Molecular marker for identifying leaf variants of paphiopedilin and application of molecular marker
By comparing second-generation sequencing and high-throughput sequencing, specific molecular markers were designed to solve the problem of identifying leaf variants of Paphiopedilum giganteum, enabling highly sensitive identification and the improvement and breeding application of germplasm resources.
Patent Information
- Application Number
- CN202511166485.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2025-05-06
- Filing Date
- 2025-08-20
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2045-08-20
AI Technical Summary
Existing technologies have failed to provide accurate molecular markers for identifying leaf variants of Paphiopedilum giganteum, making it difficult to distinguish them from the original Paphiopedilum giganteum leaves, which affects the identification and breeding utilization of germplasm resources.
The AT-enriched fragment of the giant slipper orchid leaf variant was obtained using next-generation sequencing. Specific molecular markers were designed and identified by high-throughput sequencing alignment. Geneious software was used for sequence alignment, providing four specific markers that can be used alone or in combination.
It enables accurate identification of leaf variants of Paphiopedilum giganteum, is simple to operate, highly sensitive, requires no primer design, and is suitable for identification of mixed samples and improvement and breeding of germplasm resources.
Smart Images

Figure CN120989280A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present case claims priority to the invention patent with the application date of May 6, 2025, the application number of 2025105744336, and the invention name of "Molecular marker for identifying Paphiopedilum bellatulum f. viridis and application thereof", and the full text thereof is incorporated herein by reference.
[0002] The present application belongs to the field of biotechnology, and specifically relates to a molecular marker for identifying Paphiopedilum bellatulum f. viridis and application thereof. BACKGROUND
[0003] Paphiopedilum bellatulum (Rchb. f) Stein belongs to the Paphiopedilum genus, the Paphiopedilum subgenus, and the Homalopetalum group, and its petals are broad-elliptical, the whole flower is white and densely covered with purple-brown spots. It is an Appendix I species of the Convention on International Trade in Endangered Species of Wild Fauna and Flora, is strictly protected by the international community, is one of the orchid breeding parent materials with high ornamental value in the Paphiopedilum genus, and has high conservation value and ornamental value. The leaf of P. bellatulum is dark green, and the ventral surface has interlaced grid spots of dark and light green colors, and the dorsal surface is densely covered with dark purple coarse spots.
[0004] In the long-term investigation of wild Paphiopedilum germplasm resources and ex-situ conservation, researchers found a variant of P. bellatulum with light green color on the dorsal surface of the leaf, i.e. P. bellatulum f. viridis. The difference between the variant and the original species of P. bellatulum mainly lies in the color of the dorsal surface of the leaf, i.e. the dorsal surface of the leaf of P. bellatulum f. viridis is light green, while the dorsal surface of the leaf of the original species of P. bellatulum is purple red. P. bellatulum f. viridis has great scientific value in the system evolution and leaf color development of the Paphiopedilum genus, and the color performance of the variant is relatively refreshing, which is deeply loved by consumers.
[0005] However, the dorsal surface of the leaf of P. bellatulum f. viridis in the seedling stage is green, which is similar to that of the original species of P. bellatulum, and the two are easily confused, which brings great difficulty to the effective development and utilization of P. bellatulum f. viridis. At present, the protection and utilization research of the Paphiopedilum genus has attracted widespread attention, but species identification is the basis of protection and utilization research, and there is no molecular marker for accurately identifying P. bellatulum f. viridis at present. Therefore, it is of great significance to develop a molecular marker for accurately identifying P. bellatulum f. viridis and the original species of P. bellatulum for the identification and hybridization breeding of Paphiopedilum germplasm resources. SUMMARY
[0006] In order to overcome the above difficulties, we used a second-generation sequencing method to obtain two AT-rich fragments of Paphiopedilum micranthum var. susuwatuense. Analysis of the fragments showed that they were not highly homologous to any existing Paphiopedilum genome, making them suitable as reference sequences for identifying Paphiopedilum micranthum var. susuwatuense. Further, a reliable method for identifying Paphiopedilum micranthum var. susuwatuense was designed using sequencing data. The technical scheme adopted by the present application is: On the one hand, the present application provides a molecular marker for identifying or assisting in identifying Paphiopedilum micranthum var. susuwatuense, the nucleic acid sequence of which is shown in any one of SEQ ID NO. 1 to SEQ ID NO. 4.
[0007] On the other hand, another object of the present application is to provide the use of the above-mentioned molecular marker in the identification or assisted identification of Paphiopedilum micranthum var. susuwatuense.
[0008] On the other hand, the present application provides a method for identifying or assisting in identifying Paphiopedilum micranthum var. susuwatuense, characterized by comprising the following steps: 1) Collecting Paphiopedilum green tissue to be detected as a sample to be detected; 2) Extracting total DNA from the sample to be detected; 3) Performing second-generation high-throughput sequencing on the total DNA of the sample, respectively, to obtain sequencing reads; 4) Assembling the sequencing data and aligning the assembled contigs with the aforementioned molecular marker; 5) Aligning the contigs with the highest consistency that can completely cover the molecular marker with the molecular marker, and judging whether the sample is Paphiopedilum micranthum var. susuwatuense according to the alignment result; if the sequence is consistent with the molecular marker, it is determined that the species of the sample to be detected is Paphiopedilum micranthum var. susuwatuense.
[0009] On the other hand, the present application provides a method for identifying or assisting in identifying Paphiopedilum micranthum var. susuwatuense, characterized by comprising the following steps: 1) Collecting Paphiopedilum green tissue to be detected as a sample to be detected; 2) Extracting total DNA from the sample to be detected; 3) Performing second-generation high-throughput sequencing on the total DNA of the sample, respectively, to obtain sequencing reads; 4) Aligning the above sequencing reads to the DNA molecular marker described in the present application using the default parameters of Geneious software; 5) Judging whether the sample contains Paphiopedilum micranthum var. susuwatuense according to the coverage of the sequencing reads on the DNA molecular marker; if the sequencing reads can completely cover the DNA molecular marker and generate a consistent sequence identical to the DNA molecular marker, it is determined that the species of the sample to be detected contains Paphiopedilum micranthum var. susuwatuense; In one embodiment, the plurality of sample sequencing reads are mixedly grouped in step 3).
[0010] In one embodiment, if the plurality of sample sequencing reads are mixedly grouped in step 3), step 6) is further included, i.e., the sample containing the Paphiopedilum gigantifolium leaf variant is further divided into two groups, and the sequencing reads are mixedly repeated in the above-mentioned step 5) until the Paphiopedilum gigantifolium leaf variant of the individual sample is identified.
[0011] In one embodiment, the high-throughput sequencing in step 3) is second-generation sequencing or third-generation sequencing.
[0012] In one embodiment, the reads alignment in step 4) is performed using any one of Geneious, Bowtie, Tophat or HISAT.
[0013] In one embodiment, any one of SEQ ID NO. 1-SEQ ID NO. 4 is used alone.
[0014] In one embodiment, SEQ ID NO. 1-SEQ ID NO. 4 are used in combination.
[0015] In another aspect, the present application provides any one of the following applications of the above-mentioned molecular marker: (1) Application in identification of Paphiopedilum gigantifolium leaf variants; (2) Application in identification, improvement or molecular marker assisted breeding of Paphiopedilum gigantifolium germplasm resources; (3) Application in screening or creating different Paphiopedilum gigantifolium varieties; (4) Application in DNA fingerprint database of Paphiopedilum gigantifolium leaf variants; (5) Application in quality detection of Paphiopedilum gigantifolium seedlings.
[0016] The present application has the following beneficial effects: Firstly, the present application provides four Paphiopedilum gigantifolium leaf variant genomic AT-enriched fragments for the first time. It is analyzed that the fragments do not have high homology with any other existing Paphiopedilum genome, and are suitable for use as reference sequences for identification of Paphiopedilum gigantifolium leaf variants.
[0017] Secondly, the present application can extract total DNA from mixed samples, such as directly collected green tissues, obtain DNA information of the samples through high-throughput sequencing, and identify whether the samples contain Paphiopedilum gigantifolium leaf variants by comparison with reference sequences.
[0018] Thirdly, the present application directly uses high-throughput sequencing to identify or assist in identifying Paphiopedilum gigantifolium leaf variants, without the need for primer design, avoiding the difficulty of primer design, and being convenient to operate and high in sensitivity.
[0019] Fourthly, the present application simultaneously provides four specific markers which can be used alone or in combination, and the combination is more accurate. BRIEF DESCRIPTION OF DRAWINGS
[0020] The beneficial effects of the present application will be described in detail below in combination with the drawings and specific embodiments.
[0021] Figure 1 is the alignment result of the molecular marker SEQ ID NO. 1 of Paphiopedilum giganteum var. folium in the nr / nt library of NCBI.
[0022] Figure 2 is the alignment result of the molecular marker SEQ ID NO. 2 of Paphiopedilum giganteum var. folium in the nr / nt library of NCBI.
[0023] Figure 3 is the alignment result of the molecular marker SEQ ID NO. 3 of Paphiopedilum giganteum var. folium in the nr / nt library of NCBI.
[0024] Figure 4 is the alignment result of different Paphiopedilum sequencing assembly sequences and the molecular marker SEQ ID NO. 1, wherein 1 is the reference sequence, 2-3 are Paphiopedilum giganteum var. folium, 4, 5, 8 are Paphiopedilum giganteum, 6-7 are Paphiopedilum wilhelminae, 9 is Paphiopedilum niveum, and 10-11 are Paphiopedilum primulifolium.
[0025] Figure 5 is the alignment result of different Paphiopedilum sequencing assembly sequences and the molecular marker SEQ ID NO. 2, wherein 1 is the reference sequence, 2-3 are Paphiopedilum giganteum var. folium, 4-6 are Paphiopedilum giganteum, 7-8 are Paphiopedilum primulifolium, 9-10 are Paphiopedilum wilhelminae, and 11 is Paphiopedilum niveum.
[0026] Figure 6 is the alignment result of different Paphiopedilum sequencing assembly sequences and the molecular marker SEQ ID NO. 3, wherein 1 is the reference sequence, 2-3 are Paphiopedilum giganteum var. folium, 4, 5, 11 are Paphiopedilum giganteum, 6-7 are Paphiopedilum wilhelminae, 9 is Paphiopedilum niveum, and 8, 10 are Paphiopedilum primulifolium.
[0027] Figure 7 is the alignment result of different Paphiopedilum sequencing assembly sequences and the molecular marker SEQ ID NO. 4, wherein 1 is the reference sequence, 2-3 are Paphiopedilum giganteum var. folium, 4, 6, 11 are Paphiopedilum giganteum, 7-8 are Paphiopedilum primulifolium, 9-10 are Paphiopedilum wilhelminae, and 5 is Paphiopedilum niveum.
[0028] Figure 8 is the result of aligning the high-throughput sequencing reads of the sample containing Paphiopedilum giganteum var. folium to the molecular marker SEQ ID NO. 1 of Paphiopedilum giganteum var. folium.
[0029] Figure 9 Results of high-throughput sequencing reads of samples containing Pogostemon cablin var. mosoense against the molecular marker SEQ ID NO. 2 of Pogostemon cablin var. mosoense.
[0030] Figure 10 Results of high-throughput sequencing reads of samples containing Pogostemon cablin var. mosoense against the molecular marker SEQ ID NO. 3 of Pogostemon cablin var. mosoense, Figure 10 A is a 5' end screenshot after reads alignment, Figure 10 B is a 3' end screenshot after reads alignment.
[0031] Figure 11 Results of high-throughput sequencing reads of samples containing Pogostemon cablin var. mosoense against the molecular marker SEQ ID NO. 4 of Pogostemon cablin var. mosoense.
[0032] Figure 12 Results of high-throughput sequencing reads of samples not containing Pogostemon cablin var. mosoense against the molecular marker SEQ ID NO. 1 of Pogostemon cablin var. mosoense.
[0033] Figure 13 Results of high-throughput sequencing reads of samples not containing Pogostemon cablin var. mosoense against the molecular marker SEQ ID NO. 2 of Pogostemon cablin var. mosoense.
[0034] Figure 14 Results of high-throughput sequencing reads of samples not containing Pogostemon cablin var. mosoense against the molecular marker SEQ ID NO. 3 of Pogostemon cablin var. mosoense.
[0035] Figure 15 Results of high-throughput sequencing reads of samples not containing Pogostemon cablin var. mosoense against the molecular marker SEQ ID NO. 4 of Pogostemon cablin var. mosoense. DETAILED DESCRIPTION
[0036] The technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.
[0037] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The experimental methods in the following examples are routine methods unless otherwise specified. The experimental materials used in the following examples are commercially available from routine biochemical reagent stores unless otherwise specified.
[0038] Example 1 Molecular marker of Paphiopedilum spicerianum leaf variant The present application determines the molecular marker standard detection sequence of Paphiopedilum spicerianum leaf variant by sequencing assembly and comparative analysis, and the specific sequence is: 5'-CAACATAGGTCAAGTCGCACTCGATCAAAAATCATAATCATAATGTCTATTTTCTATTCATTCGGTATCCACGTATAAAAATTCCAGCTCTGTAGTTTACACTGTTCTGGGGTTTACATATACACATATAATATTATAATTAATATTAATATTTATATAATTAATATTAATATTTAGAATATAATATTAGAATATATTTAGAATAT-3'(SEQ ID NO. 1); 5'-TATCCATCTTATATATCTTATATATATAATATAAATAATATAAATATAATAATAATATATAATATATAATATATAATAATAATATATATTTAATATTTAATTTTATATTTTTTTTATTATTTTTATTATTTCCAATTTTCCAATTCTTTAAATTTCAATAGAATCTATTGACTAAGAA-3'(SEQ ID NO. 2); 5'-ATTATTTATTTTTTATATAATTATTATATAATTATTAATTATTATAATTTAGATAATTATAATTTATAATTATAATTATTATTTTTTAGAATTATTTTTATAATTTTATTATTATTTAATATTTATTTATTTATAATTTATATTTAATTATTTATTATATTATAATTAATATAAAATCAAAGTGATAGTATTATATAAATATAAAGATAAAGAATTTAATAGAGTAAAGATAAATTTCATTTTCATATCTATAATCATATCTATAAAGATAAAGTATAAATATAAGTTAAAATCTATTAAAAAGTCTATTAATATTAAGTTATTAATATTAAGTAAATATGTAAGTAAATATTAATTTTTTAATATATATATTTAGTATAATTAAATTAATATATTATAAATTAATATATTAAATTAATATAAATTATAAATTATTATAATAAGATTATTATATTATTATAATATATAATATAATAAAATAATATATAATATAAATATAATATAAATAAAAATTTATAAATTAAT-3' (SEQ ID NO. 3); 5'-TATTATATTTATGTTATATTTATATGTATTTATATGTATAATATTATATTTGATATTATAGATATTATAATATTTATATTTGATATTATAGATATTATAATATTTATATTTGATATTATATTATATTTTTATTATTTTATTTATATTTATTAATATTAATTTTATTAATATTTAAAATAATAAATATTTTTTAAATTATGAAATTATAAATATTTAAAAATTAGAAATATAAAATAATATAA-3' (SEQ ID NO. 4).
[0039] Example 2 Molecular marker of Paphiopedilum giganteum leaf variant and sequence alignment with related species To determine whether the molecular marker of the present application has species specificity, the molecular marker of the present application was submitted to NCBI for online blast alignment, selecting nr / nt library, without limiting species. As shown in Table 1, the molecular marker of the present application has high specificity to Paphiopedilum giganteum, and has no cross-reaction with other related species. Figures 1-3As shown, it was found that the molecular marker of the application was all Paphiopedilum in the nr / nt library of NCBI. Select Highly similar sequences (megablast) parameters, Figure 1 The highest consistency of SEQ ID NO. 1 was P. bellatulum, with a consistency of 96.71%. Select Somewhat similar sequences (blastn) parameters, Figure 2 The highest consistency of SEQ ID NO. 2 was P. bellatulum, with a consistency of 96.07%; Figure 3 The highest consistency of SEQ ID NO. 3 was P. bellatulum, with a consistency of 90.07%. SEQ ID NO. 4 had no higher homologous sequence in the nr database, indicating that the molecular marker of the application was extremely specific. In addition to being able to distinguish P. bellatulum var. albopurpureum from normal P. bellatulum (P. bellatulum), the molecular marker of the application can also be distinguished from other Paphiopedilum plants.
[0040] Example 3 Identification method 1 of P. bellatulum var. albopurpureum 1) Collect green tissues (such as leaves) of Paphiopedilum to be detected as a sample to be detected; 2) Extract total DNA of the sample to be detected; 3) Perform second-generation high-throughput sequencing on the total DNA of the sample, and obtain sequencing reads; 4) Assemble the sequencing data, and compare the assembled contigs with the aforementioned molecular marker; 5) Perform sequence alignment of contigs that can completely cover the molecular marker and have the highest consistency with the molecular marker, and determine whether the sample is P. bellatulum var. albopurpureum according to the alignment results; if it is consistent with the sequence of the molecular marker, it is determined that the species of the sample to be detected is P. bellatulum var. albopurpureum, otherwise the opposite result is obtained.
[0041] The detection results are shown in Table 1. Figures 4-7 As shown in Table 1, two P. bellatulum var. albopurpureum sequences (samples 2-3) were completely consistent with the molecular marker (sample 1) in Example 1, and the homologous sequences of the other species had differences with the sequence of the molecular marker in Example 1, indicating that the method of the application can accurately identify P. bellatulum var. albopurpureum.
[0042] Example 4 Identification method 2 of P. bellatulum var. albopurpureum 1) Collect green tissues (such as leaves) of Paphiopedilum to be detected as a sample to be detected; 2) Extract total DNA of the sample to be detected; 3) The total DNA of the above samples is respectively subjected to second-generation high-throughput sequencing to obtain sequencing reads; 4) The sequencing reads are aligned to the DNA molecular marker according to the default parameters of the Geneious software; 5) Whether the sample contains the Paphiopedilum bellatulum leaf variant is determined according to the coverage of the sequencing reads on the DNA molecular marker; if the molecular marker can be completely covered and a consistent sequence identical to the DNA molecular marker can be generated, it is determined that the species of the sample to be tested contains the Paphiopedilum bellatulum leaf variant; 6) If the sequencing reads of multiple samples are mixed and grouped in the foregoing step 4), step 6) is further included, i.e., the sample containing the Paphiopedilum bellatulum leaf variant is further divided into two groups, the sequencing reads are mixed respectively, and the above step 5) is repeated until the Paphiopedilum bellatulum leaf variant of the individual sample is identified.
[0043] The results are shown in Figures 8-15 , Figures 8-11 It is shown that the sequencing reads of the sample containing the Paphiopedilum bellatulum leaf variant can completely cover SEQ ID NO. 1-SEQ ID NO. 4, and generate a sequence identical to SEQ ID NO. 1-SEQ ID NO. 4. However, Figures 12-15 It is shown that the sequencing reads of the sample not containing the Paphiopedilum bellatulum leaf variant (containing Paphiopedilum micranthum, Paphiopedilum wilsonii, Paphiopedilum primulifolium, Paphiopedilum henryanum, Paphiopedilum rothschildii, Paphiopedilum barbigerum, Paphiopedilum hirsutum, Paphiopedilum callosum, Paphiopedilum tsangianum, Paphiopedilum eximium, Paphiopedilum delenatii, Paphiopedilum rosalindae, Paphiopedilum dracomontanum) cannot generate a sequence identical to SEQ ID NO. 1-SEQ ID NO. 4 on SEQ ID NO. 1-SEQ ID NO. 4, wherein Figure 14 and Figure 15 It is shown that there is an obvious gap. Figure 14 Due to the long sequence, the specific sequence is not shown, wherein red is A base, green is T base, blue is C base, and yellow is G base. The red box is a gap (the black part in the consistent sequence).
[0044] The above is only a preferred embodiment of the present application, and does not limit the present application in any form. Although the present application has been disclosed as above with a preferred embodiment, it is not intended to limit the present application. Any person skilled in the art can make some changes or modifications to the above disclosed technical content without departing from the scope of the technical solution of the present application, and any equivalent embodiments with equivalent changes and modifications made on the basis of the technical essence of the present application to the above embodiments are still within the scope of the technical solution of the present application.
Claims
1. A molecular marker for identifying or aiding in the identification of a Paphiopedilum giganteum leaf variant, characterized in that, The molecular marker comprises at least one sequence of SEQ ID NO. 1-4.
2. The molecular marker of claim 1, wherein The molecular marker comprises all sequences of SEQ ID NO. 1-4.
3. A method of identifying or aiding in the identification of a Paphiopedilum var. leaf variant, characterized in that The method comprises the following steps: 1) collecting leaves of Paphiopedilum bellatulum as a sample to be detected; 2) extracting total DNA of the sample to be detected; 3) performing high-throughput sequencing on the total DNA to obtain sequencing reads; 4) assembling the sequencing data and aligning the assembled contigs with the molecular marker of claim 1; 5) performing sequence alignment between the contigs that can completely cover the molecular marker of claim 1 and have the highest consistency and the molecular marker of claim 1, and determining whether the sample is Paphiopedilum bellatulum based on the alignment result; if the sequence is consistent with the molecular marker of claim 1, it is determined that the sample to be detected is Paphiopedilum bellatulum.
4. A method of identifying or aiding in the identification of a Paphiopedilum leaf variant, characterized in that The method comprises the following steps: 1) collecting leaf tissue of Paphiopedilum bellatulum as a sample to be detected; 2) extracting total DNA of the sample to be detected; 3) performing high-throughput sequencing on the total DNA of the sample to obtain sequencing reads; 4) aligning the sequencing reads to the molecular marker of claim 1; 5) determining whether the sample contains Paphiopedilum bellatulum based on the coverage of the sequencing reads on the molecular marker; if the sequencing reads can completely cover the molecular marker and generate a consistent sequence that is completely consistent with the DNA molecular marker, it is determined that the sample to be detected contains Paphiopedilum bellatulum.
5. The method of identifying or aiding in the identification of a Paphiopedilum leaf variant of claim 4, wherein, In step 4), the sequencing reads of multiple samples are mixed and grouped, and step 6) is further included, i.e., the samples containing Paphiopedilum bellatulum are further divided into two groups, the sequencing reads are mixed respectively, and the above step 5) is repeated until the Paphiopedilum bellatulum of a single sample is identified.
6. The method of identifying or aiding in the identification of a Paphiopedilum leaf variant according to any one of claims 3 to 5, wherein, In step 3), the high-throughput sequencing is second-generation sequencing or third-generation sequencing.
7. The method for identifying or assisting in the identification of leaf variants of Paphiopedilum macrocarpa as described in any one of claims 3 to 5, characterized in that, In step 4), any one of Geneious, Bowtie, Tophat or HISAT is used for reads alignment.
8. Use of the molecular marker of claim 1 or claim 2 as a reference sequence in a method for identifying or assisting in identifying Paphiopedilum bellatulum.
Citation Information
Patent Citations
Chloroplast genome of dendrobium huoshanense and germplasm identification method
CN103468709A
Identification method for paphiopedilum bellatulum, paphiopedilum concolor and paphiopedilum wenshanense
CN105123299A
CAPS molecular marker for identifying species of paphiopedilum hirsutissimum and application of CAPS molecular marker
CN118028509A
Paphiopedilum PCMYB1 gene and application thereof in changing plant flower color
CN119285723A