Biosynthetic nano-material-based tumor marker biochemical detection method
By using the biosynthesized nanomaterial SPA [PEG (AgNP)]-Ab to enhance the detection signal of tumor markers in a biochemical detection platform, the problem of insufficient sensitivity of the biochemical detection platform is solved, and rapid quantitative detection of ultra-trace tumor markers is achieved in a cost-effective manner, making it suitable for primary healthcare institutions.
Patent Information
- Application Number
- CN202511068962.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-31
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2045-07-31
AI Technical Summary
Existing biochemical testing platforms lack sufficient sensitivity for tumor marker detection, have limited applicability, and face difficulties in popularizing high-sensitivity detection technologies in primary healthcare institutions.
The biosynthesized nanomaterial SPA [PEG (AgNP)]-Ab was incubated with the sample to be tested, and the visible light absorption signal was detected using a fully automated biochemical analyzer. The detection signal was enhanced by combining the local surface plasmon resonance characteristics of bio-silver nanoparticles, and non-specific adsorption was reduced by PEG coating, while the fusion protein linker improved the antibody conjugation specificity.
It enables rapid quantitative detection of ultra-trace tumor markers, with the detection limit of quantitation improved to no more than 1.0 ng/mL and the linear detection range reaching 1-1500 ng/mL. It solves the problem of low sensitivity and reduces detection costs, making it suitable for primary healthcare institutions.
Smart Images

Figure CN120971733A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological detection, and particularly relates to a tumor marker biochemical detection method based on biosynthetic nanomaterials. BACKGROUND
[0002] In recent years, in vitro diagnostic reagent (IVD) detection technology has developed rapidly, and various technical platforms coexist and complement each other. The current in vitro diagnostic reagent detection technology platforms mainly include biochemical, immunological, molecular, microfluidic and chip technology platforms. The principle of the biochemical detection technology platform is mainly based on biochemical reactions such as enzyme reaction and substrate coloration, and it is used to detect metabolites, enzymes, electrolytes and the like in blood, urine and other samples, and is widely used in routine projects such as liver function, kidney function, blood sugar and blood lipid. The detection technology is mature, and domestic products have basically realized import substitution, and are widely used in hospitals at all levels; the representative technologies of the immunological detection technology platform mainly include chemiluminescence immunoassay (CLIA), enzyme-linked immunoassay (ELISA), immunochromatography (such as colloidal gold and fluorescent chromatography), etc. Chemiluminescence immunoassay detection technology is one of the fastest growing and most widely used technologies in the field of in vitro diagnostics in recent years, and has become an important pillar technology in the field of in vitro diagnostics.
[0003] Although the biochemical detection platform has the advantages of relatively low price of reagents and instruments, mature technology, easy standardization, and support for multiple reagent brands on most platforms, it has low sensitivity, poor specificity, and a detection limit usually in the μg / mL level, which is not suitable for low concentration analysis. In addition, some projects are easily interfered by other substances in the sample, and the accuracy is not as good as immunological methods, which cannot meet the detection needs of ultra-micro analysis markers (such as tumor markers, hormones, etc.).
[0004] Chemiluminescence immunoassay (CLIA) combines the high sensitivity of chemiluminescence and the high selectivity of immunological reaction, and has high sensitivity and specificity. Theoretically, the sensitivity can reach 10 -18 mol / L, which can detect low-concentration substances that are difficult to detect by other methods. In addition, its linear range is wide, and the linear range of chemiluminescence can reach 4-6 orders of magnitude, which is much higher than the linear range of traditional enzyme-linked immunoassay (ELISA) and other methods, and is suitable for the detection of samples with different concentrations. However, the chemiluminescence reagent and instrument used in combination are relatively expensive, the maintenance cost is also high, and professional operators are required, which has high technical threshold and limits its popularization in primary medical institutions. SUMMARY
[0005] The purpose of the embodiments of the present application is to provide a tumor marker biochemical detection method based on biosynthetic nanomaterials, which aims to solve the problems of insufficient sensitivity of the biochemical detection platform in the prior art for tumor marker detection, limited application range, and difficulty in popularizing high-sensitivity detection technology.
[0006] The embodiment of the present application is implemented in the following way: a tumor marker biochemical detection method based on biosynthetic nanomaterials, comprising the following steps:
[0007] The biosynthetic nanomaterial SPA
PEG (AgNP)
[0008] The visible light absorption signal of the mixed system at 600-650 nm is detected by a full-automatic biochemical analyzer.
[0009] According to the strength of the visible light absorption signal, the content of the tumor marker in the sample to be detected is determined.
[0010] The SPA
PEG (AgNP)
PEG (AgNP)
[0011] Another object of the embodiment of the present application is a biosynthetic nanomaterial SPA
PEG (AgNP)
PEG (AgNP)
PEG (AgNP)
[0012] Another object of the embodiment of the present application is a tumor marker biochemical detection reagent, which is obtained by blocking, washing, purifying and resolubilizing the above-mentioned biosynthetic nanomaterial SPA
PEG (AgNP)
[0013] The embodiment of the application detects tumor markers on a biochemical detection platform by biosynthesizing nano material SPA
PEG (AgNP)
[0014] Figure 1 A preparation process flowchart of the biosynthetic nano material SPA
PEG (AgNP)
[0015] Figure 2 A schematic diagram of the reaction process between the biosynthetic nano material SPA
PEG (AgNP)
[0016] Figure 3 An ultraviolet-visible absorption spectrum in the preparation process of the biological nano silver particles provided by the embodiment of the application is provided.
[0017] Figure 4 A particle size change in the preparation process of the nano particles provided by the embodiment of the application (including intermediates in different stages: AgNP, PEG(AgNP), SPA
PEG(AgNP)
[0018] Figure 5 A potential change in the preparation process of the nano particles provided by the embodiment of the application (including intermediates in different stages: AgNP, PEG(AgNP), SPA
PEG(AgNP)
[0019] Figure 6 An SDS-PAGE characterization result diagram of the fusion protein linker SPA provided by the embodiment of the application is provided.
[0020] Figure 7 A molecular sieve characterization result diagram of the working nano particle SPA
PEG(AgNP)
[0021] In order to make the purposes, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to the drawings and embodiments. It should be understood that the specific embodiments described herein are only intended to explain the present application and not to limit the present application.
[0022] The embodiment of the present application provides a tumor marker biochemical detection method based on biosynthetic nanomaterials, comprising: using biosynthetic nanomaterials SPA
PEG (AgNP)
PEG (AgNP)
PEG (AgNP)
[0023] In the embodiment of the present application, the detection method is applied to a biochemical detection platform, and a full-automatic biochemical analyzer is used to detect the content of ultramicro tumor markers in a human sample. Specifically, the detection method is applied to detect tumor markers, and the tumor markers include ferritin (FER), carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), free prostate specific antigen (FPSA), total prostate specific antigen (TPSA), carbohydrate antigen 72-4 (CA72-4), neuron-specific enolase (NSE), pepsinogen I (PG I), pepsinogen II (PG II), gastrin 17 (G17), human epididymis protein 4 (HE4), squamous cell carcinoma antigen (SCCA), progastrin-releasing peptide (ProGRP), carbohydrate antigen 153 (CA15-3), carbohydrate antigen 19-9 (CA19-9), carbohydrate antigen 50 (CA 50), carbohydrate antigen 242 (CA 242), tumor-related antigen CA125 (CA 125), cytokeratin 19 fragment (CRFRA21-1), nerve-specific protein S100-β (S100-β), thyroid globulin (Tg), β2-microglobulin (β2-MG), abnormal prothrombin (PIVKA-II), calcitonin (CT), human epidermal growth factor receptor 2 (HER-2 / neu), malignant tumor-specific growth factor (TSGF), tumor necrosis factor (TNF), prostate acid phosphatase (PAP), but not limited to these tumor marker antigens.
[0024] In the embodiment of the present application, the sample to be detected is one of human serum, plasma, urine and cerebrospinal fluid.
[0025] In the embodiment of the present application, the coupling step of the SPA
PEG (AgNP)
PEG (AgNP)
PEG (AgNP)
[0026] In the embodiment of the present application, the fusion protein linker SPA is constructed by fusing S-layer protein and Protein A. The S-layer protein includes SbpA, SbsB, EA1, etc. The construction steps of the fusion protein linker SPA include: extracting S-layer protein DNA sequence from E. coli strain containing S-layer protein sequence, adding nucleotide sequence corresponding to fusion peptide segment in S-layer protein ORF; transfecting E. coli with fusion plasmid, inducing expression and purifying to obtain SPA protein.
[0027] In the embodiment of the present application, the PEG (AgNP) particle is prepared by wrapping biological silver nanoparticles AgNPs with PEG. The preparation steps of the PEG (AgNP) particle include: mixing Fusarium oxysporum strain filtrate and AgNO3 solution, reacting in the dark under the condition of pH 8.0, 30℃, 100rpm for 24-48h, purifying to obtain AgNPs; mixing AgNPs and HS-PEG(2000-10000)-NH2 at a molar ratio of 1:200, reacting in an inert gas environment at 2-8℃ and pH 8.0 for 2h, purifying to obtain PEG (AgNP) particles.
[0028] The embodiment of the present application also provides a tumor marker biochemical detection reagent prepared by blocking, washing and purifying the biosynthetic nanomaterial SPA
PEG (AgNP)
[0029] The embodiment of the present application also provides a tumor marker biochemical detection reagent prepared by blocking, washing and purifying the biosynthetic nanomaterial SPA
PEG (AgNP)
[0030] Specifically, the preparation method of the tumor marker biochemical detection reagent comprises the following steps: taking a blocking solution, adding the purified biosynthetic nanometer material SPA
PEG (AgNP)
PEG (AgNP)
PEG (AgNP)
[0031] The following specific examples are respectively taken as examples of ferritin (FER), carcinoembryonic antigen (CEA), alpha-fetoprotein (AFP), total prostate specific antigen (TPSA), and gastrin 17 (G17) in human serum samples for detection, but are not used to limit the scope of the present application. The specific techniques or conditions not mentioned in the examples are carried out according to the techniques or conditions described in the literature in the art, or according to the product instructions. The reagents or instruments not mentioned by the manufacturer are conventional products that can be purchased through regular channels.
[0032] The preparation process of the SPA
PEG (AgNP)
PEG (AgNP)
PEG (AgNP)
[0033] The preparation of the microbial fermentation-based biological silver nanoparticles AgNPs comprises strain activation and culture, preparation of biological silver nanoparticles AgNPs, centrifugal purification of biological silver nanoparticles, and characterization and identification of biological silver nanoparticles, and is prepared by the following steps:
[0034] Further, the strain activation and culture are prepared by the following steps: picking Fusarium oxysporum spores from a PDA slant, inoculating into 50 mL of PDB culture medium (250 mL conical flask), culturing at 28°C with 150 rpm shaking for 48 hours until the mycelium grows vigorously, filtering the culture solution through a 0.45 μm filter membrane to remove the mycelium, and reserving the filtrate at 4°C for standby.
[0035] Further, the preparation of the biological silver nanoparticles AgNPs is prepared by the following steps: take 20 mL filtrate, add 1 mM AgNO3 solution (final concentration, i.e. 20 mL filtrate + 200 μL 100 mM AgNO3); at pH = 8.0, 30°C, 100 rpm, avoid light oscillation reaction for 36 hours; every 6 hours take sample, detect LSPR peak at 400-450 nm by UV-Vis.
[0036] Further, the centrifugal purification of the biological silver nanoparticles is prepared by the following steps: under the condition of avoiding light, the reaction liquid is centrifuged at 12000 rpm for 20 minutes, the supernatant is discarded to remove unreacted Ag + and impurities; the precipitate is resuspended and washed 3 times with sterile water; the AgNPs suspension is loaded into a dialysis bag (MWCO 10 kDa) and dialyzed in ultrapure water for 24 hours, and the liquid is changed every 6 hours; the purified AgNPs solution is sterilized by 0.22 μm filter membrane, and stored at 4°C in the dark or freeze-dried.
[0037] Further, the characterization and identification of the biological silver nanoparticles are identified by the following steps: (1) ultraviolet-visible spectrum scanning: wavelength range 300-600 nm, characteristic LSPR absorption peak at 400-450 nm, absorption peak value positively correlated with biological synthesis time; (2) dynamic light scattering (DLS), (10 nm≤average particle size≤15 nm, PDI≤0.3); (3) Zeta potential, (Zeta potential<-20 mV).
[0038] Further, the results of ultraviolet-visible spectrum scanning of the biological silver nanoparticles are shown in Figure 3 , the results of dynamic light scattering (DLS) of the biological silver nanoparticles are shown in Figure 4 , the results of Zeta potential of the biological silver nanoparticles are shown in Figure 5 , and the characterization results of the biological silver nanoparticles are shown in Table 1.
[0039] Table 1 Characterization results of biological silver nanoparticles
[0040]
[0041] The wrapping of the biological silver nanoparticles based on PEG comprises AgNPs pretreatment, PEG wrapping of AgNPs, purification of high uniformity AgNP-PEG particles, and product identification, which are prepared by the following steps:
[0042] Further, the AgNPs pretreatment is prepared by the following steps: under the condition of avoiding light, the purified AgNPs are resuspended in 1 mM HEPES (pH 8.0).
[0043] Further, the PEG coating of the AgNPs is prepared by the following steps: in the dark, take mPEG (6000)-NHS, freshly prepare 100 mM mother liquor with anhydrous DMSO; mix AgNPs with HS-PEG (6000)-NH2 at a molar ratio of 1:200, react at 4°C in an inert gas environment (N2) at pH 8.0, 200 rpm for 2 hours. 15 minutes before the end, add 1 / 10 volume of 0.5 M glycine (pH 8.0), continue stirring until the reaction is complete.
[0044] Further, the purification of the high-uniformity AgNP-PEG particles is prepared by the following steps:
[0045] Under the conditions of 4°C and light protection, use a 100 kDa ultrafiltration membrane to wash with PBS to remove small molecular impurities; use a cation exchange column (SP Sepharose FF) to remove PEG-ized nanoparticles to obtain high-uniformity AgNP-PEG particles; filter with a 0.22 μm PVDF membrane to remove bacteria, and store at 4°C.
[0046] Further, the product identification is identified by the following steps: (1) dynamic light scattering (DLS) (20 nm≤average particle size≤30 nm, PDI≤0.3); (2) Zeta potential (the Zeta potential of AgNP-PEG is lower than that of AgNPs).
[0047] Further, the dynamic light scattering (DLS) results of the AgNP-PEG particles are shown in Figure 4 , the Zeta potential results of the AgNP-PEG particles are shown in Figure 5 , and the characterization results of the AgNP-PEG particles are shown in Table 2.
[0048] Table 2 Characterization results of AgNP-PEG particles
[0049]
[0050] The preparation of the fusion protein linker based on the structure of bacterial S-layer protein comprises the following steps: fusion construction of S-layer protein (EA1) and Protein A or polypeptide, expression of EA1-Protein A fusion protein, preparation of EA1-Protein A fusion protein, and product identification.
[0051] Further, the fusion construction containing S-layer protein (EA1) and Protein A or polypeptide is prepared by the following steps: (1) extracting the DNA sequence of S-layer protein from the previously prepared E. coli strain containing S-layer protein sequence; adding the sequence GGCAGCTACTGGTACAACGTGTGGTTC in the ORF of S-layer protein, which corresponds to the fusion protein EA1- GSYWYNVWF; (2) transfecting the fusion plasmid into E. coli to construct an expression strain.
[0052] Further, the expression of the fusion protein EA1-Protein A is prepared by the following steps: taking a single colony to culture under double-antibiotic conditions at 37℃ for 16 hours to the logarithmic phase (OD 600 is 0.4-0.6); adding IPTG with a final concentration of 1 mM, inducing culture at 150 rpm and 28℃ for 4 hours to harvest the bacterial cells; centrifuging at 2-8℃ and 4000g for 10 min to collect the bacterial cells and discard the supernatant.
[0053] Further, the fusion protein EA1-Protein A is prepared by the following steps: using a high-pressure homogenizer to crush the bacterial cells at 4℃ with 16500 psi for 2 cycles, centrifuging and discarding the residue; using standard SEC method (molecular exclusion chromatography) to obtain the fusion protein; desalting the target protein by ultrafiltration through a 30KD ultrafiltration membrane; finally, concentrating to an appropriate volume using polyethylene glycol 20000, which is abbreviated as SPA, and storing at -15~-25℃ after dispensing.
[0054] Further, the product is identified by the following steps: (1) detecting the protein concentration by BCA method, and the concentration should be greater than 3.0 mg / mL; (2) detecting the protein purity by SDS-PAGE method, and the molecular weight range is 186-200KD, and the protein purity should be greater than 95%.
[0055] Further, the detection of protein purity by SDS-PAGE method is shown in Figure 6 , and the characterization results of SPA protein are shown in Table 3.
[0056] Table 3 Characterization results of SPA protein
[0057]
[0058] Further, the final assembly of the working nanoparticles, including the self-assembly of SPA on the surface of PEG(AgNP) particles, the detection of SPA
PEG(AgNP)
[0059] Further, the SPA self-assembles on the surface of the PEG(AgNP) particles, and is prepared by the following steps: self-assembly of the SPA on the surface of the PEG(AgNP) particles: equal molar amounts of the PEG(AgNP) particles and the SPA protein are mixed at 4°C, and assembled overnight at 10 mM CaCl2at 4°C to obtain a SPA
PEG(AgNP)
[0060] Further, detection of the SPA
PEG(AgNP)
PEG(AgNP)
[0061] Further, the dynamic light scattering (DLS) result of the SPA
PEG(AgNP)
PEG(AgNP)
PEG(AgNP)
[0062] Table 4 Characterization result of the SPA
PEG(AgNP)
[0063]
[0064] Further, the antibody is coupled by the following steps: equal molar amounts of an antibody against a target detection object and the SPA
PEG(AgNP)
PEG(AgNP)
[0065] Further, the working nanoparticles are purified by the following steps: 30KD ultrafiltration purification and washing, and 0.45 μm filter membrane filtration.
[0066] Further, the product is identified by the following steps: molecular sieve detection. The product is run on a molecular sieve, and whether the SPA
PEG(AgNP)
[0067] Further, the elution time of the SPA
PEG(AgNP)
PEG(AgNP)
PEG(AgNP)
PEG(AgNP)
[0068] The preparation of the SPA
PEG(AgNP)
[0069] Further, the blocking of the SPA
PEG(AgNP)
PEG(AgNP)
[0070] Further, the washing and purifying of the SPA
PEG(AgNP)
PEG(AgNP)
[0071] Further, the resuspension and preservation of the SPA
PEG(AgNP)
PEG(AgNP)
[0072] In the preparation process of the SPA
PEG(AgNP)
[0073] Further, the blocking solution is prepared by the following steps: measure 800mL of purified water with a graduated cylinder into a clean beaker, respectively weigh 0.75g of glycine, 1.00g of sodium azide, and 200.00g of BSA into the beaker, and stir until completely dissolved. Adjust the pH of the solution to 7.4±0.1, add purified water to constant volume to 1000mL, and filter with a 0.45μm filter membrane.
[0074] Further, the preparation of the glycine washing and purifying buffer is prepared by the following steps: 800 mL of purified water is measured by a measuring cylinder and put into a clean beaker, 0.75 g of glycine is weighed and added into the beaker, and stirred until completely dissolved. The pH of the solution is adjusted to 7.4±0.1, purified water is added to 1000 mL, and filtered with a 0.45 μm filter membrane.
[0075] Further, the preparation of the storage solution is prepared by the following steps: 800 mL of purified water is measured by a measuring cylinder and put into a clean beaker, 15.01 g of glycine, 50.00 g of sucrose, 50.00 g of mannitol, 40.00 g of trehalose, and 50.00 g of glycerol are weighed and added into the beaker, respectively, and stirred until completely dissolved. The pH of the solution is adjusted to 8.2±0.1, purified water is added to 1000 mL, and filtered with a 0.45 μm filter membrane.
[0076] Further, the method for detecting ultramicro tumor markers based on the biosynthetic nanomaterial SPA
PEG(AgNP)
PEG(AgNP)
[0077] Further, the method for detecting ultramicro tumor markers based on the biosynthetic nanomaterial SPA
PEG(AgNP)
PEG(AgNP)
PEG(AgNP)
[0078] Example 1: Gastrin 17 detection method based on biosynthetic nanomaterials
[0079] 1) The preparation method of SPA
PEG(AgNP)
[0080] Equal molar amounts of anti-gastrin 17 antibody and SPA
PEG(AgNP)
PEG(AgNP)
[0081] Take the blocking solution, add the purified working nanoparticles SPA
PEG(AgNP)
[0082] The prepared SPA
PEG(AgNP)
[0083] 2) Verification of the limit of quantification of gastrin 17
[0084] Experimental method: 5 samples at the limit of quantification concentration were detected with the reagent, each sample was detected 3 times, and the detection was performed for 3 days. The error allowed range of the detection value was limit of quantification ± 25%, the number of test results of each sample falling within the allowed error range was calculated, and the percentage of all sample measurement results meeting the acceptable target standard of LoQ statement was calculated. Compared with the lower limit value in the table, if the percentage is greater than or equal to the corresponding result in the table, it is considered that the verification is successful.
[0085]
[0086] The experimental data and results are shown in Table 5.
[0087] Table 5 Analysis of limit of quantification verification data
[0088]
[0089] The experimental results show that: through the limit of quantification verification of the reagent for detecting gastrin 17, the percentage of meeting the accuracy target is greater than 95%, which is greater than the minimum percentage (88%) required when the sample size is 45 in the consensus, and the LoQ verification is passed.
[0090] 3) Verification of the linear interval of gastrin 17
[0091] Experimental method: the sample near the upper limit of the linear range is diluted to at least 5 concentrations in a certain proportion, and the low concentration sample should be close to the lower limit of the linear interval. According to the method of the kit instruction, each concentration sample is detected 3 times, the average value is calculated, the linear regression equation is obtained by regression analysis of the average value of the measured concentration (y) and the corresponding theoretical concentration value or dilution multiple (x), and the linear correlation coefficient r is calculated. The result should meet the linear correlation coefficient (r) greater than 0.99 in the range of [1.5, 500] pmol / L. The relative bias of each measured value and the theoretical concentration value should be within ±10%.
[0092] Test data and results are shown in Table 6.
[0093] Table 6 Linear interval verification data analysis table
[0094]
[0095] The test results show that the linear interval verification of the reagent for detecting gastrin 17 prepared by the method is carried out, the linear correlation coefficient (r) is greater than or equal to 0.9998 in the range of [1.5, 500] pmol / L, and the linear relative deviation is not more than ±10%. It meets the linear requirement of gastrin 17 in clinic.
[0096] Example 2: Ferritin detection method based on biosynthetic nanomaterials
[0097] 1) The preparation method of SPA
PEG(AgNP)
[0098] At 4°C, equal molar amounts of anti-ferritin antibody and SPA
PEG(AgNP)
PEG(AgNP)
[0099] Take the blocking solution and add it to the purified working nanoparticles SPA
PEG(AgNP)
PEG(AgNP)
PEG(AgNP)
[0100] Using the prepared SPA
PEG(AgNP)
[0101] 2) Verification of ferritin quantitative limit
[0102] Experimental method: 5 samples at the limit of quantification concentration were detected by reagent, each sample was repeated 3 times, and each sample was tested for 3 days. The error allowed range of the detection value was quantification limit ± 25%, the number of test results of each sample falling within the allowed error range was calculated, and the percentage of all sample measurement results meeting the acceptable target standard of LoQ statement was calculated. Compared with the lower limit value in the following table, if the percentage is greater than or equal to the corresponding result in the table, it is considered that the verification is successful.
[0103]
[0104] The test data and results are shown in Table 7.
[0105] Table 7 Quantitative limit verification data analysis table
[0106]
[0107] The test results show that: by verifying the quantitative limit of the ferritin detection reagent, the percentage of meeting the accuracy target is greater than 97.8%, which is greater than the minimum percentage (88%) required when the sample size is 45 in the consensus, and the LoQ verification is passed.
[0108] 3) Verification of ferritin linear interval
[0109] Experimental method: The high-value sample close to the upper limit of the linear range is diluted to at least 5 concentrations in a certain proportion, and the low-value sample close to the lower limit of the linear interval. According to the kit instruction method, each concentration of sample is repeated 3 times, the average value is calculated, the measured concentration average value (y) is regressed with the corresponding theoretical concentration value or dilution multiple (x), the linear regression equation is calculated, and the linear correlation coefficient r is calculated. The result should meet the range of [1, 1500] ng / mL, and the linear correlation coefficient (r) is greater than 0.99. The relative bias of each measured value and the theoretical concentration value should be within ±10%.
[0110] The test data and results are shown in Table 8.
[0111] Table 8 Linear interval verification data analysis table
[0112]
[0113] The test results show that: through linear interval verification of the reagent for detecting ferritin prepared by the method, in the range of [1, 1500] ng / mL, the linear correlation coefficient (r) is greater than or equal to 0.9962, and the linear relative deviation is not more than ±10%. It meets the linear requirements of ferritin in clinic.
[0114] Example 3: Carcinoembryonic antigen detection method based on biosynthetic nanomaterials
[0115] 1) The preparation method of SPA
PEG(AgNP)
[0116] Take equal molar amounts of anti-carcinoembryonic antigen antibody and SPA
PEG(AgNP)
PEG(AgNP)
[0117] Take the blocking solution and add it to the purified working nanoparticles SPA
PEG(AgNP)
PEG(AgNP)
PEG(AgNP)
[0118] Use the prepared SPA
PEG(AgNP)
[0119] 2) Verification of the quantitative limit of carcinoembryonic antigen
[0120] Experimental method: use the reagent to detect 5 samples at the quantitative limit concentration, each sample is repeated 3 times, and each sample is tested for 3 days. Take the quantitative limit ±25% as the allowable error range of the test value, calculate the number of test results of each sample falling within the allowable error range, and calculate the percentage of all sample measurement results meeting the acceptable target standard of LoQ statement. Compare with the lower limit value in the following table. If the percentage is greater than or equal to the corresponding result in the table, the verification is considered successful.
[0121]
[0122] The test data and results are shown in Table 9.
[0123] Table 9 Quantitative limit verification data analysis table
[0124]
[0125] The test results show that: by verifying the quantitative limit of the reagent for detecting carcinoembryonic antigen, the percentage of meeting the accuracy target is 95.6%, which is greater than the required minimum percentage (88%) when the sample size is 45 in the consensus, and the LoQ verification is passed.
[0126] 3) Verification of the linear interval of carcinoembryonic antigen
[0127] Experimental method: The high-value sample close to the upper limit of the linear range is diluted by a certain proportion to at least 5 concentrations, and the low-value sample close to the lower limit of the linear interval. According to the method of the kit instructions, operate, detect each concentration of sample 3 times, calculate the average value, and perform regression analysis on the average value of the measured concentration (y) and the corresponding theoretical concentration value or dilution multiple (x), to obtain the linear regression equation, calculate the linear correlation coefficient r, and the result should meet the linear correlation coefficient (r) greater than 0.99 in the range of [0.2, 600] ng / mL. Calculate the relative bias of each measured value and the theoretical concentration value, which should be within ±10%.
[0128] The test data and results are shown in Table 10.
[0129] Table 10 Linear interval verification data analysis table
[0130]
[0131] The test results show that: by verifying the linear interval of the carcinoembryonic antigen reagent prepared by the method, the linear correlation coefficient (r) is greater than or equal to 0.9976 in the range of [0.2, 600] ng / mL, and the linear relative deviation is not more than ±10%. It meets the linear requirements of carcinoembryonic antigen in clinical practice.
[0132] Example 4: Alpha-fetoprotein detection method based on biosynthetic nanomaterials
[0133] 1) The method for preparing SPA
PEG(AgNP)
[0134] At 4°C, take equal molar amounts of anti-alpha-fetoprotein antibody and SPA
PEG(AgNP)
PEG(AgNP)
[0135] Take the blocking solution, add the purified working nanoparticles SPA
PEG(AgNP)
PEG(AgNP)
PEG(AgNP)
[0136] The prepared SPA
PEG(AgNP)
[0137] 2) verification of the limit of quantification of alpha fetoprotein
[0138] Experimental method: 5 samples of limit of quantification concentration were detected by reagent, each sample was repeated 3 times, and 3 days were tested. The error allowed range of the detection value was limit of quantification ± 25%, the number of test results of each sample falling within the allowed error range was calculated, so as to calculate the percentage of all sample measurement results meeting the acceptable target standard of LoQ statement, and compared with the lower limit value in the following table. If the percentage is greater than or equal to the corresponding result in the table, it is considered that the verification is successful.
[0139]
[0140] The test data and results are shown in Table 11.
[0141] Table 11 limit of quantification verification data analysis table
[0142]
[0143] The test results show that: by verifying the limit of quantification of the reagent for detecting alpha fetoprotein, the percentage of meeting the accuracy target is 100%, which is greater than the minimum percentage (88%) required when the sample size is 45 in the consensus, and the LoQ verification is passed.
[0144] 3) verification of the linear interval of alpha fetoprotein
[0145] Experimental method: the sample with high value near the upper limit of linear range is diluted to at least 5 concentrations in a certain proportion, and the sample with low value concentration should be near the lower limit of the linear interval. According to the method of the kit instructions, operate, detect each concentration of sample 3 times, calculate the average value, and carry out regression analysis on the average value of measured concentration (y) and the corresponding theoretical concentration value or dilution multiple (x), obtain the linear regression equation, calculate the linear correlation coefficient r, and the result should meet the linear correlation coefficient (r) greater than 0.99 in the range of [1, 1500] ng / mL. Calculate the relative bias of each measured value and the theoretical concentration value, which should be within ±10%.
[0146] Test data and results are shown in Table 12.
[0147] Table 12 Linear interval verification data analysis table
[0148]
[0149] The test results show that: by linear interval verification of the reagent for detecting alpha-fetoprotein prepared by the method, the linear correlation coefficient (r) is greater than or equal to 0.9966 in the range of [1, 1500] ng / mL, and the linear relative deviation is not more than ±10%. It meets the linear requirements of alpha-fetoprotein in clinic.
[0150] Example 5: Total prostate specific antigen detection method based on biosynthetic nanomaterials
[0151] 1) The preparation method of SPA
PEG(AgNP)
[0152] At 2~8℃, equal molar amount of anti-prostate specific antigen antibody and SPA
PEG(AgNP)
PEG(AgNP)
[0153] Take the blocking solution, add the purified working nanoparticles SPA
PEG(AgNP)
[0154] The prepared SPA
PEG(AgNP)
[0155] 2) Verification of the total prostate specific antigen limit of quantification
[0156] Experimental method: 5 samples at the limit of quantification concentration were detected by the reagent, each sample was detected 3 times, and the detection was performed for 3 days. The error allowed range of the detection value was quantification limit ± 25%, the number of test results of each sample falling within the allowed error range was calculated, and the percentage of all sample measurement results meeting the acceptable target standard of LoQ declaration was calculated. Compared with the lower limit value in the following table, if the percentage is greater than or equal to the corresponding result in the table, it is considered that the verification is successful.
[0157]
[0158] The experimental data and results are shown in Table 13.
[0159] Table 13 Analysis table of limit of quantification verification data
[0160]
[0161] The experimental results show that: by verifying the limit of quantification of the total prostate specific antigen detection reagent, the percentage of meeting the accuracy target is 97.8%, which is greater than the minimum percentage (88%) required when the sample size is 45 in the consensus, and the LoQ verification is passed.
[0162] 3) Verification of the total prostate specific antigen linear interval
[0163] Experimental method: the sample near the upper limit of linear range is diluted to at least 5 concentrations according to a certain proportion, and the low concentration sample should be close to the lower limit of the linear interval. According to the method of the kit instruction, the operation is carried out, each concentration of sample is detected for 3 times, the average value is calculated, the average value of the measured concentration (y) and the corresponding theoretical concentration value or dilution multiple (x) is regressed, the linear regression equation is obtained, the linear correlation coefficient r is calculated, and the result should meet the linear correlation coefficient (r) greater than 0.99 in the range of [0.01, 80] ng / mL. The relative bias of each measured value and the theoretical concentration value is calculated, and the relative bias should be within ±10%.
[0164] Test data and results are shown in Table 14.
[0165] Table 14 linear interval verification data analysis table
[0166]
[0167] The test results show that: by linear interval verification of total prostate specific antigen reagent prepared by the method, the linear correlation coefficient (r) is greater than or equal to 0.9979 in the range of [0.01, 80] ng / mL, and the linear relative deviation is not more than ±10%. It meets the linear requirement of total prostate specific antigen in clinic.
[0168] The above only describes the preferred embodiments of the present application and does not limit the present application. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.
Claims
1. A biochemical detection method for tumor markers based on biosynthetic nanomaterials, characterized in that, include: The biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab was mixed and incubated with the sample to be tested to allow the biosynthetic nanomaterial to specifically bind to the target tumor marker in the sample to obtain a mixed system. The visible light absorption signal of the mixture at 600-650 nm was detected using a fully automated biochemical analyzer. The content of tumor markers in the sample to be tested is determined based on the intensity of the visible light absorption signal. The SPA[PEG (AgNP)]-Ab is obtained by conjugating the SPA[PEG (AgNP)] complex with the antibody Ab of the corresponding tumor marker.
2. The biochemical detection method for tumor markers based on biosynthetic nanomaterials according to claim 1, characterized in that, The coupling steps of the SPA [PEG (AgNP)]-Ab are as follows: An equimolar amount of antibody against the target tumor marker was mixed with SPA [PEG (AgNP)] complex at 2-8℃ and kept in the dark for 12-18 hours to obtain SPA [PEG (AgNP)]-Ab.
3. The biochemical detection method for tumor markers based on biosynthetic nanomaterials according to claim 1 or 2, characterized in that, The SPA [PEG (AgNP)] complex is formed by the self-assembly of fusion protein linkers SPA on the surface of PEG (AgNP) particles; The self-assembly step of the SPA [PEG (AgNP)] complex is as follows: Equimolar amounts of PEG (AgNP) particles and SPA protein were taken at 2-8℃ and assembled overnight at 2-8℃ under 10mM CaCl2 conditions to obtain the SPA [PEG (AgNP)] complex.
4. The biochemical detection method for tumor markers based on biosynthetic nanomaterials according to claim 3, characterized in that, The fusion protein linker SPA is constructed by fusing S-layer proteins with Protein A; the S-layer proteins include SbpA, SbsB, and EA1; The construction steps of the fusion protein linker SPA include: The S-layer protein DNA sequence was extracted from E. coli strains containing the S-layer protein sequence, and the nucleotide sequence of the corresponding fusion peptide was added to the S-layer protein ORF. The fusion plasmid was transfected into E. coli, and expression and purification were performed to obtain the fusion protein linker SPA.
5. The biochemical detection method for tumor markers based on biosynthetic nanomaterials according to claim 3, characterized in that, The PEG (AgNP) particles are prepared by encapsulating bio-silver nanoparticles AgNPs with PEG. The preparation steps of the PEG (AgNP) particles include: The filtrate of Fusarium oxysporum strain was mixed with AgNO3 solution and reacted with shaking in the dark at pH 8.0, 30℃, and 100 rpm for 24-48 h to purify AgNPs. AgNPs were mixed with HS-PEG(2000-10000)-NH2 at a molar ratio of 1:200 and reacted for 2 hours at 2-8℃ in an inert gas environment with pH 8.0 to obtain PEG (AgNP) particles after purification.
6. The biochemical detection method for tumor markers based on biosynthetic nanomaterials according to claim 1, characterized in that, The tumor markers include ferritin, carcinoembryonic antigen, alpha-fetoprotein, free prostate-specific antigen, total prostate-specific antigen, carbohydrate antigen 72-4, neuron-specific enolase, pepsinogen I, pepsinogen II, gastrin 17, human epididymal protein 4, squamous cell carcinoma antigen, gastrin-releasing peptide precursor, carbohydrate antigen 153, carbohydrate antigen 19-9, carbohydrate antigen 50, carbohydrate antigen 242, tumor-associated antigen CA125, cytokeratin 19 fragment, neuron-specific protein S100-β, thyroglobulin, β2-microglobulin, abnormal prothrombin, calcitonin, human epidermal growth factor receptor 2, malignant tumor-specific growth factor, tumor necrosis factor, and prostatic acid phosphatase.
7. A biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab, characterized in that, The biosynthetic nanomaterial SPA[PEG(AgNP)]-Ab is obtained by conjugating the SPA[PEG(AgNP)] complex with an antibody Ab, a tumor marker; the SPA[PEG(AgNP)] complex is self-assembled by a fusion protein linker SPA on the surface of PEG(AgNP) particles; the PEG(AgNP) particles are biosynthetic silver nanoparticles AgNPs encapsulated in PEG; the fusion protein linker SPA is constructed by fusing S-layer protein with Protein A.
8. A biochemical detection reagent for tumor markers, characterized in that, The tumor marker biochemical detection reagent is obtained by blocking, washing, purifying, and reconstituted the biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab as described in claim 7.
9. The tumor marker biochemical detection reagent according to claim 8, characterized in that, The preparation method of the tumor marker biochemical detection reagent includes: Take the blocking solution and add it to the purified biosynthetic nanomaterial SPA [PEG (AgNP)]-Ab. Stir at room temperature for 4-5 hours and centrifuge at 2-8℃ to obtain the first precipitate. The first precipitate was redissolved in the purification buffer by washing with glycine, and then sonicated to ensure uniform dispersion of SPA [PEG(AgNP)]-Ab nanoparticles. The precipitate was then centrifuged at 2-8°C to obtain the second precipitate. The second precipitate was redissolved with the preservation solution, and ultrasonically treated to ensure uniform dispersion of SPA [PEG(AgNP)]-Ab nanoparticles. The volume was then adjusted with the preservation solution, and the mixture was filtered to obtain the final product.
10. The tumor marker biochemical detection reagent according to claim 9, characterized in that, The blocking solution comprises 0.75 g / L glycine, 200 g / L BSA, and 1 g / L sodium azide, with a pH of 7.4 ± 0.
1. The preservation solution comprises 15.01 g / L glycine, 50 g / L sucrose, 50 g / L mannitol, 40 g / L trehalose, and 50 g / L glycerol, with a pH of 8.2 ± 0.1.
Citation Information
Patent Citations
Method for predicting the response of subject suffering from viral infection of the liver to antiviral therapy
CN101821629A
Preparation method of immunoagglutination detection reagent of SPA-labeled PEGylated fluorescent nanoprobe
CN116413424A