Dressing for promoting healing of diabetic wound

Abstract

The invention relates to a dressing for promoting healing of diabetic wounds. Chitosan is dissolved in a hydrochloric acid solution at room temperature to obtain a chitosan solution; the preparation method comprises the following steps: dissolving loxoprofen in ethanol activated by 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide / N-hydroxysuccinimide, dropwise adding into a chitosan solution, adding ethanol while stirring at a high speed by using a magnetic rod to form a transparent solution, and stirring at a low speed in the dark; air-drying the solution in a drying oven to form a solid film, and thoroughly washing the solid film in ethanol to obtain a chitosan-loxoprofen conjugate; the preparation method comprises the following steps: adding chitosan-loxoprofen into a phosphate buffer solution to form a chitosan-loxoprofen solution; dissolving genipin in a phosphate buffer solution to obtain a genipin solution, stirring and mixing the chitosan-loxoprofen solution and the genipin solution at a high speed, cross-linking, and freezing in a refrigerator to obtain the chitosan-loxoprofen / genipin sponge bracket. The dressing disclosed by the invention can effectively relieve chronic inflammation, remarkably improve skin tissue regeneration and stimulate angiogenesis.

Description

Technical Field

[0001] This invention relates to a disease treatment drug, specifically a drug for promoting wound healing in diabetic patients. Background Technology

[0002] Diabetic wounds are a common and serious complication of diabetes and remain a leading cause of amputation and death worldwide, primarily caused by peripheral nerve damage, vascular dysfunction, and wound infection. The wound healing process is complex and dynamic, involving the coordinated action of various cells and signaling molecules to repair damaged tissue, and can generally be divided into three interrelated phases: inflammation, proliferation, and remodeling. For diabetic wounds, several distinct characteristics emerge, including severe and persistent inflammation, impaired angiogenesis, and impaired reepithelialization. These factors collectively contribute to the challenge of achieving effective wound closure. Persistent inflammation delays the progression from inflammation to proliferation, a key factor affecting the normal healing of diabetic wounds. Furthermore, the proliferation and migration of cells are suppressed due to the large release of inflammatory cytokines, including tumor necrosis factor (TNF)-α and interleukin (IL)-6. Macrophages are one of the key immune cells regulating the inflammatory process and can be activated and polarized into different phenotypes, mainly divided into the classical activated M1 phenotype with pro-inflammatory effects and the alternative activated M2 phenotype with anti-inflammatory capabilities. During the proliferative phase, M2 macrophages significantly influence vascular bed regeneration, cell proliferation, and suppress inflammatory responses, thereby promoting wound healing. Due to the complex inflammatory immune microenvironment resulting from intense inflammatory stimulation in diabetic wounds, M1 macrophages become overactivated and dominant. This imbalance and glucose-induced immunosuppression further contribute to chronic inflammation, impaired angiogenesis, and delayed healing in diabetic wounds. To address this issue, strategies to reverse this immunosuppression and promote M2 polarization have emerged as effective methods to facilitate the transition from the inflammatory phase to the proliferative phase and further improve diabetic wound healing.

[0003] Loxoprofen (LOX), 2-(4-((2-oxocyclopentyl)methyl)phenyl)propionic acid, was marketed in Japan in 1986 as an anti-inflammatory drug by Daiichi Sankyo Co., Ltd. LOX is a prodrug of the non-selective NSAID benzoxoprofen; it is one of the most widely used nonsteroidal anti-inflammatory drugs (NSAIDs) for reducing inflammation, pain, and postoperative tissue adhesions. Macrophages are the primary target for LOX's anti-inflammatory effects. However, LOX is typically delivered orally via tablets; repeated oral administration of LOX can lead to gastric mucosal damage and upper gastrointestinal bleeding, thus limiting its oral use. Furthermore, oral administration makes it difficult to control the sustained release of the drug at the target site in the body. Therefore, developing a drug suitable for diabetic wound healing, minimizing adverse reactions, and ensuring therapeutic efficacy is a topic that needs to be discussed here. Summary of the Invention

[0004] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a dressing that promotes wound healing in diabetic patients.

[0005] To achieve the above objectives, the present invention provides the following technical solution: A dressing for promoting wound healing in diabetic patients, characterized in that the dressing is prepared by the following steps: Step 1: Dissolve 1.61 g of chitosan in 100 mL of hydrochloric acid solution at room temperature by continuous stirring to prepare a chitosan solution; Step 2: Dissolve 0.246 g, 1 mM loxoprofen in 20 mL of ethanol, then add 0.96 g, 6.18 mmol of (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 0.28 g, 5.95 mmol of N-hydroxysuccinimide to obtain a loxoprofen solution with the carboxyl group activated. Add the loxoprofen solution dropwise to the chitosan solution in Step 1, and add 80 mL of ethanol while stirring at 800 rpm with a magnetic rod to ensure uniform dispersion and the formation of a clear solution. Step 3: In the dark, keep the transparent solution from Step 2 at 25 °C and stir at 200 rpm for 6 hours. The solution was then air-dried in a 37 °C oven until it became a solid film, and then thoroughly washed several times in ethanol to obtain a solid film chitosan-loxoprofen conjugate. Step 4: Add the chitosan-loxoprofen conjugate obtained in Step 3 to 80 mL of phosphate buffer. The amount of chitosan-loxoprofen added is 1.6 g. Stir magnetically until the chitosan-loxoprofen solution is dissolved at 2% w / v. Step 5: Dissolve 0.2 g of genipin in 40 mL of phosphate buffer to prepare a 0.5% w / v genipin solution; Step six: The chitosan-loxoprofen solution and genipin solution prepared in step four are mixed at a volume ratio of 4:1 by high-speed stirring, poured into a mold for cross-linking for 24 h, and then placed in a -80 ℃ freezer for freezing. Finally, the chitosan-loxoprofen / genipin sponge scaffold is prepared by freeze drying.

[0006] A novel freeze-dried scaffold was developed using the aforementioned technical approach, through amino cross-linking of gardenia extract genipin (GP) with chitosan-loxoprofen conjugate (CS-LOX). This design integrates covalently grafted LOX into a mechanically stable network formed by precise genipin-mediated cross-linking to achieve sustained anti-inflammatory drug release. Transcriptomic analysis (RNA-seq) showed that the CS-LOX / GP scaffold significantly downregulated the TNF, IL-17, and NF-κB signaling pathways in macrophages, promoting a therapeutic M1 to M2 phenotypic transition. In a rat model of diabetic wounds, CS-LOX / GP treatment effectively alleviated chronic inflammation, significantly improved skin tissue regeneration, and stimulated angiogenesis.

[0007] The present invention will now be further described with reference to the accompanying drawings. Attached Figure Description

[0008] Figure 1 Characterization of the physicochemical properties of the scaffold; Figure 2 Figures showing the results of antibacterial properties and hemostasis tests; Figure 3 Results of immunofluorescence staining analysis of wound healing quality Figure 1 ; Figure 4 Results of immunofluorescence staining analysis of wound healing quality Figure 2 ; Figure 5 Gross photographs taken 7 days after subcutaneous implantation of CS / GP and CS-LOX / GP stents; Figure 6 Histological images of H&E and Masson trichrome staining on day 7; Figure 7 High-magnification images of cells within fibrous capsules and scaffolds; Figure 8 A diagram showing the number of cells in the fibrous capsule; Figure 9 A diagram showing the number of cells in the scaffold; Figure 10 This is a quantitative diagram of the thickness of the fibrous capsule. Detailed Implementation

[0009] Example 1: Preparation of CS-LOX / GP foam scaffold.

[0010] The CS-LOX / GP scaffold was synthesized via a two-step method. First, loxoprofen (LOX) was coupled to chitosan (CS) via 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide (EDC) / N-hydroxysuccinimide (NHS) carbodiimide chemistry in an ethanol / water solution. Briefly, 1.61 g of CS (-10 mM repeating unit) was dissolved in 100 mL of 0.1 M hydrochloric acid (HCl) solution at room temperature with continuous stirring. Simultaneously, 0.246 g of LOX (1 mM) was dissolved in 20 mL of ethanol activated by EDC (0.96 g) / NHS (0.28 g) and added dropwise to the chitosan (CS) solution. 80 mL of ethanol was added under high-speed stirring with a magnetic rod to allow for homogeneous dispersion and the formation of a clear solution. The reaction was maintained at low stirring at 25 °C in the dark for 6 hours. The solution was dried in an oven at 37 °C until it became a solid film, and then thoroughly washed several times in ethanol to obtain the CS-LOX conjugate.

[0011] CS-LOX conjugates were crosslinked with genipin to prepare CS-LOX / GP sponge scaffolds. In short, 1.6 g of CS-LOX was added to 80 mL of phosphate-buffered saline (PBS) (1X) and magnetically stirred until dissolved to form a CS-LOX solution (2% w / v). Subsequently, 0.2 g of GP was dissolved in 40 mL of phosphate-buffered saline (PBS) (1X) to prepare a GP solution (0.5% w / v). The CS-LOX solution (2% w / v) and the genipin (GP) solution (0.5% w / v) were mixed at a volume ratio of 4:1 by high-speed stirring, poured into a mold, crosslinked for 24 h, and then frozen overnight at -80 °C. Finally, the mixture was lyophilized to prepare the CS-LOX / GP sponge scaffold.

[0012] Example 2; Preparation of CS / GP scaffold; 1.6 g of CS was dissolved in 80 mL of hydrochloric acid (0.1 M) and stirred at high speed at room temperature until completely dissolved to prepare a chitosan (CS) solution (2% w / v). The CS solution and GP solution were mixed at a volume ratio of 4:1 by high-speed stirring, poured into a mold for crosslinking for 24 h, and then frozen overnight at -80°C. Finally, the CS / GP scaffold was prepared by freeze-drying as a control group.

[0013] Example 3: Physicochemical analysis of CS-LOX / GP sponge scaffold.

[0014] To elucidate the successful grafting of LOX and to identify the physical and chemical properties of the scaffold, FTIR and XRD tests were performed. Furthermore, the morphology, pore size, porosity, density, degradation, drug release, and water absorption of the scaffold were investigated. Detailed experimental procedures are provided in the supplementary information.

[0015] The Fourier Transform Infrared (FTIR) spectroscopy method for the CS-LOX / GP sponge scaffold is detailed in the literature (https: / / doi.org / 10.1021 / acsbiomaterials.4c00882). CS, LOX, CS-LOX, GP, CS-GP, and CS-LOX / GP were scanned using a Nicolet IS50 infrared spectrometer (Thermo Fisher Scientific). The FTIR spectra had a resolution of 0.5 cm⁻¹ and a scanning range of 4000 to 600 cm⁻¹.

[0016] X-ray diffraction (XRD) patterns of CS, LOX, and CS-LOX were determined using an X-ray diffractometer (D8 Advance, Bruker, Germany), and the crystal phase of the samples was detected in the 2θ range of 5° to 60°.

[0017] The microstructure of the scaffolds was observed using scanning electron microscopy (SEM). Gold-plated surfaces of CS-GP and CS-LOX / GP scaffolds were placed on conductive tape and imaged using a scanning electron microscope (XL desktop, Phenom, Netherlands) at an accelerating voltage of 5 kV. Twenty pores were randomly selected from individual scaffold samples, and their apertures were measured using ImageJ and statistically analyzed.

[0018] The porosity and density of the scaffold were determined using the liquid displacement method described above (https: / / doi.org / 10.1016 / j.actbio.2025.02.043). In short, the length (d), width (l), and height (h) of the scaffold were measured, and a dry sample (m0) was weighed and then immersed in ethanol for 1 hour. The scaffold was removed from the ethanol and weighed (m1). The porosity (%) was calculated using the following formula: Porosity (%) = ((m1 - m0)) / (ρ ethanol ×d×l×h)×100%; calculate the porosity of the stent; the density of the stent is calculated according to the following formula: ρ=(m0) / (d×l×h)×100%; three parallel samples are tested for each group of samples.

[0019] The volume expansion ratio and water absorption rate of the scaffold were determined by measuring the length (d0), width (l0), height (h0), and mass (md) of the dried sample. The sample was incubated in deionized water for different time periods. After gently wiping off the surface moisture with absorbent paper, the wet weight (mw) was measured. When the sample reached its maximum water absorption state, its diameter (d1) and height (h1) were measured. The volume expansion ratio was calculated using the following formula: Volume expansion ratio (%) = ((d1×l1×h1 - d0×l0×h0)) / (d0×l0×h0)×100%; the water absorption rate was calculated using the following formula: Water absorption capacity (%) = ((md) / (d0×l0×h0) / (d0×l0×h0)×100%. w - m d )) / (m d )×100%; 3 parallel samples were tested for each group of samples.

[0020] The degradability of the scaffold was assessed by cutting the dried scaffold into approximately 10 mg pieces, weighing them (m0, n = 3), and incubating them in 2 mL of phosphate-buffered saline (PBS) at 37°C and 100 rpm. Samples were collected on days 7, 14, 21, and 28, lyophilized, and weighed (m1). The remaining mass was calculated using the following formula: Mass remaining = m1 / m0 × 100%.

[0021] Drug release behavior of the stent: 10 mg LOX was weighed and LOX standard solutions of different concentration gradients were prepared. The absorbance of the solutions was measured at 220 nm using a UV spectrophotometer (TU-1810) and a standard curve was plotted. The absorbance of the supernatant of the degradation samples was measured on days 1, 4, 7, 14, 21 and 28 to evaluate the release behavior of LOX (n=3).

[0022] Fourier transform infrared (FTIR) spectroscopy analysis revealed characteristic absorption peaks for the typical functional groups in the untreated chitosan (CS) sample: amide I (C=O stretching vibration) at 1652 cm⁻¹, amide II (N–H bending vibration) at 1590 cm⁻¹, and amide III (C–N stretching vibration) at 1374 cm⁻¹. In the loxoprofen (LOX) sample, the stretching vibration peak at 2967 cm⁻¹ indicates the presence of a –OH group; a characteristic stretching vibration peak for the carboxyl group (–C=O) appears at 1540 cm⁻¹, while the peak at 1698 cm⁻¹ corresponds to the carbonyl group (–C=O) stretching vibration in the cyclopentanone structure. In the spectrum of the CS-LOX covalent conjugate, the increased absorption peak intensities at 1622 cm⁻¹ and 1521 cm⁻¹ indicate the formation of amide I and amide II bonds between the carboxyl group of LOX and the amino group on the CS molecular chain. These results suggest a grafting reaction between LOX and CS via amide bonds. The characteristic transmission peaks of genipin appear at 1679 cm⁻¹ and 1618 cm⁻¹, corresponding to the C=C stretching vibrations of the carboxymethyl group and the aromatic ring, respectively (DOI:10.1039 / d2ma00536k). With the formation of crosslinks between CS and GP, the intensities of the amide I and amide II absorption peaks of CS-GP and CS-LOX / GP both increase, indicating that the amino groups in the chitosan molecule react with the carboxymethyl groups in the genipin molecule to form a secondary amide structure. In addition, the C=O stretching vibration peak of the secondary amide in the hydrogel overlaps with the C=C stretching vibration peak of the olefin ring in the genipin molecule in the infrared region, which results in a slight broadening of the curve profile of the amide I absorption band.

[0023] X-ray diffraction (XRD) patterns showed that LOX exhibited multiple narrow and sharp diffraction peaks, indicating its good crystallinity. In the XRD patterns of chitosan (CS) and its derivatives, a distinct diffraction peak was observed at approximately 2θ = 20°, representing its partially crystalline structure. However, after grafting with the drug (LOX), this peak gradually broadened, indicating a decrease in the crystallinity of chitosan. This result suggests that the successful modification of chitosan with LOX disrupted its original highly crystalline structure, leading to a disturbance of the ordered arrangement between the CS macromolecular chains, thereby reducing the overall crystallinity.

[0024] The microstructure of the scaffolds was examined by SEM, and the results showed that all groups of scaffolds exhibited typical porous morphology. Compared with the CS / GP scaffold, the density, porosity, pore size, and volume expansion rate of the drug-grafted CS-LOX / GP scaffolds did not change significantly. Figure 1Density, porosity, and pore size diagrams of CS / GP and CS-LOX / GP; Figure 10 (p > 0.05). We further characterized the water absorption rate of the scaffold, which affects the absorption of tissue exudates and changes in scaffold volume. The water absorption rate of the hydrogel was evaluated over 120 minutes, as shown in the figure. Figure 1 The water absorption curves of CS / GP and CS-LOX / GP are shown in the figure. Both CS / GP and CS-LOX / GP absorb water rapidly within 20 minutes and gradually reach water absorption equilibrium. The water absorption curves of the two sets of stents are similar.

[0025] The degradation performance of the stent, such as Figure 1 The in vitro degradation curves of CS / GP and CS-LOX / GP are shown in the figures. At day 28, the CS / GP hydrogel degraded to 55.4 ± 9.1% of its initial mass, while the CS-LOX / GP hydrogel degraded to 60.4 ± 4.3% of its initial mass. We also assessed the cumulative release of LOX from the CS-LOX / GP hydrogel, which lasted for up to 28 days. Figure 1 (In vitro drug release curves of CS-LOX / GP over 28 days). During the first 7 days, approximately 50% of the LOX was released from the CS-LOX / GP hydrogel. Over the next 28 days, LOX release was relatively slow, with near-complete release by day 28. Overall, LOX release in vitro exhibited a slow and sustained drug delivery pattern.

[0026] Example 4; In vitro biocompatibility and biological function of the scaffold; The biocompatibility and biological function of the scaffold were evaluated through a series of in vitro experiments, including antibacterial tests, blood compatibility assessment, live / dead staining, cell proliferation assays, macrophage phenotype analysis, macrophage ROS detection, macrophage inflammatory cytokine expression, scratch healing assay, migration assay, and in vitro angiogenesis-related gene expression assays. In addition, transcriptomic analysis was performed on untreated and CS-LOX / GP-treated RAW264.7 cells. Detailed experimental procedures are provided in the supplementary information.

[0027] 1. Antibacterial performance test of the stent.

[0028] The in vitro antimicrobial activity of the scaffold was evaluated against *Escherichia coli* (ATCC 25922) and *Staphylococcus aureus* (ATCC 25923). The bacteria were cultured overnight in LB broth at 37 °C in a shaker. Subsequently, the scaffold was mixed with 200 μL of bacterial inoculum (10⁸ cfu / mL) and incubated at 37 °C for 12 h. Then, 100 μL of each diluted bacterial culture was inoculated onto LB agar and incubated at 37 °C for 12 h. Colonies were imaged using an automated colony counter (Shineso Science & Technology Co., Ltd., Hangzhou). Imagej counted the colony counts to calculate normalized survival rate (n=3).

[0029] 2. Blood compatibility test of stent.

[0030] In vitro hemolysis experiments were performed using 2% (v / v) suspension of red blood cells (RBCs). Red blood cells were obtained from fresh anticoagulated whole blood of healthy rats, diluted with physiological saline, centrifuged at 3000 rpm for 10 min, the supernatant was discarded, and the cells were washed three times with physiological saline to achieve a final suspension of 2% (v / v). During the experiment, 200 μL of pre-warmed (37 ℃, 30 min) scaffold sample (10 mm long, 5 mm wide, 3 mm high) was mixed with 500 μL of the red blood cell suspension and incubated at 37 ℃ for 1 h. After incubation, the supernatant was collected by centrifugation at 3000 rpm, and its absorbance at 540 nm was measured to assess the amount of hemoglobin released. Physiological saline and deionized water served as negative and positive controls, respectively. The hemolysis rate was calculated using the following formula: Hemolysis rate = (A s -A n ) / (A p -A n ); where A s A represents the absorbance of the supernatant in the experimental group. n Absorbance of the negative control, A p The absorbance is for positive control; three parallel samples were tested for each group of samples.

[0031] The hemostatic ability of the stent was assessed using a dynamic whole blood coagulation test. The stent was incubated at 37 °C for 5 minutes. 100 μL of fresh anticoagulated rabbit whole blood (supplemented with 10% sodium citrate) was added to the stent (10 mm long, 5 mm wide, 3 mm high) and gauze, respectively, followed by the addition of 10 μL of calcium chloride (CaCl2, 0.2 M) solution. The sample was then incubated at 37 °C for 10 minutes to allow blood coagulation. Afterward, 10 mL of deionized (DI) water was added to the sample, and the sample was shaken in a track shaker at 37 °C for 5 minutes to remove any unbound blood. The absorbance (Dt) of the supernatant was measured at 540 nm. Deionized water and physiological saline were used as positive (Dm) and negative controls (Dn), respectively. The coagulation index (BCI) was calculated using the equation: BCI = (Dt / Dm) * ... t -D n ) / (D m -D n )×100%(n = 3), and 3 parallel samples were tested for each group of samples.

[0032] The whole blood clotting time was tested by adding 2 mL of whole blood (containing 10% sodium citrate) to a centrifuge tube containing a scaffold (10 mm long, 5 mm wide, 3 mm high), followed by 60 μL of CaCl2 solution (0.25 mol L−1). A gauze control group was cut into rectangular slices 10 mm long and 5 mm wide. The centrifuge tubes were inverted, and clot formation was recorded each time (n = 3).

[0033] Prothrombin time (PT), activated partial thromboplastin time (APTT), and thrombin time (TT) were used to assess the coagulation activation pathway and clotting time of the stent. Whole blood from healthy New Zealand rabbits (containing 3.8% sodium citrate, 9:1 ratio) was centrifuged at 3000 rpm for 15 minutes to obtain platelet-free plasma. The stent was then incubated with 100 μL of platelet-free plasma at 37°C for 2 minutes. For the control group, gauze was cut into rectangles 10 mm long and 5 mm wide. Next, 100 μL of PT reagent was added to the incubated hydrogel, and the time required for clot formation in the platelet-free plasma was recorded. To measure APTT, 100 μL of LAPTT reagent was added to the hydrogel, and then incubated at 37°C for 3 minutes. Subsequently, 100 μL of 0.025 M CaCl2 solution was added, and APTT was recorded. For TT measurement, 200 μL of platelet-free plasma was added to the hydrogel, and then incubated at 37°C for 2 minutes. Then, add 200 μL of TT reagent and record TT (n=3).

[0034] 3. Cell compatibility test of scaffold: The scaffold was placed in a complete medium consisting of high glucose DMEM, 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin for 24 h to prepare scaffold conditioned medium.

[0035] Mouse fibroblasts (NIH3T3, ATCC), human umbilical vein endothelial cells (HUVECs, ATCC), and mouse macrophages (RAW 264.7, ATCC) were provided by the Cell Bank of the Chinese Academy of Sciences for cell compatibility assessment. Cells were cultured in DMEM supplemented with 10% FBS and 1% penicillin / streptomycin antibiotics at 37 °C in a humidified incubator containing 5% CO2. NIH3T3 and RAW 264.7 cells were cultured at 0.8 × 10⁻⁶ cells / cells. 4 Cells were seeded at a density of 10 cells / well in 48-well plates and cultured in a CO2 incubator at 37 °C. After the cells were firmly attached, they were replaced with medium containing various scaffold conditions for incubation. Cell proliferation was assessed on days 1 and 4 using the Cell Count Kit-8 (CCK-8) assay. Briefly, medium was aspirated, and 200 μL of CCK-8 working solution (serum-free medium: CCK-8 solution = 9:1, v / v) was added to each well, followed by incubation for 1 hour and 30 minutes. Approximately 100 μL of solution was collected from each well, and absorbance was measured at 450 nm using a microplate reader (Thermo Fisher Multiskan FC, Thermo Fisher Scientific, Waltham, MA, USA). Live / dead staining was performed using calcein AM and propidium iodide (PI), and cells were imaged using a fluorescence microscope (DMi, Leica, Germany). Cell viability was determined using ImageJ (n = 3).

[0036] Simultaneously, the scaffolds were sliced ​​into thin slices (1 mm thick) and sterilized by irradiation of both sides with ultraviolet (UV) light for 12 hours. The sterilized scaffolds were placed in 48-well cell culture plates, fixed with sterile stainless steel rings, and 600 μL of the corresponding complete culture medium was added to each well. The scaffolds were incubated at 37°C and 5% CO2. NIH3T3 and HUVECs were seeded on the scaffolds (cell density = 2 × 10⁴ cells / well) and cultured in an incubator for 1 and 4 days. On day 4, cells were stained with DAPI / F-actin for cytoskeleton staining and imaged using a fluorescence microscope. Cell proliferation was assessed using a CCK-8 assay on days 1 and 4 (n = 3).

[0037] 4. Anti-inflammatory and antioxidant performance test of the stent.

[0038] The anti-inflammatory and antioxidant capabilities of the scaffold were assessed using lipopolysaccharide (LPS)-stimulated macrophages. Briefly, RAW 264.7 cells (3 × 10⁶ cells / well) were seeded in six-well plates and cultured for 12 hours. The cells were then incubated for 8 hours in serum-free medium containing 100 ng / mL LPS. The LPS-containing medium was then removed, and the cells were incubated in scaffold-conditioned medium for 24 hours.

[0039] The cell pellet was resuspended in 1 mL of phosphate-buffered saline (PBS 1X) containing 1 μg PE anti-mouse CD86 antibody and 1 μg FITC anti-mouse CD2066 antibody (BioLegend) for immunophenotyping analysis. To maintain cell viability and prevent non-specific antibody binding, the resuspended cells were incubated on ice for 30 min, followed by two washes to remove unbound antibodies. CD86 and CD206 expression was analyzed using a CytoFLEX flow cytometer (Becton Dickinson, USA) and analyzed using FlowJo (FlowJo V 10) (n=3).

[0040] Antioxidant performance was assessed using a 2′,7′-dichlorodihydrofluorescein (DCFH-DA) assay kit (Beyotime, China) to determine intracellular reactive oxygen species (ROS) levels. ROS levels were detected using an inverted fluorescence microscope and quantified by flow cytometry (n=3).

[0041] According to the manufacturer's instructions (n=3), the NO level in the centrifuged supernatant was determined using a nitric oxide (NO) detection kit (Beyotime, China).

[0042] RAW 264.7 cells were cultured to extract RNA. Total RNA was isolated from the samples using the EZ-press RNA purification kit (EZBioscience, Roseville, MN, USA). RNA was then reverse transcribed using the Color Reverse Transcription Kit (EZBioscience) to generate complementary DNA (cDNA). Quantitative qRT-PCR analysis was then performed using 2×Color SYBR GreenqPCR Master Mix (EZBioscience). The relative expression levels of the target genes (n=3) were assessed using the 2–ΔΔCt method. Primer sequences are shown in Appendix S1, with GAPDH used as an internal control gene.

[0043] Table S1 RAW 264.7 Different types of primers used for quantitative RT-PCR in cells; Gene names Sequences Forward 5'- AGGTCGGTGTGAACGGATTTG -3’Reverse 5'- TGTAGACCATGTAGTTGAGGTCA -3’ Forward 5’- CTGCAAGAGACTTCCATCCAG -3’Reverse 5’- AGTGGTATAGACAGGTCTGTTGG -3’ Forward 5’- CAGGCGGTGCCTATGTCTC -3’Reverse 5’- CGATCACCCCGAAGTTCAGTAG -3’ Forward 5’- TGGAGAGTGTGGATCCCAAG -3’Reverse 5’- GGTGCTGATGTACCAGTTGG -3’ Forward 5’-CAGGTGTGCTTCTGCCAAGAT -3’Reverse 5’- GGTAGGTATCCGTCATGGTCT-3’ Forward 5’- CTTACTGACTGGCATGAGGATCA -3’Reverse 5’- GCAGCTCTAGGAGCATGTGG -3’ Forward 5’- TCTCACCTCCCAACTGCTTC -3’Reverse 5’- ACTTTGCCGAGCTGTCCTTGGAGA -3’ Forward 5’- CTCCAAGCCAAAGTCCTTAGAG -3’Reverse 5’- GGAGCTGTCATTAGGGACATCA -3’

[0044] 5. RNA sequencing (RNA-seq) of the scaffold: In the RNA sequencing (RNA-seq) analysis, RAW264.7 cells activated with LPS and treated with scaffold-conditioned medium were used, and RNA was extracted by lysis using TRIZOL reagent. The RNA-seq analysis was then performed by Shanghai Xihua Yanchuang Biotechnology Co., Ltd.

[0045] 6. Preparation of macrophage conditioned medium; RAW264.7 cells were cultured at 3 × 10⁻⁶ cells / mL. 5 Cells were seeded at a density of [number] cells / well in 6-well plates. After adhesion, fresh medium containing lipopolysaccharide (LPS, 100 ng / mL) was added for 12 h of stimulation. Subsequently, the cells were gently washed with PBS 1X, and 1.5 mL of scaffold conditioned medium was added to each well. After culturing for another 24 hours, the medium was collected. The treated medium from each group was filtered through a 0.22 μm filter and then mixed with other cell culture media at a 1:1 volume ratio to prepare macrophage conditioned medium for subsequent experiments.

[0046] 7. In vitro Transwell migration of the scaffold; the migration ability of HUVECs was assessed using a Transwell migration assay. Transwell chambers were placed in 24-well cell culture plates. 200 μL of cell suspension (n = 3, 2 × 10⁶ cells per well) was added to the inserted chambers. 5 (100 cells), and 800 μL of different macrophage conditioned medium was added to the lower well. The culture plate was incubated at 37°C for 12 hours. Cells were fixed with 4% paraformaldehyde (PFA) for 30 minutes and stained with 100 μL of 1% crystal violet solution for 5 minutes. Cells on the upper side of the membrane were then carefully removed with a moistened cotton swab, and cells on the lower side of the membrane were observed using an optical microscope (Eclipse Nikon, Japan). Finally, 10% acetic acid solution was added to dissolve the crystal violet dye on the lower surface of the chamber, and the OD value was measured at 590 nm.

[0047] 8. In vitro scratch wound healing of the scaffold: HUVECs were cultured in 24-well cell culture plates (n=3, 3×10⁴ cells per well) and grown to 90% confluence. A uniform scratch was made on the cell monolayer using a sterile 200 μL pipette. Cells were washed with phosphate-buffered saline (PBS) to remove debris, and then 1 mL of the appropriate macrophage conditioned medium was added to each well. Cell migration was observed using an optical microscope at t=0 and t=24 hours. The scratch area at t=0 (P0) and t=24 hours (Pt) was counted using ImageJ, and the cell migration rate was calculated using the formula (n=3): 9. Expression of angiogenesis-related genes in HUVECs: The expression of angiogenesis-related genes in HUVECs was detected by quantitative real-time polymerase chain reaction (qRT-PCR). The genes detected included vascular endothelial growth factor (VEGF), kinase insertion site receptor (KDR), endothelial nitric oxide synthase (eNOS), and hypoxia-inducible factor (HIF). Briefly, HUVECs were seeded in 6-well plates and cultured until confluence (n = 3, 3 × 10⁶ cells / well). 5 (Number of cells). The original culture medium was then replaced with macrophage conditioned medium, and culture continued until day 5. Total RNA was extracted from the cells using TRIzol reagent, and the extracted RNA was reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). qRT-PCR reactions were performed using a NovoStart® SYBR qPCR SuperMix Plus (Novozymes Biotechnology, Shanghai) on an Applied Biosystems™ 7500 real-time quantitative PCR system. Gene expression levels were normalized using the internal control gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer sequences used in this study are shown in Table S2.

[0048] Table S2 summarizes the different types of primers used for quantitative RT-PCR of HUVEC; Gene names Sequences Forward 5'- CAAGCTCATTTCCTGGTATGACAAT -3’Reverse 5'- GTTGGGATAGGGCCTCTCTTG -3’ Forward 5’- TATGCGGATCAAACCTCACCA -3’Reverse 5’- TCGTTCTGTTCTTTTTAGGGACAC - 3’ Forward 5’ - ATCCAGTGGGGGAAGCTGCA -3′Reverse 5’- GGGAACACTGTGATGGCCGAG -3′ Forward 5’- AACAGCACATTTGTCAGGGTCCA -3’Reverse 5’- CTGGGGGTGGGTAACCAAGGTA -3’ Forward 5′-AGTCCGCAAGCCCTGAAAGC-3′Reverse 5′-GCAGTGGTAGTGGTGGCATTAGC-3′

[0049] 10. Conclusion.

[0050] 1) Regarding the in vitro biocompatibility and biological function of the stents, antibacterial tests and hemostatic ability assessments were performed. Compared with the control group, the CS / GP and CS-LOX / GP stent groups showed significantly fewer bacterial colonies. The normalized survival rates of *E. coli* co-cultured with the CS / GP and CS-LOX / GP stents were 11.04 ± 0.94% and 10.37 ± 1.53%, respectively, and those of *Staphylococcus aureus* were 11.59 ± 1.34% and 10.62 ± 3.32%, respectively. The CS-LOX / GP stent exhibited significant antibacterial activity.

[0051] The in vitro coagulation function of the stents was assessed using the blood coagulation index (BCI). Compared to the gauze in the control group, both stent groups promoted clot formation. The BCI values ​​for the control group, CS / GP, and CS-LOX / GP stents were 106.4 ± 3.8%, 52.2 ± 1.3%, and 49.3 ± 7.2%, respectively. The in vitro hemostatic performance of the hydrogels was evaluated by measuring clotting time. All samples formed clots after a period of blood incubation, and quantitative results indicated that the CS / GP and CS-LOX / GP stents had accelerated clotting times. Furthermore, blood compatibility was also an important performance indicator. Hemolysis tests showed that the solution in the positive control group turned dark red due to red blood cell rupture, while no significant color change was observed in the negative control group or any stent group. Quantitative analysis showed that the hemolysis rates of both the CS / GP and CS-LOX / GP stents were within the international standard range of ≤5%, indicating that all material groups had good blood compatibility. Figure 2 (Hemolysis rate). To assess the impact of the materials on extrinsic and intrinsic coagulation pathways, prothrombin time (PT) and activated partial thromboplastin time (APTT) were measured. Compared with the control group, the APTT values ​​of CS / GP and CS-LOX / GP stents were significantly reduced, while there were no significant differences in PT and TT values ​​(see [link to relevant documentation]). Figure 2 The stent activation portion of the thrombin activation time / prothrombin time / thrombin time.

[0052] The APPT value of the CS-LOX / GP group (40.3 ± 1.5 s) was significantly lower than that of the Control group (45.3 ± 0.6 s), but comparable to that of the CS / GP group (40.7 ± 1.2 s). There were no significant differences in PT values ​​among the CS-LOX / GP, CS / GP, and Control groups (22.7 ± 1.2 s, 21.3 ± 1.2 s, and 21.3 ± 3.1 s, respectively). Furthermore, there were no significant differences in TT values ​​among the CS-LOX / GP, CS / GP, and Control groups (15.3 ± 1.2 s, 14.7 ± 1.2 s, and 14.3 ± 2.1 s, respectively). These results indicate that the CS-LOX / GP stent can activate the intrinsic coagulation pathway.

[0053] Cell compatibility of the scaffolds was assessed using NIH3T3 cells, RAW 264.7 cells, and HUVECs. Both NIH3T3 fibroblasts and RAW 264.7 macrophages maintained good cell viability in the scaffold-conditioned medium. From day 1 to day 4, both cell types showed a majority of viable cells (green staining) and a small number of dead cells (red staining), with an increase in cell number. CCK-8 assays also showed a sustained increase in cellular metabolic activity, with no significant differences between groups. On day 4, cell viability in all groups was above 90%. Simultaneously, NIH3T3 cells and HUVECs were seeded onto the scaffolds. On day 4, DAPI / F-actin staining showed that some cells also adhered to the scaffold pore walls and exhibited a spindle-shaped morphology, indicating cell migration within the scaffold pores. CCK-8 assays also showed that cells in the scaffolds proliferated over time from day 1 to day 4.

[0054] 2) Targeting in vitro immune modulation; the transformation of macrophages from the M1 to the M2 phenotype is considered a potential anti-inflammatory treatment. Therefore, we investigated the effect of the CS-LOX / GP scaffold on macrophage polarization under LPS challenge. Transforming macrophages from the M1 to the M2 phenotype is considered a potential anti-inflammatory therapy. Flow cytometry analysis showed that after CS-LOX / GP treatment, the proportion of M1 macrophages (CD86+) changed (4.87%), while the proportion of M2 macrophages (CD206+) increased (3.8%). Furthermore, quantitative data from flow cytometry showed that compared with the Control (0.052±0.004) and CS / GP (0.276±0.081) groups, the M2 / M1 ratio in the CS-LOX / GP group was significantly increased (0.739±0.077). Flow cytometry analysis showed that the percentages of M2 macrophages (CD 206+) and M1 macrophages (CD 86+) were significantly increased after treatment with CS-LOX / GP.

[0055] To further elucidate the role of CS-LOX / GP in macrophage polarization and the regulation of inflammatory mediators, RT-PCR was used. The results showed that in the CS-LOX / GP group, the expression of pro-inflammatory genes IL-6, TNF-α, IL-1β and CCR7 was significantly downregulated, while the expression of anti-inflammatory genes IL-4, IL-10 and ARG1 was significantly upregulated, highlighting the strong immunomodulatory and pro-repair capabilities of the CS-LOX / GP scaffold.

[0056] Previous studies have shown that NO production plays an important physiological role in inflammation. High concentrations of NO are cytotoxic to cells and are associated with various inflammatory diseases. Our study shows that the application of the CS-LOX / GP scaffold significantly reduces NO levels, thereby alleviating cellular oxidative stress damage. Excessive ROS accumulation in diabetic wounds not only oxidizes surrounding lipids and proteins, causing cell damage, but also promotes the chemotaxis of inflammatory factors to the wound site, thus hindering skin regeneration (DOI: 10.1038 / s41467-020-16544-7). Therefore, RAW 264.7 cells were cultured in a pathological oxidative microenvironment induced by 100 ng / mL LPS, and intracellular ROS levels were assessed using DCFH-DA. Results showed that flow cytometry quantification revealed a significantly lower percentage of FITC-positive channels in the CS-LOX / GP scaffold group compared to other groups. Furthermore, DCFH-DA staining revealed significantly lower green fluorescence in the CS-LOX / GP scaffold group compared to the control and CS / GP groups. This finding highlights the powerful ROS scavenging capabilities of the CS-LOX / GP scaffold and underscores its potential as an effective antioxidant in wound dressing applications.

[0057] To further investigate whether cytokines and growth factors produced by macrophages activated by the CS-LOX / GP scaffold contribute to tissue repair, we cultured tissue-repair-related HUVECs in conditioned medium (CM) with pretreated macrophages. The effects of different CM treatments on HUVECs were investigated using in vitro scratch assays and Transwell migration assays. After co-culturing HUVECs with CS-LOX / GP scaffold-treated CM for 24 h, cell migration was significantly higher than in other groups. Transwell migration assays also showed similar results, with the CS-LOX / GP group significantly enhancing cell migration. We further performed qRT-PCR to assess the expression of angiogenesis-related genes in HUVECs; we found that the CS-LOX / GP group significantly upregulated the mRNA expression of angiogenesis-related genes, including VEGF, eNOS, KDR, and HIF. These data suggest that the CS-LOX / GP scaffold may enhance the angiogenesis capacity of endothelial cells through paracrine factors released by macrophages, showing great promise in promoting wound healing.

[0058] To elucidate the molecular mechanism by which the CS-LOX / GP scaffold mediates macrophage anti-inflammatory activity, transcriptomic analysis was performed. The analysis revealed distinct transcriptomic profiles between the LPS and LPS+CS-LOX / GP groups. Principal component analysis (PCA) further highlighted the transcriptional alterations induced by CS-LOX / GP treatment. Volcano plot analysis revealed that 1436 genes were upregulated and 709 genes were downregulated in the CS-LOX / GP group compared to the LPS group. To further explore the biological functions and key enrichment pathways of these differentially expressed genes (DEGs), KEGG and GO pathway enrichment analyses were performed. KEGG enrichment analysis showed that genes with significantly downregulated expression between the CS-LOX / GP group and the control group included IL-17, TNF, NF-κB, and various signaling pathways. On the other hand, the differentially upregulated gene expression between the CS-LOX / GP group and the control group in KEGG enrichment analysis was mainly related to cellular signaling and metabolism, such as ECM-receptor interaction, lysine degradation, alpha-linolenic acid metabolism, and the oxytocin signaling pathway. In GO enrichment analysis, the downregulated genes between the CS-LOX / GP group and the control group were mainly enriched in biological processes related to inflammation and immune responses, such as inflammatory response, immune response, and response to lipopolysaccharide. The upregulated genes between the CS-LOX / GP group and the control group were mainly enriched in those related to tissue remodeling and cellular regulation of inflammation, such as extracellular matrix organization and cellular component morphogenesis. Furthermore, Gene Set Enrichment Analysis (GSEA) showed downregulation of TNF, IL-17, and NF-κB signaling pathways, consistent with the results of KEGG and GO enrichment analyses. In summary, these results indicate that the CS-LOX / GP material has a positive regulatory role in inflammation relief, and its mechanism may be related to the regulation of key gene transcription.

[0059] Example 5; Animal Experiment; This animal research protocol has been approved by the Ethics Committee of Wenzhou Medical University and conducted in accordance with the "Guideline for the Care and Use of Laboratory Animals" (National Institutes of Health, 8th Edition, 2011 Revision).

[0060] 1. Subcutaneous scaffold implantation in rats: Before implantation, scaffolds with a diameter of 10 mm and a height of 2 mm were prepared and sterilized by irradiation of both sides with ultraviolet (UV) light for 12 hours. Six 6–8 week old male SD rats were purchased from Shanghai Jiesijie Laboratory Animal Co., Ltd. and housed in a standard environment with a temperature of 22–25 ℃, humidity of 40–70%, and a 12-hour light / dark cycle. Before surgery, the fur on the back of the rats was shaved and disinfected. After anesthesia with isoflurane, a small incision of about 1 cm was made along the midline of the back. Subsequently, two symmetrical subcutaneous sacs were formed on both sides of the incision by blunt dissection, and scaffolds were implanted in each sac. After implantation, the incision was sutured with 7–0 sutures. On the 7th day after surgery, the animals were sacrificed, and the scaffolds along with the surrounding tissues were removed, fixed in 4% paraformaldehyde, and then embedded in paraffin for subsequent histological analysis. Histological staining assessment of tissue response: Hematoxylin and eosin (H&E) staining and Masson trichrome staining were used to analyze the scaffold-induced tissue response. Paraffin-embedded samples were sectioned to a thickness of 5 μm and H&E stained according to standard procedures. The number of cells in the scaffold and the density of cells in the surrounding fibrous capsule were further analyzed based on the H&E images. In addition, Masson trichrome staining was performed to assess collagen deposition and fibrous capsule formation around the hydrogel. Masson stained images were used to measure the thickness of the fibrous capsule surrounding the scaffold, and related image analysis was also performed using ImageJ (n = 3). Finally, major organs, including the heart, liver, spleen, lung, and kidney, were retrieved and H&E stained. 2. Streptozotocin (STZ)-induced diabetic rats: A diabetic model was established using a cohort of 36 male SD rats aged 6 to 8 weeks. Rats were housed under controlled environmental conditions, maintained at 22±2°C, with three animals per cage to ensure sufficient space and social interaction. A diabetic rat model was established by intraperitoneal injection of streptozotocin. Successful establishment of the diabetic model was indicated by three consecutive measurements of fasting blood glucose levels greater than 16.7 mmol / L.

[0061] 3. Wound Healing Assessment: After isoflurane-induced anesthesia, the rats' back hair was carefully removed using an electric animal razor, and the surgical area was disinfected with 75% alcohol. The rats were then divided into three groups: control, CS-GP, and CS-LOX / GP, with 12 animals in each group. In each rat, a 20 mm diameter full-thickness skin wound was created on the back using a sterile biopsy punch. The wound was then covered with a suitable scaffold, bandaged, and secured with sutures. Wound healing progress was recorded at 0, 3, 7, 10, and 14 days post-healing by taking digital photographs of the wound, and the relative wound area was calculated using ImageJ. The wound size percentage was calculated using the formula: Wound closure rate = At / A0 × 100%, where A(0) and A(3,7,14,21) represent the wound area on day 0 and days 3, 7, 10, and 14, respectively.

[0062] 4. Histological and Immunofluorescence Analysis: Healing tissues from animals were harvested on postoperative days 7 and 14 and subjected to a series of histological preparations. First, samples were stained using hematoxylin-eosin (H&E) and Masson's trichrome staining. Subsequently, immunofluorescence (IF) staining was performed to assess the phenotype of macrophages and the degree of tissue repair in the damaged skin tissue. Paraffin sections were dewaxed, clarified three times in xylene for 15 minutes each, then rehydrated twice in anhydrous ethanol for 5 minutes each, rehydrated once each in 85% ethanol and 75% ethanol for 5 minutes, and finally rehydrated once in distilled water. Different slides were then incubated overnight at 4 °C with primary antibodies against α-smooth muscle actin (α-SMA) and CD31; CD86 and CD206; and VEGF and F4 / 80. After rinsing three times in PBS (pH 7.4) for 5 minutes each time, the slides were incubated with specific secondary antibodies at room temperature for 50 minutes. Subsequently, after further washing in PBS, the slides were incubated with DAPI in the dark for 10 minutes. The stained sections were examined under a Ci-S microscope (Nikon) for morphological and quantitative analysis. (DOI: 10.1186 / s12951-025-03274-5).

[0063] 5. In vivo biocompatibility of the scaffolds. To determine the in vivo biocompatibility and foreign body reaction of the scaffolds, we subcutaneously implanted CS / GP and CS-LOX / GP scaffolds into SD rats for 7 days. The results are shown below. Figures 5-10 In the CS / GP group, inflammatory features such as redness and swelling were observed around the subcutaneous site. However, this was not observed in the CS-LOX / GP stent. Both groups of stents still showed relatively complete bulging during the first 7 days; this indicates that the stents did not undergo extensive degradation during the first 7 days. Figure 5 (Mass photograph 7 days after subcutaneous implantation of CS / GP and CS-LOX / GP stents). Figure 6 Low-power images of the two scaffolds stained with H&E and Masson trichrome staining on day 7 post-implantation are shown. The CS-LOX / GP group showed a milder inflammatory response compared to the CS / GP group, as observed in H&E staining. Masson trichrome staining also showed reduced inflammation induced in the CS-LOX / GP group compared to the CS / GP group. Significant differences were found in inflammatory cell density within the fibrous capsule on day 7 post-implantation: CS / GP group = 8.3 ± 0.4 (×10³ cells / mm²), CS-LOX / GP group = 4.6 ± 1.1 (×10³ cells / mm²). Intrascaffold inflammatory cell densities were: CS / GP group = 2.70 ± 0.6 (×10³ cells / mm²), CS-LOX / GP group = 1.3 ± 0.4 (×10³ cells / mm²); the inflammatory cell density in the CS-LOX / GP group was significantly lower than that in the CS / GP group. Interfacial analysis of fibrous capsule thickness also showed that the CS-LOX / GP group (333 ± 28 μm) was significantly smaller than that of the CS / GP group (473 ± 52 μm). Furthermore, no significant lesions, such as tissue necrosis and edema, were observed in major organs including the heart, liver, lungs, spleen, and kidneys.

[0064] 6. Evaluation of the regenerative effect of the CS-LOX / GP scaffold on diabetic wounds: To evaluate the ability of the CS-LOX / GP scaffold to promote the healing of full-thickness skin wounds in diabetic rats, we conducted in vivo experiments in a STZ-induced diabetic SD rat model. Wound healing was observed on days 0, 3, 7, 10, and 14. On day 3, the wound closure rate in the CS-LOX / GP scaffold group was significantly higher than that in the CS / GP group (29 ± 6%) and the Control group (11 ± 4%), reaching 49 ± 6%. On day 14, the wounds in the CS-LOX / GP group were almost completely healed, while wounds in other groups still showed delayed healing. To further elucidate the role of the scaffold in promoting chronic wound healing, we performed histological analysis. H&E staining results showed that, compared with the Control and CS / GP groups, the wounds in the CS-LOX / GP scaffold-treated group had more neovascularization and hair follicle formation, and less inflammatory cell infiltration. On day 14, the wounds in the CS-LOX / GP scaffold-treated group had achieved complete re-epithelialization, exhibiting typical epidermal structure and morphological characteristics. Furthermore, H&E staining on day 14 revealed that the inflammatory cell density at the wound site was 0.63 ± 0.17 (×10³ cells / mm²) for the CS-LOX / GP scaffold, significantly lower than that in the Control group (2.08 ± 0.14 (×10³ cells / mm²) and the CS / GP group (1.72 ± 0.1 (×10³ cells / mm²)). Masson's trichrome staining was used to assess granulation tissue thickness to determine collagen deposition and scar length, important indicators of wound healing. Compared to the Control and CS / GP groups, the CS-LOX / GP scaffold treatment group exhibited thicker granulation tissue and significantly narrower wound margins. Dense and orderly collagen deposition was observed beneath the epidermis in this group, indicating more mature skin regeneration. In contrast, other treatment groups showed poorer skin regeneration, characterized by sparse collagen deposition and prominent wound margins. Furthermore, quantitative analysis showed that on day 14, the length of the unhealed wound in the CS-LOX / GP treatment group was only (1.64 ± 0.39 mm), which was significantly lower than that in the Control group (5.67 ± 0.61 mm) and the CS / GP group (4.36 ± 0.54 mm).

[0065] Based on observed H&E and Masson staining results, the inflammatory response in diabetic wounds treated with CS-LOX / GP scaffolds was significantly reduced. To further assess the inflammatory status during the healing process, immunofluorescence staining with CD206 (green) and CD68 (red) was performed on days 7 and 14. Compared with other groups, the CS-LOX / GP group showed a significantly higher percentage of CD206 (M2) expression in CD68-labeled macrophages. Figure 3 The IF staining on days 7 and 14 shown in the image displays a double staining pattern of CD86+ and CD206+, as well as... Figure 4 The ratio of CD86+ positive macrophages to CD206+ positive macrophages indicates that CS-LOX / GP treatment effectively alleviated the inflammatory response during the healing process in diabetic mice. In vitro studies showed that the CS-LOX / GP scaffold enhanced the expression of angiogenesis-related genes in HUVECs when cultured in LPS-induced macrophage conditioned medium, prompting us to explore in vivo angiogenesis and the formation of new blood vessel networks. CD31 and α-SMA were stained on days 7 and 14 to assess the pro-angiogenic capacity of the CS-LOX / GP scaffold. Figure 3 Double staining images of CD31 and α-SMA on days 7 and 14, and Figure 4 The quantitative data of newly formed blood vessels corresponding to α-SMA staining and the quantitative data of mature blood vessels corresponding to CD31 staining are shown in the figure. Compared with the Control group and the CS / GP group, the CS-LOX / GP scaffold treatment group showed significantly enhanced angiogenesis, with a wider positive area for CD31 and α-SMA, strongly indicating its superior pro-angiogenic activity, further accelerating the wound closure process. To investigate whether the enhanced angiogenesis in the CS-LOX / GP group in diabetic wounds is related to macrophage behavior, tissue samples were collected on days 7 and 14 and subjected to dual immunofluorescence staining for VEGF (vascular endothelial growth factor, red) and F4 / 80 (macrophage marker, green). Compared with the Control group and the CS / GP group, the CS-LOX / GP group had higher VEGF fluorescence intensity, indicating higher VEGF expression levels in these groups. In addition, the proportion of macrophages expressing VEGF in the CS-LOX / GP group was significantly higher than that in the other four groups. This finding suggests that the CS-LOX / GP group can effectively promote the secretion of VEGF by macrophages during wound healing in diabetic mice. Figure 3 VEGF and double F4 / 80 staining on days 7 and 14. Figure 4 The ratio of VEGF-positive macrophages to F4 / 80-positive macrophages was observed. Therefore, the above results validate that the CS-LOX / GP scaffold can significantly promote angiogenesis and functional vascular network construction in diabetic wounds. This effect is mainly attributed to the enhanced VEGF secretion induced by CS-LOX / GP scaffold-induced M2 macrophages.

[0066] The persistent chronic inflammation and excessive ROS production in diabetic wounds impair the activity of growth factors, inhibit angiogenesis, and significantly increase the risk of infection. This cascade of events ultimately leads to prolonged healing time for diabetic wounds. To address these challenges, a CS-LOX / GP scaffold with inflammation-modulating properties was developed by covalently coupling LOX to CS and then cross-linking the coupling with GP. It possesses hemostatic and antibacterial capabilities, sustains LOX release, and exhibits anti-inflammatory and antioxidant properties, collectively promoting the healing of diabetic wounds.

[0067] Chemical modification of CS primarily targets its -NH2 groups, as these groups mainly contribute to its crystallinity. Carboxymethylation is typically the most common method to improve the water solubility of CS. Furthermore, the CS-drug conjugate approach has gained interest in CS modification because it not only increases its water solubility but also introduces bioactive agents or reagents to enhance the biological properties of CS. Our results demonstrate that CS-LOX conjugates are a successful method for CS modification and further GP crosslinking of CS. FTIR spectroscopy confirmed the successful grafting of LOX in the CS-LOX conjugates, which disrupted the strong intermolecular and intramolecular hydrogen bonds in the CS chains. This alteration significantly reduced the crystallinity of CS. Meanwhile, CS-based scaffolds are renowned for their excellent antibacterial activity, primarily due to the interaction between the polycationic amino groups on CS and negatively charged macromolecular residues on the bacterial cell surface, altering cell membrane permeability, leading to bacterial metabolic disturbances, and ultimately bacterial death. However, our recent study showed that hydrogels prepared by consuming free amino groups in IBU-CS during MA modification resulted in a significant reduction in antibacterial activity. However, the antibacterial performance of the CS-LOX / GP scaffold obtained by lyophilizing GP crosslinked with CS-LOX can reach about 90%. Figure 2 The survival rates of E. coli and Staphylococcus aureus shown in the diagram may be due to the large pore size of the scaffold. Figure 1 As shown in the figure, this allows bacteria to exert their antibacterial function by contacting not only the scaffold surface but also the free amino groups within the scaffold. The successful synthesis and characterization of the CS-LOX / GP scaffold confirmed its structural stability, biocompatibility, and suitability for wound healing applications. Degradation characteristics demonstrate its ability to remain stable during wound healing. Figure 1 (In vitro degradation curves of CS / GP and CS-LOX / GP) and the controlled release of LOX within 28 days minimizes the need for frequent dressing changes. Figure 1 (In vitro drug release curves of CS-LOX / GP during 28 days). Optimal absorbency and pore size support a clean wound environment and promote cell migration, both of which are crucial for wound healing and tissue regeneration.

[0068] In diabetic patients, uncontrolled bleeding and infection can significantly delay wound healing and increase the risk of trauma-related death. High blood glucose levels in diabetic patients lead to excessively thick blood, metabolic disturbances, reduced clotting factors, and slowed blood flow, all of which impair coagulation function. Although the body initiates a coagulation cascade response after bleeding, severe or uncontrollable bleeding often requires external hemostatic materials. The CS-LOX / GP stent exhibits significant extracorporeal hemostatic properties, facilitating rapid hemostasis at diabetic wound sites. Figure 2 (Coagulation index and clotting time values). Positively charged CS molecular chains can attract negatively charged cell walls, promoting cell adhesion. The interaction between CS and red blood cells leads to cell aggregation and subsequent blood coagulation. In addition to the hemostatic function of the organic components, CS-LOX / GP scaffolds can provide a larger surface area for platelet adhesion and aggregation. Furthermore, the scaffolds' ability to absorb more water allows them to absorb blood like a sponge, forming a physical barrier that stops blood flow and promotes local hemostasis.

[0069] Prolonged and excessive inflammation is detrimental to successful wound healing in diabetic patients. Maintaining the balance between M1 and M2 macrophage populations is crucial for controlling inflammation and promoting tissue repair. However, this balance is disrupted in diabetic wounds, leading to a decrease in the immunomodulatory activity of macrophages. Previous studies have found that LOX can regulate the inflammatory response by inducing the transformation of M1 macrophages into M2 macrophages. Therefore, in this study, we found that under in vitro LPS stimulation, the CS-LOX / GP scaffold effectively induced macrophage polarization towards the M2 phenotype and inhibited ROS production by modulating the TNF, IL-17, and NF-κB signaling pathways. In vivo results showed that CS-LOX / GP scaffold treatment successfully activated macrophage polarization towards the M2 phenotype and partially inhibited M1 macrophage activation, reducing the inflammatory response and thus modulating immune dysregulation in wound repair.

[0070] In natural skin tissue, a complex capillary network is crucial for maintaining normal metabolism, facilitating the efficient exchange of nutrients, gases, and metabolic waste. Therefore, vascularization of regenerating skin tissue is a key component of the wound regeneration process after injury. Previous studies have shown that pro-regenerative macrophages can secrete pro-angiogenic and neurotrophic factors, thereby promoting new blood vessel formation after injury. However, diabetic wounds often exhibit impaired angiogenesis due to factors such as hydrolyzed growth factors, leading to delayed healing and increased risk of infection. Here, we investigated the effects of the CS-LOX / GP scaffold on angiogenesis. First, all scaffolds exhibited excellent biocompatibility when co-cultured with HUVECs. Furthermore, in an inflammatory microenvironment, the CS-LOX / GP scaffold induced the conversion of M1 macrophages to M2 macrophages, thereby significantly enhancing the angiogenic behavior of HUVECs through paracrine mechanisms, including migration, upregulation of angiogenesis-related factors, and scratch healing capacity. In vivo results support the role of M2 macrophages in enhancing angiogenesis. In vivo, CS-LOX / GP scaffold-induced M2 macrophages secrete abundant VEGF at the wound site, promoting angiogenesis and elongation from existing vessels into the wound. The increased number of α-SMA-positive vessels confirms this enhanced angiogenesis. Therefore, CS-LOX / GP-induced M2 polarization enhances the angiogenic capacity of HUVECs and further accelerates the healing process of diabetic wounds by promoting angiogenesis through VEGF secretion.

[0071] In summary, the CS-LOX / GP scaffold demonstrates significant potential for accelerating diabetic wound healing. By modulating the NF-κB signaling pathway, it effectively polarizes macrophages towards the M2 phenotype, reduces inflammation, and increases intralesional angiogenesis and collagen deposition, ultimately leading to satisfactory wound healing outcomes in diabetic patients. With sustained LOX release and the significant antibacterial effect of CS, this multifunctional scaffold achieves promising healing outcomes by modulating macrophages.

Claims

1. A dressing for promoting wound healing in diabetic patients, characterized in that: The dressing is prepared using the following steps: Step 1: Dissolve 1.61 g of chitosan in 100 mL of hydrochloric acid solution at room temperature by continuous stirring to prepare a chitosan solution; Step 2: Dissolve 0.246 g, 1 mM loxoprofen in 20 mL of ethanol, then add 0.96 g, 6.18 mmol of (1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and 0.28 g, 5.95 mmol of N-hydroxysuccinimide to obtain a loxoprofen solution with the carboxyl group activated. Add the loxoprofen solution dropwise to the chitosan solution in Step 1, and add 80 mL of ethanol while stirring at 800 rpm with a magnetic rod to ensure uniform dispersion and the formation of a clear solution. Step 3: In the dark, keep the transparent solution from Step 2 at 25 °C and stir at 200 rpm for 6 hours. The solution was then air-dried in a 37 °C oven until it became a solid film, and then thoroughly washed several times in ethanol to obtain a solid film chitosan-loxoprofen conjugate. Step 4: Add the chitosan-loxoprofen conjugate obtained in Step 3 to 80 mL of phosphate buffer. The amount of chitosan-loxoprofen added is 1.6 g. Stir magnetically until the chitosan-loxoprofen solution is dissolved at 2% w / v. Step 5: Dissolve 0.2 g of genipin in 40 mL of phosphate buffer to prepare a 0.5% w / v genipin solution; Step six: The chitosan-loxoprofen solution and genipin solution prepared in step four are mixed at a volume ratio of 4:1 by high-speed stirring, poured into a mold for cross-linking for 24 h, and then placed in a -80 ℃ freezer for freezing. Finally, the chitosan-loxoprofen / genipin sponge scaffold is prepared by freeze drying.

Images