Saccharomyces cerevisiae genetically engineered bacterium with ATF1 and BAT2 genes knocked out as well as construction method and application of saccharomyces cerevisiae genetically engineered bacterium

By knocking out the ATF1 and BAT2 genes in a brewing yeast strain using CRISPR/Cas9 technology, a genetically engineered brewing yeast strain BRY97-ΔATF1ΔBAT2 was constructed. This solved the problem of excessive ester and higher alcohol content in beer fermentation, and improved the taste and flavor of beer.

CN120988871APending Publication Date: 2025-11-21CHENGDU FENGLI BIOTECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202511511688.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2025-11-21

AI Technical Summary

Technical Problem

Excessive levels of esters and higher alcohols in current beer fermentation processes result in off-flavors and unpleasant tastes, while excessively low levels of higher alcohols negatively impact flavor.

Method used

By knocking out the ATF1 and BAT2 genes in a Saccharomyces cerevisiae strain using CRISPR/Cas9 technology, the production of esters and higher alcohols was regulated, and a genetically engineered Saccharomyces cerevisiae strain BRY97-ΔATF1ΔBAT2 was constructed.

Benefits of technology

It reduces the formation of esters and higher alcohols during fermentation, improves the taste and flavor of beer, and enhances palatability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120988871A_ABST
    Figure CN120988871A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of genetically engineered microorganisms, and particularly discloses a saccharomyces cerevisiae genetically engineered bacterium with ATF1 and BAT2 genes knocked out as well as a construction method and application of the saccharomyces cerevisiae genetically engineered bacterium. The preservation number of the saccharomyces cerevisiae genetically engineered bacterium is CGMCC (China General Microbiological Culture Collection Center) No.35994. The engineering bacteria are saccharomyces cerevisiae genetically engineered bacteria with the ATF1 and BAT2 genes knocked out, and compared with original saccharomyces cerevisiae, the saccharomyces cerevisiae genetically engineered bacteria with the ATF1 and BAT2 genes knocked out show low higher alcohol content and low acetate substance concentration in the beer fermentation process, and the taste of fermentation type beer fermented by the saccharomyces cerevisiae is greatly improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering and microbial technology, specifically involving a Saccharomyces cerevisiae genetically engineered strain with ATF1 and BAT2 genes knocked out using CRISPR / Cas9 technology, its construction method, and its application. Background Technology

[0002] The beer brewing process involves brewing yeast fermenting sugars such as maltose and glucose to produce ethanol. During fermentation, yeast produces various alcohols and esters through bypass metabolism, which together contribute to the rich flavor of beer. Esters are the main components of beer flavor compounds, primarily including acetates, lactates, and caproate esters, which impart fruity or floral aromas to the product. However, when the ester content is too high, the taste of the fermented product will change, resulting in off-flavors. For example, ethyl acetate levels exceeding a certain threshold can lead to a strong bitter taste in the beer.

[0003] Higher alcohols are a collective term for alcohols with two or more carbon atoms. They typically have a rich aroma and flavor and are directly related to the quality of beer. A suitable amount of higher alcohols can give beer a full-bodied, smooth, rich, and harmonious taste. However, when the content of higher alcohols exceeds a certain threshold, off-flavors will appear in the beer, and excessive higher alcohols can also cause symptoms of "headache" in the drinker. Conversely, too low a content of higher alcohols will result in a bland and thin beer.

[0004] Controlling the content of higher alcohols and their ratio with esters is a key factor in improving beer flavor.

[0005] The above is the inventor's analysis of the problems with the fermentation process technology and does not constitute a general understanding of the prior art. Summary of the Invention

[0006] The purpose of this invention is to overcome the problems in the prior art and address the shortcomings of existing fermentation strains and processes by providing a genetically engineered brewing yeast strain with the ATF1 and BAT2 genes knocked out using CRISPR / Cas9 technology. This reduces the excessive production of esters and alcohols during fermentation and improves the bitter taste of the wine.

[0007] Secondly, another technical problem that the present invention needs to solve is to provide a method for constructing the above-mentioned genetically engineered brewer's yeast.

[0008] Thirdly, the final technical problem to be solved by the present invention is to provide the application of the above-mentioned genetically engineered brewer's yeast.

[0009] Invention Concept: Ethanol acetyltransferase (ATF1) participates in the metabolic pathways of various esters. Regulating ATF1 synthesis is a key factor in altering the total ester synthesis during fermentation. Branched-chain amino acid transaminase (BAT2) catalyzes the conversion of amino acids such as valine and isoleucine into α-keto acids, which are further converted into higher alcohols such as isobutanol. Regulating BAT2 synthesis is one of the effective ways to reduce the total amount of higher alcohols.

[0010] To achieve the first objective mentioned above, the present invention provides the following technical solution: A genetically engineered strain of Saccharomyces cerevisiae, with accession number CGMCC No. 35994.

[0011] The engineered strain is *Saccharomyce cerevisiae*, a type of yeast. The storage conditions are as follows: Culture medium: yeast extract 10 g / L, peptone 20 g / L, glucose 20 g / L, agar powder 20 g / L; culture temperature 30°C; culture pH 6.0-6.5; culture time (days): 2-3. Long-term preservation method: ultra-low temperature freezing. This is a non-pathogenic strain, intended for fermentation applications.

[0012] Furthermore, a genetically engineered strain of *Saccharomyces cerevisiae* was obtained by modifying *Saccharomyces cerevisiae* after knocking out the ATF1 and BAT2 genes.

[0013] Furthermore, this strain was obtained by gene knockout modification of the original Saccharomyces cerevisiae.

[0014] Preferably, the original brewing yeast is American West Coast Ayers BRY-97.

[0015] Specifically, it was purchased from LALLEMAND, Austria, from the American West Coast, specifically from yeast strain BRY-97.

[0016] The nucleotide sequences of the ATF1 and BAT2 genes before inactivation are shown in SEQ ID NO.17 and SEQ ID NO.18.

[0017] The ATF1 and BAT2 genes were knocked out using CRISPR-Cas9 technology, and their inactivated nucleotide sequences are shown in SEQ ID NO.19 and SEQ ID NO.20.

[0018] To achieve the second objective mentioned above, the present invention provides the following technical solution: obtaining a corresponding gene-edited yeast strain through a genetic engineering construction method.

[0019] A method for constructing the above-mentioned genetically engineered Saccharomyces cerevisiae includes the following steps: Using the original BRY97 Saccharomyces cerevisiae, the Cas9-NAT plasmid was introduced to obtain a yeast strain containing Cas9; the gRNA fragment of the ATF1 gene was ligated into the pMEL13 backbone to construct the ATF1-gRNA plasmid; then, the ATF1-gRNA plasmid and the ATF1 repair fragment were co-transformed into the original BRY97 Saccharomyces cerevisiae containing the Cas plasmid to knock out the ATF1 gene and construct the BRY97-ΔATF1 recombinant strain. The Cas9-NAT plasmid was introduced into the BRY97-ΔATF1 recombinant strain, and the gRNA fragment of the BAT2 gene was ligated into the pMEL13 backbone to construct the BAT2-gRNA plasmid. Then, the BAT2-gRNA plasmid and the BAT2 repair fragment were co-transformed into the BRY97-ΔATF1 recombinant strain containing the Cas plasmid to knock out the BAT2 gene and construct the BRY97-ΔATF1ΔBAT2 recombinant strain.

[0020] A method for constructing the above-mentioned genetically engineered Saccharomyces cerevisiae includes the following steps: (1) Using BRY-97, the original brewing yeast, gRNA and repair fragments targeting the ATF1 gene were designed.

[0021] (2) Construction of gRNA plasmid of ATF1 gene: The gRNA fragment of ATF1 gene was connected to the pMEL13 backbone by assembly, transformed into E. coli DH5α and ATF1-gRNA plasmid was extracted.

[0022] (3) Transformation of Cas9 plasmid: The Cas9-NAT plasmid was introduced into yeast strain BRY97.

[0023] (4) Preparation of repair fragment: Synthesize a double-stranded DNA fragment containing the upstream and downstream homologous arms of the ATF1 gene.

[0024] (5) Co-transformation of the gRNA plasmid and repair fragment of the ATF1 gene: The gRNA plasmid obtained in step (2) and the repair fragment obtained in step (4) were co-transformed into yeast containing Cas9, and transformants were obtained by resistance screening.

[0025] (6) Verification of ATF1 gene knockout: The knockout of the ATF1 gene was verified by colony PCR and sequencing, and the BRY97-ΔATF1 recombinant strain was successfully constructed.

[0026] (7) Design gRNA and repair fragments targeting the BAT2 gene using the successfully constructed BRY97-ΔATF1 strain as the original Saccharomyces cerevisiae.

[0027] (8) Constructing the gRNA plasmid of the BAT2 gene: The gRNA fragment of the BAT2 gene was ligated into the pMEL13 backbone by Gibson assembly, transformed into E. coli DH5α and the BAT2-gRNA plasmid was extracted.

[0028] (9) Transformation of Cas9 plasmid: The Cas9-NAT plasmid was introduced into the BRY97-ΔATF1 recombinant strain successfully constructed in step (6).

[0029] (10) Preparation of repair fragment: Synthesize a double-stranded DNA fragment containing the upstream and downstream homologous arms of the BAT2 gene.

[0030] (11) Co-transformation of gRNA plasmid and repair fragment of BAT2 gene: The gRNA plasmid obtained in step (8) and the repair fragment obtained in step (10) were co-transformed into BRY97-ΔATF1 yeast containing Cas9, and transformants were obtained by resistance screening.

[0031] (12) Verification of BAT2 gene knockout: The knockout of BAT2 gene was verified by colony PCR and sequencing, and the BRY97-ΔATF1ΔBAT2 recombinant strain was successfully constructed.

[0032] Furthermore, in step (2), the nucleotide sequences of the primers for the ATF1 gene gRNA target site are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0033] Furthermore, in step (2), the nucleotide sequences of the pMEL13 backbone amplification primers are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0034] Furthermore, in step (2), the nucleotide sequences of the sequencing primers for constructing the gRNA plasmid of the ATF1 gene are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0035] Furthermore, in step (4), the nucleotide sequences of the primers for constructing the ATF1 gene repair fragment are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0036] Furthermore, in step (6), the nucleotide sequences of the colony PCR sequencing verification primers are shown in SEQ ID NO.9 and SEQ ID NO.10.

[0037] Furthermore, in step (8), the nucleotide sequences of the primers for the BAT2 gene gRNA target site are shown in SEQ ID NO.11 and SEQ ID NO.12.

[0038] Furthermore, in step (8), the nucleotide sequences of the pMEL13 backbone amplification primers are shown in SEQ ID NO.3 and SEQ ID NO.4.

[0039] Furthermore, in step (8), the nucleotide sequences of the sequencing primers for constructing the gRNA plasmid of the BAT2 gene are shown in SEQ ID NO.5 and SEQ ID NO.6.

[0040] Furthermore, in step (10), the nucleotide sequences of the primers for constructing the BAT2 gene repair fragment are shown in SEQ ID NO.13 and SEQ ID NO.14.

[0041] Furthermore, in step (12), the nucleotide sequences of the colony PCR sequencing verification primers are shown in SEQ ID NO.15 and SEQ ID NO.16.

[0042] To achieve the third objective mentioned above, the present invention provides the following technical solution.

[0043] The above-mentioned genetically engineered brewer's yeast is used, especially in the fermentation of ethanol-containing beverages.

[0044] The application of the aforementioned genetically engineered Saccharomyces cerevisiae in the fermentation and preparation of ethanol is also within the scope of protection of this invention.

[0045] The application involves beer production through liquid fermentation. The seed culture of the genetically engineered brewer's yeast is inoculated into the fermentation medium at a volume ratio of 10%. The inoculation ratio can fluctuate by ±5%, meaning it can be inoculated at a volume ratio of 5%-15%.

[0046] Furthermore, the fermentation temperature is 25-35℃. Preferably, it is 27-33℃, more preferably 28-32℃, and most preferably 29-31℃.

[0047] Furthermore, the fermentation temperature is 30°C.

[0048] Furthermore, the fermentation time is 20-30 hours.

[0049] Furthermore, in the fermentation production of beer, YPD medium is used for fermentation.

[0050] Preferably, the YPD culture medium is formulated as follows: 10-40 g / L glucose, 10-30 g / L peptone, 5-20 g / L yeast extract, with water as the solvent.

[0051] Preferably, the YPD culture medium is formulated as follows: 18-25 g / L glucose, 18-22 g / L peptone, 8-12 g / L yeast extract, with water as the solvent.

[0052] The optimal YPD fermentation medium formulation is as follows: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, with water as the solvent.

[0053] Compared with the prior art, the present invention has the following advantages: The strain of this invention is a genetically engineered Saccharomyces cerevisiae strain with the ATF1 and BAT2 genes knocked out. Because the original strain BRY97 produces more esters and alcohols during fermentation and has a low sugar alcohol conversion efficiency, the genetically engineered Saccharomyces cerevisiae strain with the ATF1 and BAT2 genes knocked out reduces the production of esters and alcohols during fermentation compared to the original strain, while also improving the taste of the wine and enhancing its palatability.

[0054] Preservation Instructions Strain name: Saccharomyces cerevisiae.

[0055] Latin name: Saccharomyces cerevisiae .

[0056] Preservation institution: China General Microbiological Culture Collection Center, China Microbial Culture Collection Committee.

[0057] The abbreviation for the depository is CGMCC.

[0058] Address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

[0059] Postal code: 100101.

[0060] Date of preservation: September 25, 2025.

[0061] Registered with the China National Collection Center (CGMCC) No. 35994. Attached Figure Description

[0062] Figure 1 The pMEL13 linear backbone obtained by gel extraction and PCR amplification in Example 1 is shown, where M: DNA molecular weight marker, and lanes 1-2 are the pMEL13 linear backbone (6106 bp).

[0063] Figure 2 The image shows the PCR identification electrophoresis diagram of the ATF1 gene deletion transformant in Example 1, where M: DNA molecular weight marker, and 1-3 are the ATF1 gene knockout fragments (675 bp).

[0064] Figure 3 The image shows the electrophoresis diagram of the PCR identification of the BAT2 gene deletion transformant in Example 2. In the image, M represents the DNA molecular weight marker, and lanes 4-6 represent the BAT2 gene knockout fragment (817 bp).

[0065] Figure 4 The data show the yield of higher alcohols produced by fermentation of the original strain BRY97(WT) and the BRY97-ΔATF1ΔBAT2 gene knockout strain obtained in Example 2.

[0066] Figure 5 The total ester content data are for the original strain BRY97(WT) and the BRY97-ΔATF1ΔBAT2 gene knockout strain obtained in Example 2. Detailed Implementation

[0067] The present invention will be further described in detail below with reference to experimental examples and specific embodiments. However, this should not be construed as limiting the scope of the above-mentioned subject matter of the present invention to the following embodiments; all technologies implemented based on the content of the present invention fall within the scope of the present invention.

[0068] The formulations of some of the reagents used in the following examples are as follows.

[0069] The YPD liquid culture medium formula is as follows: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, with water as the solvent.

[0070] The YPD solid culture medium formula is as follows: 20 g / L glucose, 20 g / L peptone, 10 g / L yeast extract, 20 g / L agar, and water as the solvent.

[0071] The LB+Kan liquid culture medium formula is as follows: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, 50 mg / L kanamycin, and water as the solvent.

[0072] Example 1 Construction of recombinant strain BRY97-ΔATF1 I. Construction of gRNA plasmids (1) Using the reference yeast BRY97, enter the target gene: ATF1 on the website http: / / yeastriction.tnw.tudelft.nl to obtain gRNA primers: ATF1 pMEL fw / rv (SEQ ID NO.1 and SEQ ID NO.2), ATF1_repair oligo fw / rv (SEQ ID NO.7 and SEQ ID NO.8), and ATF1_dg fw / rv (SEQ ID NO.9 and SEQ ID NO.10) for subsequent experiments.

[0073] (2) Construct gRNA plasmids, centrifuge ATF1 pMEL fw / rv primers at 13000 rpm for 1 min, dilute with sterile water to a concentration of 50 μM, mix primers at a volume ratio of 1:1, and incubate at 95℃ for 5 min in a PCR instrument; measure the concentration using Nanodrop.

[0074] (3) Using pMEL13 plasmid as a template, a linear backbone was obtained by amplification using pMEL13_F (SEQ ID NO.3) and pMEL13_R (SEQ ID NO.4) primers. The PCR reaction system is shown in Table 1 below. The PCR reaction conditions are as follows: 1) 95℃ pre-denaturation for 5 min; 2) 95℃ denaturation for 15 s, 56℃ annealing for 15 s, and 72℃ extension for 2 min, repeated 35 times (polymerase chain reaction, PCR), followed by a final extension at 72℃ for 5 min. The PCR products were confirmed by 1% agarose gel electrophoresis. Figure 1 The pMEL13 linear backbone was obtained by gel extraction, recovery, and purification.

[0075] Table 1 PCR reaction system

[0076] (4) The double-stranded ATF1 gRNA fragment and the pMEL13 linear backbone were ligated using the Hieff Clone Universal II One Step Cloning Kit. The gRNA fragment and the pMEL13 linear backbone were mixed at a molar ratio of 5:1 and added to the ligation system. The reaction system is shown in Table 2 below. The reaction system was placed at 50℃ for ligation for 30 min.

[0077] (5) All reaction solution was converted into Escherichia coli DH5α, and the bacterial culture was spread on LB+Kan antibiotic plates and cultured at 37°C for 16 h. Single clones of cells were picked and inoculated into test tubes containing 5 mL of LB+Kan liquid medium and cultured at 37°C and 160 rpm for 12-16 h. The bacterial cells were collected, and plasmids were extracted using a plasmid extraction kit and sequenced for confirmation. The sequencing primer sequences are shown in SEQ ID NO. 5 and SEQ ID NO. 6.

[0078] Table 2 Gibson linkage reaction system

[0079] II. Preparation of Repair Fragments (1) When knocking out a gene, the repair fragment is a 120 bp sequence, including 60 bp upstream and 60 bp downstream of the target gene coding sequence. The repair primer sequences for ATF1 are shown in SEQ ID NO.7 and SEQ ID NO.8. The single-stranded primers were diluted to 10 μM with sterile water, and the two complementary strands were mixed 1:1. The mixture was heated at 95℃ for 5 min, cooled to room temperature, and the double-stranded repair fragment was obtained. The concentration was measured using Nanodrop and stored at -20℃ for later use.

[0080] III. Preparation of competent cells from Saccharomyces cerevisiae strains (1) Select the Saccharomyces cerevisiae strain BRY97 and inoculate it into 5 mL of YPD liquid medium. Incubate overnight at 30℃ and 200 r / min to obtain activated seed liquid.

[0081] (2) At a volume ratio of 2%, the seed culture was transferred to 50 mL of fresh YPD liquid medium and cultured overnight at 30 °C and 200 r / min until the OD600 (Eppendorf BioPhotometer plus) was between 0.8 and 1.2.

[0082] (3) Centrifuge the bacterial solution obtained in step (2) at 4℃ and 4000r / min for 5min to collect the bacterial cells.

[0083] (4) Resuspend the bacterial cells in 25 mL of pre-cooled sterile water, centrifuge at 4000 r / min for 5 min at low temperature and high speed to collect the bacterial cells, and repeat twice; resuspend the bacterial cells in 10 mL of pre-cooled 1M sorbitol aqueous solution, centrifuge at 4000 r / min for 5 min at low temperature and high speed to collect the bacterial cells, and repeat twice.

[0084] (5) Resuspend the bacterial cells in 1 mL of 1 M sorbitol aqueous solution and dispense 100 μL into each tube.

[0085] IV. Cas9 plasmid introduction (1) Take one tube of competent cells of the Saccharomyces cerevisiae strain prepared in step three, add 1 μg of Cas9 plasmid, mix and transfer all of them to an ice-pre-cooled electric transfer cup.

[0086] (2) Place on ice for 5 minutes, wipe the electro-rotator cup dry, and set the electro-rotator parameters to 1.5 kV, 25 μF, 200Ω for 5.0 ms.

[0087] (3) Add 1 mL of YPD medium to the electroporation cup after electroporation, and transfer the liquid into a 1.5 mL EP tube by pipetting. Incubate in a shaker at 30 °C and 200 r / min for 1 h.

[0088] (4) Spread 100 μL of bacterial solution onto YPD medium plates containing NAT resistance and incubate at 30°C until colonies appear.

[0089] V. Transformation of gRNA plasmids and repair fragments (1) Prepare competent cells from the yeast strain containing the Cas9-NAT plasmid that was successfully transformed in step four according to the method in step three.

[0090] (2) Take the competent cells of the prepared Saccharomyces cerevisiae strain, and co-transform the gRNA plasmid of the ATF1 gene constructed in step one and the repair fragment of the ATF1 gene constructed in step two into the competent cells.

[0091] (3) Add 1 mL of YPD medium to the electroporation cup after electroporation, and transfer the liquid into a 1.5 mL EP tube by pipetting. Incubate in a shaker at 30 °C and 200 r / min for 1 h.

[0092] (4) Take 100 μL of bacterial culture and spread it on a YPD medium plate containing NAT resistance and G418 resistance for double screening. Incubate at 30°C until colonies appear.

[0093] VI. Colony PCR Verification (1) Take a 1.5 mL centrifuge tube, add 95 μL of 1% sterile SDS and 5 μL of 4 M lithium acetate, and then randomly pick a few single colonies of transformants from the YPD+NAT+G418 plate into the solution and vortex to mix.

[0094] (2) After heating at 75℃ for 10 min, add 300 μL of anhydrous ethanol and vortex. Centrifuge at 13,000 rpm for 3 min.

[0095] (3) After carefully aspirating the supernatant, open the lid and place it in a 37°C incubator to dry.

[0096] (4) Add 50 μL of sterile water to the centrifuge tube, shake to mix, and centrifuge at 13,000 rpm for 1 min.

[0097] (5) The concentration of the supernatant was determined using a Nano Drop 2000 spectrophotometer, and the concentration was adjusted to 20 ng / μL with sterile water. This was used as a template for PCR amplification. The PCR verification primers are shown in SEQ ID NO.9 and SEQ ID NO.10. The colony PCR system is shown in Table 3 below. The PCR reaction conditions are as follows: 1) 95℃ pre-denaturation for 5 min; 2) 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 2 min, and the three steps were repeated 30 times (polymerase chain reaction, PCR), followed by a final extension at 72℃ for 5 min.

[0098] (6) The amplified band length of the ATF1 gene successfully knocked out was 675 bp, and the control band length of the ATF1 gene not knocked out was 2253 bp. After confirmation by 1% agarose gel electrophoresis, the electrophoresis results are as follows: Figure 2 As shown.

[0099] Table 3 Colony PCR Reaction System

[0100] VII. Plasmid Removal (1) Streaking the single colony transformant picked in step six onto YPD solid medium and activating it at 30°C for 24 h.

[0101] (2) Inoculate the bacterial culture into 5 mL of YPD liquid medium and culture at 30°C with shaking for 16 h; use sterile water to serially dilute the bacterial culture to the power of 10 to the power of 5, take 100 μL of the diluted solution and spread it on YPD solid medium, and culture at 30°C for 24 h.

[0102] (3) Pick a single colony, break it up with 1 mL of sterile water, and spot it onto YPD, YPD+NAT, and YPD+G418 solid culture medium respectively, and incubate at 30℃ for 1-2 days.

[0103] (4) Select colonies that grow only on YPD plates and repeat step (3).

[0104] (5) The transformants that grow only on YPD plates after two spottings are the target strain BRY97-ΔATF1 after plasmid removal. Select single colonies and culture them overnight in YPD liquid medium. Mix with sterile 50% glycerol at a 1:1 ratio and store at -80℃.

[0105] Example 2 Construction of recombinant strain BRY97-ΔATF1ΔBAT2 I. Construction of gRNA plasmids Referring to step one of Example 1, using the BAT2 gene as the target gene, BAT2 gene-specific gRNA primers were designed and synthesized using the website http: / / yeastriction.tnw.tudelft.nl: BAT2 pMEL fw / rv (SEQ ID NO.11 and SEQ ID NO.12), BAT2_repair oligo fw / rv (SEQ ID NO.13 and SEQ ID NO.14), and BAT2_dg fw / rv (SEQ ID NO.15 and SEQ ID NO.16). Using pMEL13 plasmid as a template, a linear backbone was amplified by PCR, and the BAT2 gene gRNA plasmid was constructed by assembly, which was verified to be correct by sequencing.

[0106] II. Preparation of Repair Fragments Following the method described in step two of Example 1, the BAT2 gene repair primers BAT2_repair oligo fw and BAT2_repair oligo rv were synthesized, and after annealing to form a double-stranded repair fragment, they were ready for use.

[0107] III. Preparation of competent cells from Saccharomyces cerevisiae strains Competent cells were prepared using BRY97-ΔATF1 as the starting strain, following the method in step three of Example 1.

[0108] IV. Cas9 plasmid introduction The Cas9 plasmid was introduced into competent cells according to step four of Example 1.

[0109] V. Transformation of gRNA plasmids and repair fragments Following the method in step five of Example 1, the gRNA plasmid of the BAT2 gene and the repair fragment were co-transformed into BRY97-ΔATF1 competent cells containing the Cas9 plasmid, and transformants were obtained by screening with dual resistance plates (YPD+NAT+G418).

[0110] VI. Colony PCR Verification Following the method in step six of Example 1, the transformants were verified by PCR using BAT2_dg fw / rv primers, as follows: Figure 3 As shown, the amplified band size of the strain that successfully knocked out the BAT2 gene was 817 bp, while the band size of the control strain that did not knock out the gene was 1948 bp.

[0111] VII. Plasmid Removal Following the method in step seven of Example 1, a recombinant strain BRY97-ΔATF1-ΔBAT2 without any exogenous plasmids was obtained through continuous subculturing and plate screening.

[0112] Example 3 Validation of the suitability of screening markers in industrial brewing yeast BRY-97 I. Preparation of competent cells of Saccharomyces cerevisiae strains Yeast competent cells were prepared from the experimental group strain BRY97 and the control group strain S288c, respectively, following the method in step three of Example 1.

[0113] II. Cas9 plasmid introduction (1) Divide each strain into two groups and transform them into pCAS-NAT or pCAS-Zeo plasmids respectively: Industrial strain groups: BRY97 + pCAS-NAT; BRY97 + pCAS-Zeo Laboratory strain groups: S288c + pCAS-NAT; S288c + pCAS-Zeo (2) pCAS-NAT or pCAS-Zeo plasmids were introduced into competent cells according to step four of Example 1.

[0114] (3) After electroporation and recovery for 1 h, take 50 μL of bacterial culture and spread it on YPD plates containing the corresponding antibiotics. Incubate at 30°C until colonies appear.

[0115] (4) Count the single colonies that grow and take pictures to record the results, as shown in Table 4.

[0116] Table 4: Conversion efficiency of Saccharomyces cerevisiae strains under different resistance conditions

[0117] (5) The results showed that NAT resistance performed well in both industrial and laboratory strains, with high transformation efficiency; the Zeocin resistance system was almost ineffective in the industrial strain BRY97; S288c was adapted to both resistances, indicating that the problem with Zeocin was not universal but rather a problem specific to industrial strains. Not all gene editing methods can achieve ideal results; appropriate process methods are required to achieve the desired goal of knocking out specific genes.

[0118] Test Example 1 Comparison of fermentation between original strains and genetically modified strains (1) Take 2 mL of the original bacteria BRY97 (WT) and the double gene knockout bacteria (ΔATF1ΔBAT2) constructed in Example 2 and add them to 100 mL of sterilized YPD liquid medium and culture overnight for activation.

[0119] (2) According to the inoculation ratio of 10% by volume, the bacterial culture obtained in step (1) is transferred to 5 L of YPD medium and fermented at 30℃ and 200r / min until the end. The fermentation medium formula is as follows: 20g / L glucose, 20g / L peptone, 10g / L yeast extract, and water as the solvent.

[0120] (3) Fermentation results are shown in Figure 4 and Figure 5 . Figure 4 The data show the yield of higher alcohols produced by fermentation of the original strain BRY97(WT) and the BRY97-ΔATF1ΔBAT2 gene knockout strain obtained in Example 2. Figure 5 The total ester content data are for the original strain BRY97(WT) and the BRY97-ΔATF1ΔBAT2 gene knockout strain obtained in Example 2.

[0121] Fermentation data show that, under the same fermentation temperature and time period for the original strain BRY97 and the knockout strains ΔATF1ΔBAT2, after 30 hours of fermentation, the yields of higher alcohols for the original strain BRY97 and the knockout strains ΔATF1ΔBAT2 were 104.40 mg / L and 80.72 mg / L, respectively. Figure 4 As shown; the total ester content was 79.65 mg / L and 60.72 mg / L, respectively. Figure 5 As shown.

[0122] This invention provides a genetically engineered Saccharomyces cerevisiae strain with the ΔATF1 and ΔBAT2 genes knocked out, along with its construction method and applications. Many methods and approaches exist for implementing this technical solution; the above description is merely a preferred embodiment of the invention. It should be noted that those skilled in the art can make various improvements and modifications without departing from the principles of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention. All components not explicitly stated in this embodiment can be implemented using existing technologies.

[0123] The primers used in the above process are as follows: Table 5: Primer sequences used in the examples

[0124] The nucleotide sequence of the ATF1 gene before inactivation is shown in SEQ ID NO.17, as follows: The nucleotide sequence of the BAT2 gene before inactivation is shown in SEQ ID NO.18, as follows: The nucleotide sequence of the inactivated ATF1 gene is shown in SEQ ID NO.19, as follows: tgacacccggataattaagaagtggtaagcttatgttagagtacttgtacttgacaagtaaaatcagaattgggaattatcaattgagatcacgtgcaaaccgaagaaatgcaaagaagtaaggttagggtttatggacccaggcagcagaaaattgtagcttcatttgttggcacaggactattccacccttagaattgactttttggacattgagctaaggttcaatgcactcgatggtcttctcacttccgaatatatagatctagcgtgtgaggactactcattggcttgcgatttacggtttttatattttttgccgcacatcattttttggcctggtattgtcatcgcgttgagcggactctgaatataatcctattgttttttatggatctctggaagcgtctttttgaagccaacccaacaaaaattcgagacaagaaaataaaaaacggcacttcatcagtatcacaaataccatcaatttatcagctctcatctcacatgatgcttgactgatattattcgacaatatgattatgtcgtgtaaataacccactttcatgttgtcactccctcggctttggttggttaaagggacttatcggtttctttttttagagttgatttaagatcagatcgaagtaaataacgtgcagaacattgcatatgatagataacaacctatagtatatatttcaaaatcgcgacaaatctgaaatattaattgatttgattagctgcagagatcttctcgatgtaaggagctatttaaatagaaagggtcagaatcgtcgtcctgtgggagctggtatatactaaattgatgaacaactaaaatagcactctcattgtcattttgggtgtgagaccttaagcaaggagagatatttttaatggatgtattagcgcagccgttgcttacggtattccttggcatattgtccctgaaaaaaaaccgttgtacactcggatacgcatttttcggacttctccc。 The nucleotide sequence of the inactivated BAT2 gene is shown in SEQ ID NO.20, as follows: 。 Unless otherwise specified, percentage examples in this invention, if involving solid raw materials, should be understood as mass percentages, and if involving two liquids, should be understood as volume percentages.

[0125] In the above embodiments, M represents molar concentration, which refers to the amount of solute contained in a unit volume of solution, and the commonly used unit is mol / L. For example, 1M represents a concentration of 1 mol / L; 2M represents a concentration of 2 mol / L.

[0126] EP tubes, or Eppendorf tubes, are the most commonly used miniature centrifuge tubes in molecular biology, biochemistry, and clinical laboratories. Different brands of EP tubes of the same specifications can be used without affecting the implementation of this invention.

[0127] NAT, or nourseothricin, is used to construct selective YPD media. For example, a dual-selection YPD medium containing both NAT resistance and G418 resistance.

[0128] Zeo, or bleomycin, is used to construct selective YPD media. For example, YPD media containing Zeo resistance.

[0129] SDS, sodium dodecyl sulfate, surfactant.

[0130] “Δ” marks the missing gene in the strain, for example, “ΔATF1” means the ATF1 gene is knocked out.

[0131] Furthermore, the use of terms such as "first," "second," and "third" in terminology is merely for distinguishing descriptions of identical or similar components and should not be interpreted as emphasizing or implying the relative importance of a particular component.

[0132] Furthermore, in the description of the embodiments of the present invention, "several", "more than", and "a number of" represent at least two. The number can be any number, such as 2, 3, 4, 5, 6, 7, 8, or 9, and can even exceed nine.

Claims

1. A genetically engineered brewer's yeast, characterized in that, Its accession number is: CGMCC No.35994.

2. The Saccharomyces cerevisiae genetically engineered strain according to claim 1, characterized in that, The engineered strain was obtained by knocking out the ATF1 and BAT2 genes from Saccharomyces cerevisiae BRY97.

3. The method for constructing a genetically engineered Saccharomyces cerevisiae according to claim 1 or 2, characterized in that, Includes the following steps: Using the original BRY97 Saccharomyces cerevisiae, the Cas9-NAT plasmid was introduced to obtain a yeast strain containing Cas9; the gRNA fragment of the ATF1 gene was ligated into the pMEL13 backbone to construct the ATF1-gRNA plasmid; then, the ATF1-gRNA plasmid and the ATF1 repair fragment were co-transformed into the original BRY97 Saccharomyces cerevisiae containing the Cas plasmid to knock out the ATF1 gene and construct the BRY97-ΔATF1 recombinant strain. The Cas9-NAT plasmid was introduced into the BRY97-ΔATF1 recombinant strain, and the gRNA fragment of the BAT2 gene was ligated into the pMEL13 backbone to construct the BAT2-gRNA plasmid. Then, the BAT2-gRNA plasmid and the BAT2 repair fragment were co-transformed into the BRY97-ΔATF1 recombinant strain containing the Cas plasmid to knock out the BAT2 gene and construct the BRY97-ΔATF1ΔBAT2 recombinant strain.

4. The method for constructing a genetically engineered Saccharomyces cerevisiae according to claim 3, characterized in that, Includes the following steps: (1) Using Saccharomyces cerevisiae BRY97 as the original brewing yeast, gRNA and repair fragments targeting the ATF1 gene were designed; (2) Constructing the gRNA plasmid of the ATF1 gene: The gRNA fragment of the ATF1 gene was linked to the pMEL13 backbone by Gibson assembly, transformed into E. coli DH5α and the ATF1-gRNA plasmid was extracted. (3) Transformation of Cas9 plasmid: The Cas9-NAT plasmid was introduced into yeast strain Saccharomyces cerevisiae BRY97; (4) Preparation of repair fragment: Synthesize a double-stranded DNA fragment containing the upstream and downstream homologous arms of the ATF1 gene; (5) Co-transformation of ATF1 gene gRNA plasmid and repair fragment: The gRNA plasmid obtained in step (2) and the repair fragment obtained in step (4) were co-transformed into yeast containing Cas9, and transformants were obtained by resistance selection; (6) Verification of ATF1 gene knockout: The knockout of the ATF1 gene was verified by colony PCR and sequencing, and the BRY97-ΔATF1 recombinant strain was successfully constructed. (7) Design gRNA and repair fragments targeting the BAT2 gene using the successfully constructed BRY97-ΔATF1 strain as the original Saccharomyces cerevisiae. (8) Constructing the gRNA plasmid of the BAT2 gene: The gRNA fragment of the BAT2 gene was linked to the pMEL13 backbone by Gibson assembly, transformed into E. coli DH5α and the BAT2-gRNA plasmid was extracted. (9) Transformation of Cas9 plasmid: The Cas9-NAT plasmid was introduced into the BRY97-ΔATF1 recombinant strain successfully constructed in step (6); (10) Preparation of repair fragment: Synthesize a double-stranded DNA fragment containing the upstream and downstream homologous arms of the BAT2 gene; (11) Co-transformation of gRNA plasmid and repair fragment of BAT2 gene: The gRNA plasmid obtained in step (8) and the repair fragment obtained in step (10) were co-transformed into BRY97-ΔATF1 yeast containing Cas9, and transformants were obtained by resistance selection; (12) Verification of BAT2 gene knockout: The knockout of BAT2 gene was verified by colony PCR and sequencing, and the BRY97-ΔATF1ΔBAT2 recombinant strain was successfully constructed.

5. The method for constructing a genetically engineered Saccharomyces cerevisiae according to claim 4, characterized in that, In step (2), the nucleotide sequences of the primers for the ATF1 gene gRNA target site are shown in SEQ ID NO.1 and SEQ ID NO.2; the nucleotide sequences of the primers for the pMEL13 backbone amplification are shown in SEQ ID NO.3 and SEQ ID NO.4; and the nucleotide sequences of the sequencing primers for constructing the ATF1 gene gRNA plasmid are shown in SEQ ID NO.5 and SEQ ID NO.

6.

6. The method for constructing a genetically engineered Saccharomyces cerevisiae according to claim 4, characterized in that, In step (4), the nucleotide sequences of the primers for constructing the ATF1 gene repair fragment are shown in SEQ ID NO.7 and SEQ ID NO.

8.

7. The method for constructing a genetically engineered Saccharomyces cerevisiae according to claim 4, characterized in that, In step (8), the nucleotide sequences of the primers for the BAT2 gene gRNA target site are shown in SEQ ID NO.11 and SEQ ID NO.

12.

8. The application of a genetically engineered Saccharomyces cerevisiae according to claim 1 or 2, characterized in that, Application in fermented ethanol beverages.

9. The application of the genetically engineered Saccharomyces cerevisiae according to claim 8, characterized in that, The fermentation temperature is 25-35℃.

10. The application of the genetically engineered Saccharomyces cerevisiae according to claim 8, characterized in that, In beer fermentation, YPD medium is used for fermentation.

Citation Information

Patent Citations

  • Low-yield higher-alcohol saccharomyces cerevisiae engineering bacterium and construction method thereof

    CN101914461A

  • Genetic engineering strain enriched with heavy cadmium, as well as construction and application thereof

    CN102925404A

  • Efficient traceless gene knockout method for saccharomyces cerevisiae and application thereof

    CN109136254A

  • Oak-aged imperial stout preparation method

    CN109401871A

  • Method for increasing yield of saccharomyces cerevisiae 2-phenylethanol

    CN112980868A