressing norovirus VP1 protein in vitro was prepared in this embodiment.

[0119] Example 4

[0120] 1. Experimental animals

[0121] SPF level 6-week-old female BALB / c mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. The animal use license number is SYKX (Jing) 2022-0029. This animal experiment was approved by the Animal Experiment Ethics Review Committee of China Disease Prevention and Control Center for Virus Disease Prevention and Control, with the ethics number 20240723054.

[0122] 2. Experimental methods

[0123] 2.1 Norovirus mRNA vaccine immunization program

[0124] 1) Single and bivalent norovirus mRNA vaccine immunization

[0125] BALB / c mice were randomly divided into 4 groups, each with 5 mice, and 3 vaccine groups were set up: GII.4 single-valent group, GI.1 single-valent group, GII.4+GI.1 bivalent group and Nacl control group (the vaccine used in the experiment was prepared in Example 3). The animal immunization method was taken by intramuscular injection in the hind leg, and the immunization dose was 10 μg LNP-mRNA per mouse, with a total of 2 doses of immunization, at 0, 2 weeks. Two weeks after the first immunization, blood was collected from the mice at 2, 4, 6 weeks, and indirect ELISA detection of specific IgG or its subtype antibodies and serum blocking experiment were performed.

[0126] 2) Dose effect immunization of bivalent norovirus mRNA vaccine

[0127] BALB / c mice were randomly divided into 4 groups, 6 in each group, and 3 vaccine groups were set up: GII.4+GI.1 bivalent low dose (0.5 μg) group, GII.4+GI.1 bivalent medium dose (2.5 μg) group, GII.4+GI.1 bivalent high dose (5 μg) group, and LNP as a control group. A total of 2 doses of immunization were performed, and immunization was performed at 0 and 2 weeks. Blood was collected from mice at 2, 4, and 6 weeks after the initial immunization, and specific IgG antibody ELISA detection and serum blocking experiments were performed. At 6 weeks, the spleens of mice were removed for detection of IFN-γ, IL-4, and IL-2 cytokines by ELISPOT, and the mice were euthanized at the end of the experiment.

[0128] 3) Serum sample collection: Fresh blood was collected from the submandibular plexus of BALB / c mice in vivo, and was used for detection of serum binding antibodies IgG, IgG1, IgG2a, and blocking antibodies. The average blood collection volume was 100-400 μL each time, and the serum was stored at 4°C overnight to precipitate. After centrifugation at 13,000 rpm at 4°C for 15 min, the serum was removed (to avoid blood cells), and centrifuged at 13,000 rpm at 4°C for 5 min. The serum sample was then aliquoted into clean centrifuge tubes and stored at -80°C to avoid repeated freezing and thawing. The animal immunization program and sample collection are shown in Figure 10 .

[0129] 2.2 Indirect ELISA

[0130] ELISA enzyme-labeled plates were coated with antigens NoV GII.4 / GI.1 VLP. Indirect ELISA was used to detect IgG, IgG1, and IgG2a binding antibody levels in serum samples at 2, 4, and 6 weeks after the initial immunization, and the specific methods are as follows:

[0131] 1) Antigen coating: The bottom of the ELISA microplate was coated with specific NoV GII.4 / GI.1 VLP protein using coating diluent, 2.5 μg / mL, 50 μL / well, covered with a lid, and incubated at 4°C overnight for 16-20 h;

[0132] 2) Washing the plate: Discard the liquid in the wells, add 300 μL of 0.05% PBST to each well, and wash the plate, repeat 5 times, each time for 30 s, and finally dry the residual liquid on the blotting paper;

[0133] 3) Blocking: Add 200 μL of 5% skim milk powder (2.5 μg+50 mL PBS) to each well, and incubate in a 37°C incubator for 2 h;

[0134] 4) Wash plate: repeat step 2);

[0135] 5) Antibody incubation: dilute serum with 2% skim milk (1 μg + 50 mL PBS), starting concentration 1:1000 in the first well, 3-fold dilution ratio, 7 gradients of continuous dilution, add 50 μL per well, incubate in 37°C incubator for 1 h;

[0136] 6) Wash plate: repeat step 2);

[0137] 7) Secondary antibody incubation: dilute HRP-labeled goat anti-mouse IgG, IgG1 and IgG2a antibodies with 2% skim milk, dilution ratio 1:10000, add 100 μL per well, incubate in 37°C incubator for 40 min;

[0138] 8) Wash plate: repeat step 2);

[0139] 9) Color development: restore TMB color developing solution to room temperature in advance, add 50 μL per well, develop color at room temperature in the dark for 5-10 min;

[0140] 10) Termination: add 50 μL 2M phosphoric acid per well to terminate the reaction, immediately use a microplate reader to measure the absorbance (OD) value at 450 nm.

[0141] 11) Double-repetition composite standard judgment is set in the experimental design to determine positive results: when the OD 450 absorbance value of the sample to be tested simultaneously meets the conditions of more than 2.1 times the average value of the negative control group and the absolute value ≥0.2, it is determined as a positive reaction. The antibody titer is determined by endpoint dilution method, i.e. the highest dilution degree at which the serum can still produce a positive reaction is taken as the final titer, and the titer value after logarithmic conversion is statistically analyzed to improve the normality of the data.

[0142] 2.3 Blocking experiment

[0143] The blocking antibody level in the serum samples 4 weeks and 6 weeks after the first immunization was detected, and the specific method was as follows:

[0144] 1) Antigen coating: coat the bottom of the ELISA microplate with porcine mucosal protein (PGM), 10 μg / mL 100 μL / well, cover the lid, incubate at 4°C overnight for 16-20 h;

[0145] 2) Wash plate: discard the liquid in the wells, add 300 μL 0.05% PBST per well to wash the plate, repeat 5 times,

[0146] rest for 30 s each time, and finally pat dry the residual liquid on the blotting paper after the last washing;

[0147] 3) Blocking: 200 μL of 5% skim milk powder (2.5 μg + 50 mL PBS) was added to each well for blocking, and incubated in a 37°C incubator for 2 h;

[0148] 4) VLP and antibody incubation: serum was diluted with 2% skim milk powder (1 μg + 50 mL PBS), starting concentration of 1:50 in the first well, 2-fold dilution ratio, 11 gradients of continuous dilution, 50 μL per well; specific NoV GII.4 / GI.1 VLP protein was diluted with 2% skim milk powder (1 μg + 50 mL PBS), GII.4 protein 1 μg / mL and GI.1 protein 0.25 μg / mL, 50 μL was added to the diluted serum, and a well without serum blocking was set as a control group, and incubated in a 37°C incubator for 1 h;

[0149] 5) Washing plate: the enzyme-labeled plate in step 3) was washed according to step 2);

[0150] 6) Incubation of antibodies: 100 μL of the mixture in 4) was added to the PGM-coated microplate; incubated in a 37°C incubator for 1 h;

[0151] 7) Washing plate: repeat step 2);

[0152] 8) Incubation of antibodies: GI.I and GII.4 specific antibodies were diluted with 2% skim milk powder, dilution ratio 1:5000, 100 μL was added to the PGM-coated microplate, and incubated in a 37°C incubator for 1 h;

[0153] 9) Washing plate: repeat step 2);

[0154] 10) Incubation of antibodies: HRP-labeled goat anti-rabbit IgG antibody was diluted with 2% skim milk powder, dilution ratio 1:5000, 100 μL was added to the PGM-coated microplate, and incubated in a 37°C incubator for 50 min;

[0155] 11) Washing plate: repeat step 2);

[0156] 12) Color development: TMB color developing solution was restored to room temperature in advance, 50 μL was added to each well, and color development was carried out at room temperature for 10 min in the dark;

[0157] 13) Termination: 50 μL of 2M phosphoric acid was added to each well to terminate the reaction, and the absorbance (OD) value at 450 nm was measured by an enzyme-labeled instrument.

[0158] 14) The formula for calculating the antibody blocking index is: Blocking rate (%) = [1 - (OD value of serum treatment hole / OD value of blank control hole)] x 100%. Wherein, the OD value reflects the numerical value of the amount of VLP binding to the receptor. ID50 is the reciprocal of the highest dilution of serum that can block 50% of VLP-HBGA binding. This value is calculated by curve fitting with a four-parameter logistic regression model of GraphPad Prism 9.5 software, which can accurately evaluate the titer of blocking antibodies in serum samples.

[0159] 2.4 Cross-binding experiment

[0160] The ELISA enzyme-labeled plate was coated with antigen NoV GI.3 / GII.17 VLP. The IgG binding antibody level in the serum sample at 6 weeks after the first immunization was detected by indirect ELISA, and the specific method was as follows:

[0161] 1) Antigen coating: The specific NoV GI.3 / GII.17 protein was coated at the bottom of the ELISA microplate with a coating diluent, 2.5 μg / mL 50 μL / well, covered with a lid, and incubated at 4°C overnight for 16-20 h;

[0162] 2) Washing plate: Discard the liquid in the hole, add 300 μL of 0.05% PBST to each hole for washing, repeat 5 times, and each time rest for 30 s, and finally wash the residual liquid on the blotting paper;

[0163] 3) Blocking: Add 200 μL of 5% skimmed milk powder (2.5 μg+50 mL PBS) to each hole for blocking, and incubate in a 37°C incubator for 2 h;

[0164] 4) Washing plate: Repeat step 2);

[0165] 5) Antibody incubation: Dilute the serum with 2% skimmed milk powder (1 μg+50 mL PBS), with a starting concentration of 1:100 in the first hole, 2-fold dilution, 11 gradients of continuous dilution, add 50 μL to each hole, and incubate in a 37°C incubator for 1 h;

[0166] 6) Washing plate: Repeat step 2);

[0167] 7) Secondary antibody incubation: Dilute the HRP-labeled goat anti-mouse IgG antibody with 2% skimmed milk powder at a dilution ratio of 1:10,000, add 100 μL to each hole, and incubate in a 37°C incubator for 40 min;

[0168] 8) Washing plate: Repeat step 2);

[0169] 9) Color development: Restore the TMB color developing solution to room temperature in advance, add 50 μL to each hole, and develop at room temperature in the dark for 5-10 min;

[0170] 10) Termination: Add 50 μL 2M phosphoric acid per well to terminate the reaction, and measure the absorbance (OD) value at 450 nm wavelength using a microplate reader.

[0171] 2.5 Enzyme-linked immunospot assay (ELISPOT)

[0172] Spleen lymphocyte collection: The mice were sacrificed by cervical dislocation, and then soaked in 75% alcohol for wet treatment. The spleen was removed from the mouse (note sterile operation), and the spleen lymphocyte suspension was prepared according to the following steps:

[0173] Preparation before experiment: The scissors and forceps were soaked in 75% alcohol and then autoclaved, and the absorbent paper was also autoclaved.

[0174] 1) Dissect the spleen: After the mice were sacrificed by cervical dislocation, the spleen was soaked in pre-cooled RPMI 1640 medium;

[0175] 2) Place a 40 μm filter screen in a sterile 6-well plate, add 4-5 mL mouse lymphocyte separation medium, and grind the spleen with a syringe piston;

[0176] 3) Filter the grinding liquid again through a 40 μm filter screen into a sterile 15 mL centrifuge tube;

[0177] 4) Slowly add 1.5 mL RPMI 1640 medium to the upper layer of the grinding liquid to maintain a clear layer;

[0178] 5) Room temperature centrifugation: centrifuge at 800 rpm for 40 min, and set the centrifuge lifting speed to 3;

[0179] 6) After centrifugation, a clear lymphocyte layer was formed at the liquid surface, which was sucked out with a sterile tube and transferred to a new sterile 15 mL centrifuge tube;

[0180] 7) Add 10 mL of 10% FBS 1640 medium, gently invert to mix, and centrifuge at room temperature at 250 rpm for 10 min;

[0181] 8) Discard the supernatant, resuspend the spleen cells with 1 mL of 10% FBS 1640 medium, count the lymphocytes, adjust the cell concentration to 5 × 106 cells / mL, and reserve for use, and the cell activity should be maintained above 90%.

[0182] ELISPOT was used to detect the expression of IFN-γ, IL-2, and IL-4 cytokines, and the specific experimental steps were as follows:

[0183] 1) Activation of pre-coated plates: Add 200 μL of sterile PBS to each well, wash 4 times, and dry the liquid on the last time on sterile paper, add 100 μL of 10% FBS 1640 medium to each well, incubate at room temperature for 40 min;

[0184] 2) Discard the culture medium, add 100 μL of the adjusted concentration of lymphocyte suspension to the experimental wells, set 2 replicate wells; design control wells: add 1x105 cells / well to the positive control, the same number of cells as the experimental group to the negative control; add 100 μL of 10% FBS 1640 medium to each well of the background negative control;

[0185] 3) Add stimulants: add 10 μL / well (20 ng / μL) of specific GII.4 / GI.1 VLP protein to the experimental wells, add 10 μL of positive stimulant / well to the positive control, and add 10 μL of 10% FBS 1640 medium to the negative wells. Incubate: incubate at 37°C in a 5% CO2 incubator for 48 h.

[0186] 4) Lysis of cells: discard the culture medium and cells, add 200 μL of pre-cooled PBS to each well, wash 5 times, each time for 1 min, and dry the liquid on the last time on sterile absorbent paper;

[0187] 5) Antibody incubation: dilute the biotin-labeled antibody with 0.5% FBS-PBS solution at a dilution ratio of 1:1000, add 100 μL to each well, and incubate at room temperature for 2 h in the dark;

[0188] 6) Washing: discard the supernatant, add 200 μL of PBS to each well, wash 5 times, each time for 1 min, and dry the liquid on the last time on sterile absorbent paper;

[0189] 7) Incubation of secondary antibody: dilute the HRP-labeled enzyme-labeled avidin antibody with 0.5% FBS-PBS solution at a dilution ratio of 1:1000, add 100 μL to each well, and incubate at room temperature for 1 h in the dark;

[0190] 8) Washing: repeat step 6);

[0191] 9) Color development: add 100 μL of color developing solution to each well, develop the color in the dark for 5-15 min;

[0192] 10) Stop color development: after the spots grow to an appropriate size, discard the liquid, add 200 μL of deionized water to each well to stop color development, finally remove the plate base, rinse the front and back of the plate and the base with deionized water, and dry the front and back of the plate and the base with absorbent paper. Place the plate in a well-ventilated place away from light to dry the membrane.

[0193] 11) Data reading and analysis: use the fluorescence immune image analysis system to read the ELISPOT plate data information, record the spot information for statistical analysis.

[0194] 2.6 Statistical Analysis

[0195] The titers of IgG, IgG1, IgG2a, and blocking antibodies were all logarithmically calculated before analysis. Statistical analysis was performed using One-way ANOVA and Two-way ANOVA in the software. P < 0.05 was considered statistically significant (*P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001).

[0196] 3 Results

[0197] 3.1 Serum antibody levels of total IgG, IgG1, and IgG2a induced by monovalent and bivalent vaccines

[0198] IgG antibody levels are an important indicator for evaluating the humoral immunogenicity of vaccines. The levels of NoV GII.4 / GI.1 specific IgG antibodies in serum samples at weeks 2, 4, and 6 after the initial immunization were detected using an indirect ELISA method. Both monovalent and bivalent vaccine groups produced specific IgG antibodies against GI.1 and GII.4 types as early as 2 weeks after the initial immunization, with antibody levels reaching their peak at 2 weeks post-immunization and persisting up to 6 weeks.

[0199] Four weeks after the initial immunization, the levels of IgG antibodies in all groups showed a significant increasing trend, reaching their highest levels. The titers of monovalent and bivalent IgG antibodies in the GII.4 genotype were 10 and 10, respectively. 5.46 and 10 5.52 Six weeks after the initial immunization, the specific IgG antibody levels in each immunization group remained high, with the titers of monovalent and bivalent IgG antibodies for the GII.4 genotype being 10. 5.19 and 10 5.57 ( Figure 11 A) The IgG antibody titer in the bivalent group was higher than that in the monovalent group. Serum samples were analyzed to detect IgG1 and IgG2a antibody levels. Results showed that both the monovalent and bivalent vaccines induced high levels of IgG1 and IgG2a antibodies. However, there was no statistically significant difference in IgG1 levels between the groups (P>0.05). Figure 11 B), while IgG2a showed differences between groups, and IgG2a was significantly elevated in the bivalent group ( Figure 11 C). The IgG2a / IgG1 results showed that the IgG2a / IgG1 ratios in the monovalent and bivalent GII.4 vaccine groups were 0.98 and 1.15, respectively, indicating that the bivalent group drove a more effective Th1-biased immune response. Figure 11 D). Figure 11The titers of GII.4 antigen-specific IgG / IgG1 / IgG2a antibodies in BALB / c mice are given. Note: A—GII.4 IgG antibody titer; B—GII.4 IgG1 antibody titer; C—GII.4 IgG2a antibody titer; D—GII.4 IgG2a / IgG1 ratio; *P<0.05, ***P<0.001, ****P<0.0001.

[0200] Four weeks after the initial immunization, the titer of IgG antibodies against the GI.1 genotype was measured at 10 for both monovalent and bivalent antibodies. 5.16 and 10 5.10 At this stage, there was no statistically significant difference in antibody titers between the bivalent and monovalent vaccine groups (P>0.05); 6 weeks after the first immunization, the IgG antibody titers of the GI.1 genotype monovalent and bivalent vaccines were 10... 5.00 and 10 5.67 ( Figure 12 A) Compared with the monovalent vaccine group, the antibody level in the bivalent vaccine group remained higher for a longer period of time. Analysis of IgG1 antibody results showed that both the monovalent and bivalent vaccines induced high levels of IgG1, and the differences compared with the control group were statistically significant (P<0.05). Figure 12 B), IgG2a was significantly elevated in the bivalent group, with a statistically significant difference compared to the monovalent group (P<0.05). Figure 12 C); The IgG2a / IgG1 ratio showed that the ratios of the monovalent and bivalent groups were 0.93 and 1.12, respectively, suggesting that the bivalent group drove a Th1-biased immune response. Figure 12 D). Figure 12 The titers of GI.1 antigen-specific IgG / IgG1 / IgG2a antibodies in BALB / c mice are: A—GI.1 IgG antibody titer; B—GI.1 IgG1 antibody titer; C—GI.1 IgG2a antibody titer; D—GI.1 IgG2a / IgG1 ratio; *P<0.05, ***P<0.001, ****P<0.0001.

[0201] 3.2 Levels of blocking antibodies in serum induced by monovalent and bivalent vaccines

[0202] This study used the HBGA blocking assay to replace the NoV neutralization assay to indirectly evaluate changes in specific neutralizing antibodies against monovalent and bivalent norovirus vaccines. This method quantitatively analyzes the ability of serum antibodies to block the binding of NoVVLP to tissue blood group antigen (HBGA) receptors, thereby evaluating the level of neutralizing antibodies in the vaccine. Antibody blocking efficacy was assessed using serum samples taken at weeks 4 and 6 post-primary immunization via a serial dilution method.

[0203] The results showed that both monovalent and bivalent vaccines effectively induced a specific blocking antibody response against NoV. For the GII.4 genotype ( Figure 13 A) The bivalent vaccine group showed an immune advantage 4 weeks after the initial immunization, with an average ID50 of approximately 2166 in the bivalent vaccine group and approximately 1815 in the monovalent vaccine group. Six weeks after the booster immunization, the ID50 in both groups showed a decreasing trend, with an average ID50 of approximately 1447 in the bivalent vaccine group and approximately 1399 in the monovalent vaccine group, but the difference between the groups was not statistically significant. For the GI.1 genotype ( Figure 13 (B) Four weeks after the initial immunization, the mean ID50 was approximately 707 in the bivalent vaccine group and approximately 538 in the monovalent vaccine group. Six weeks after the initial immunization, antibody levels remained stable in both groups, with the mean ID50 in the bivalent vaccine group being approximately 798 and the mean ID50 in the monovalent vaccine group being approximately 548, but the difference was not statistically significant. Overall, the blocking antibody level in the bivalent group was significantly higher than that in the monovalent group, and the overall ID50 level of the GI.1 genotype was lower than that of the GI.4 genotype. Figure 13 The values ​​represent the neutralizing antibody titers in BALB / c mice. Note: A—GII.4 blocking antibody level; B—GI.1 blocking antibody level.

[0204] 3.3 Levels of specific antibodies and blocking antibodies in serum induced by different doses of vaccine

[0205] Following immunization with bivalent norovirus vaccines of 0.5 μg, 2.5 μg, and 5 μg, the 5 μg dose group showed higher antibody titers after two booster immunizations. Analysis revealed that all dose groups induced significant NoV GI.1 and GI1.4 protein-specific IgG antibody responses in mice two weeks after the initial immunization. Four weeks after the initial immunization, IgG antibody levels significantly increased in all immunization groups, with antibody titers in the low, medium, and high dose groups reaching 10, respectively. 4.66 10 4.74 10 4.98 The difference between the high-dose and low-dose groups was statistically significant; 6 weeks after the first immunization, the antibody titer in the high-dose group was 10. 5.14 These are 1 times that of the low-dose group and the medium-dose group, respectively. Figure 14 A) In each dose group, the bivalent vaccine IgG2a / IgG1 ratio > 1, inducing a Th1-biased immune response. Figure 14 B). Figure 14 The bivalent vaccine induced serum IgG / IgG1 / IgG2a antibodies in mice. Note: A—GII.4 IgG antibody titer; B—GII.4 IgG2a / IgG1 ratio; *P<0.05, **P<0.01, ****P<0.0001.

[0206] Four weeks after the initial immunization, the antibody titer in the high-dose group was 10. 5.17The titers were 1.2 times and 1 times higher in the low-dose and medium-dose groups, respectively; 6 weeks after the first immunization, the IgG antibody titer in the high-dose group was 10. 4.11 10 4.66 10 4.98 ( Figure 15 A); Antibody levels remained highest in the high-dose group. Further analysis of serum IgG2a / IgG1 results at week 6 after the initial immunization showed ( Figure 15 B) In each dose group, the ratio of IgG2a / IgG1 to bivalent vaccine was >1, resulting in an effective Th1-biased immune response. Figure 15 The values ​​represent the serum IgG / IgG1 / IgG2a antibody titers induced by the bivalent vaccine in mice. Note: A—GI.1 IgG antibody titer; B—GI.1 IgG2a / IgG1 ratio; **P<0.01, ****P<0.0001.

[0207] The levels of GII.4 and GI.1 blocking antibodies in serum samples from mice at weeks 4 and 6 post-initial immunization were evaluated. The study found that all vaccine doses effectively induced specific blocking antibody responses in mice, and this response was consistent with the level of binding antibodies. Specifically, the level of blocking antibodies increased with increasing vaccine dose, with the highest dose group producing the highest levels of blocking antibodies at both weeks 4 and 6. For the GII.4 genotype, a clear dose-response relationship was observed in serum antibody levels as early as week 4 post-initial immunization, with ID50 values ​​of 208, 330, and 573 for the low, medium, and high dose groups, respectively. The differences between the medium / high dose groups and the low dose group were statistically significant. At week 6 post-initial immunization, serum blocking antibody levels changed, with ID50 values ​​of 250, 260, and 549. Although these values ​​were similar to those at week 4, differences in blocking antibody levels still existed between different dose groups. Figure 16 A). For GI.1 genotyping results, the levels of blocking antibodies in serum at 4 weeks post-primary immunization showed significant differences among different dose groups. Specifically, the ID50 values ​​for the low, medium, and high dose groups were 166, 259, and 412, respectively, and the levels of blocking antibodies increased significantly with increasing dose. At 6 weeks post-primary immunization, the average ID50 values ​​were 131, 262, and 539, respectively. Although these values ​​were slightly lower than at week 4, statistical differences remained between the dose groups, with the high-dose group exhibiting a stronger blocking effect. Figure 16 B). It is worth noting that there were significant differences in antibody levels among individual mice in each experimental group. Figure 16 The titers of blocking antibodies in the serum of mice induced by the bivalent vaccine are shown in the figure. Note: A—GII.4 blocking antibody level; B—GI.1 blocking antibody level; **P<0.01, ***P<0.001, ****P<0.0001.

[0208] The binding assays of serum samples from 6 weeks after the first immunization against the prevalent GI.3 and GII.17 VLP in my country were performed under the same conditions as those for GII.4 / GI.1. The results showed that the OD450 values ​​were all less than 0.2.

[0209] 3.4 Different doses of vaccine induced the expression and secretion of IFN-γ, IL-4, and IL-2 levels in splenic T lymphocytes.

[0210] The ELISPOT method was used to assess the lymphocyte-mediated immune response in mice following immunization with a bivalent norovirus vaccine (GII.4 and GI.1), particularly the secretion levels of cytokines IFN-γ, IL-4, and IL-2. Six weeks after the initial immunization, splenic lymphocytes were isolated from mice and stimulated with GII.4 and GI.1 virus-like particles (VLPs) as specific antigens to detect cytokine secretion responses and evaluate the vaccine-induced specific immune response in mice.

[0211] The results showed that the LNP control group could not stimulate mice to secrete specific IFN-γ, IL-4, and IL-2 cytokines, indicating that LNP could not produce a specific immune response in mice. All vaccine groups could stimulate mice to secrete the aforementioned specific cytokines, with the secretion increasing with increasing vaccine dose (1 × 10⁻⁶). 6 The number of IFN-γ, IL-4, and IL-2 positive T cells detected in spleen lymphocytes showed an increasing trend. (Based on experimental data analysis...) Figure 17 The regulatory effects of different vaccine doses on Th1 / Th2 immune responses showed genotype-specific differences. In the GII.4 genotype, the expression level of IFN-γ (a marker of Th1 cytokines) was linearly related to the vaccine dose, with the high-dose group showing a significant upregulation effect, its secretion reaching 2.9 times and 1.2 times that of the low-dose and medium-dose groups, respectively. This suggests that this dose may effectively promote antigen-specific cellular immune responses by activating the CD4+ Th1 cell pathway. Figure 17 A). In contrast, the GI.1 genotype exhibited dose-response immunomodulatory characteristics: the expression levels of IL-2 (Th1 type) and IL-4 (Th2 type) increased continuously with increasing vaccine dose, especially in the high-dose group where IL-4 concentration increased 2.6 times from baseline. This regulatory pattern suggests that the GI.1 genotype vaccine can synergistically activate the Th1 / Th2 immune axis, while simultaneously inducing cell-mediated immune responses and B-cell-dependent humoral immune responses. Figure 17 B). Figure 17 The amount of IFN-γ, IL-4 and IL-2 cytokines expressed and secreted by splenic T lymphocytes induced by the bivalent vaccine. Note: A—GII.4 genotype; B—GI.1 genotype; ***P<0.001, ****P<0.0001.

[0212] From the above examples, the application is based on the mRNA vaccine platform, and a carrier with better expression and persistence is screened, a bivalent mRNA vaccine of GII.4 and GI.1 is constructed, and a lipid nanoparticle (LNP) encapsulation technology is used to form an mRNA candidate vaccine. Through mouse experiments, the antibody titer, blocking antibody level and cellular immune response of the vaccine are evaluated, and the potential application value of the vaccine in norovirus vaccine research and development is discussed. The results show that:

[0213] (1) Whether it is a single or bivalent vaccine, it can induce IgG antibodies against GII.4 and GI.1, and the IgG antibodies reach a peak 2 weeks after boosting and last for 6 weeks. In the further dose optimization experiment, the high dose (5 μg) produces higher IgG, IgG1 and IgG2a antibodies, blocking antibodies in mice than the low and medium dose groups. The IgG antibody titer induced by the high dose group of mRNA bivalent vaccine in this paper is equivalent to that of the bivalent (GI.1 / GII.4) and six-valent (GI.1, GII.2, GII.3, GII.4, GII.6, GII.17) vaccines based on VLP.

[0214] (2) The bivalent vaccine in this study is more effective in driving Th1-biased immune response. The mouse serum 6 weeks after the first immunization does not bind to GI.3 and GII.17 VLP proteins, indicating that the bivalent mRNA vaccine has no cross-protection for GI.3 or GII.3.

[0215] (3) The single and bivalent mRNA vaccines can induce GII.4 and GI.1 blocking antibodies 4 and 6 weeks after immunization, and the blocking antibody ID50 values are higher than 1000 (GII.4) and 500 (GI.1), respectively. In the dose optimization experiment, the blocking antibody level shows a dose effect, and the ID50 values of the high dose group (5 μg) are 573 (GII.4) and 539 (GI.1), respectively, which are significantly higher than those of the low and medium dose groups.

[0216] (4) The secretion levels of IFN-γ, IL-2 and IL-4 were significantly improved in the bivalent vaccine group with the increase of vaccine dose, indicating that the high-dose vaccine more effectively activated the cellular immune and humoral immune systems and induced specific T cell responses. In addition, the IFN-γ immune response of GII.4 genotype was stronger and more biased towards Th1 type immune response, while the IL-4 immune response of GI.1 genotype was stronger and more biased towards Th2 type immune response, which may be related to the difference in antigens. There was no significant difference in IL-2 levels among different dose groups, suggesting that the induction of IL-2 may be more dependent on the overall immune activation level of the vaccine, rather than just related to the vaccine dose. The immune response of GI.1 was lower than that of GII.4 genotype, which may be related to the exposure degree of different genotypes of antigen epitopes, receptor binding affinity or T cell reactivity to different antigens. In summary, the bivalent norovirus mRNA vaccine of the present study can induce immune mice to produce balanced immune responses of Th1 type cellular immunity and Th2 type humoral immunity.

[0217] In summary, the study showed that the bivalent mRNA norovirus vaccine exhibited significant immunogenicity and durability in mice, and showed a strong dose effect in terms of antibody titers, blocking antibodies and cellular immune responses, especially in inducing humoral immunity and cellular immunity, which achieved good results, and provided a basis for further research and application of the bivalent vaccine.

[0218] The above only describes the preferred embodiments of the present application. It should be noted that for those skilled in the art, without departing from the principles of the present application, several improvements and refinements can be made, which should also be considered within the scope of protection of the present application.

Claims

1. An mRNA expression vector, characterized in that, The 5'UTR of the mRNA expression vector is derived from α-globin or human β-globin, and the 3'UTR is derived from alpha 1 or β-globin on human chromosome 16.

2. The mRNA expression vector as described in claim 1, characterized in that, The mRNA expression vector includes three combinations: m1, m2, and m3. The 5'UTR of m1 comes from α-globin, and the 3'UTR comes from alpha 1 on human chromosome 16. The 5'UTR of m2 comes from α-globin, and the 3'UTR comes from β-globin. The 5'UTR of m3 comes from the human β-globin gene, and the 3'UTR comes from β-globin.

3. The mRNA expression vector as described in claim 2, characterized in that, The 5'UTR sequence of m1 is shown in SEQ ID NO: 1, and the 3'UTR sequence is shown in SEQ ID NO: 2; the 5'UTR sequence of m2 is shown in SEQ ID NO: 3, and the 3'UTR sequence is shown in SEQ ID NO: 4; the 5'UTR sequence of m3 is shown in SEQ ID NO: 5, and the 3'UTR sequence is shown in SEQ ID NO:

6.

4. An mRNA expression vector as described in any one of claims 1 to 3, characterized in that, The mRNA expression vector also includes a T7 promoter, an enzyme restriction site, a KOZAK sequence, and polyA, with the GCATATGAC sequence added at position 31A of polyA.

5. A norovirus mRNA expression vector as described in claim 4, characterized in that, The nucleotide sequence of m1 is shown in SEQ ID NO: 7, the nucleotide sequence of m2 is shown in SEQ ID NO: 8, and the nucleotide sequence of m3 is shown in SEQ ID NO:

9.

6. The mRNA expression vector as described in claim 5, characterized in that, The basic expression vector for constructing the mRNA expression vector was the pcDNA3.1(+) vector.

7. The mRNA expression vector as described in claim 6, characterized in that, Used to express norovirus VP1 protein, wherein the genotypes of norovirus VP1 protein include GII.4VP1 and GI.1VP1.

8. The use of the mRNA expression vector according to any one of claims 1 to 7 in increasing the expression level of norovirus protein.

9. The use of the norovirus mRNA expression vector according to any one of claims 1 to 7 in the preparation of a norovirus mRNA vaccine.

Images