Molecular marker, primer group and kit for identifying camellia oleifera improved variety Jiangxi 2 and application of molecular marker, primer group and kit

Abstract

The invention discloses a molecular marker, a primer group and a kit for identifying a camellia oleifera improved variety Ganxi 2 and application of the molecular marker, the primer group and the kit. The primer group comprises a primer 5 '-ATGATGGATGGGAGATGAA-3' and a primer 5 '-CACAACAGGCTGGAATGG-3' aiming at the SSR molecular marker est-SSR29, and a primer 5 '-ACGGTGGAGAAGACGATTGT-3' and a primer 5 '-TCGCCGATTCCTTCTTCGTT-3' aiming at the SSR molecular marker CCgSSR-19. The two groups of primers are respectively amplified to obtain three specific bands of 266bp, 269bp and 272bp, and two specific bands of 138bp and 148bp. According to the invention, a scientific technical guarantee is provided for the identification of the oil tea improved variety 'Gandida 2'.

Description

Technical Field

[0001] This invention relates to the fields of variety resource identification and bio-agricultural germplasm innovation technology, specifically to a molecular marker, primer set, reagent kit, and application for identifying the superior Camellia oleifera variety 'Ganwu 2'. Background Technology

[0002] Camellia oleifera is a unique woody oilseed tree species in my country, integrating ecological, economic, and social benefits. With a cultivation history of 2300 years, it is considered one of the world's "four major woody oilseed plants," along with olive, oil palm, and coconut. Camellia oil is highly nutritious, with an unsaturated fatty acid content as high as 90%, and is rich in squalene, tocopherol, and other trace substances beneficial to human health. It possesses various medicinal properties and can effectively prevent various cardiovascular diseases such as hypertension, hyperlipidemia, and coronary heart disease. It is popularly known as "health oil," "longevity oil," and "postpartum oil," and is recognized worldwide as one of the healthiest edible oils.

[0003] Camellia oleifera, a unique woody oilseed tree species in my country, possesses the unique advantages and development potential of not competing with farmland or people for food. Making full use of barren hills and wastelands for Camellia oleifera planting, strengthening the transformation of existing low-yield and inefficient Camellia oleifera forests, and significantly increasing camellia oil production can effectively alleviate the contradiction between oilseed supply and demand and import pressure, enhance my country's food security capacity, and is an important measure to ensure national food and oil security.

[0004] Currently, most newly planted camellia oleifera forests are of the main varieties recommended by the state. However, the phenotypic differences among the main camellia oleifera varieties are small, making it difficult to effectively identify and distinguish them based on phenotypic alone. This poses challenges to variety identification and protection management. Therefore, it is necessary to conduct variety identification research on the existing main cultivated camellia oleifera varieties as soon as possible and develop a set of rapid technical measures for variety testing, which can better solve this problem in production.

[0005] Microsatellites (SSRs), as codominant molecular markers, are stable and efficient, enabling rapid and accurate analysis of allele segregation. They are one of the important molecular markers in molecular biology research and are often used in research such as forest tree germplasm identification.

[0006] 'Ganwu 2' is a high-yield, disease-resistant camellia oleifera variety that has been promoted and applied in production. However, it is difficult to distinguish the authenticity of the variety based on its morphological characteristics during the seedling stage, making it difficult to effectively identify and supervise the variety. This has brought difficulties to the promotion of the variety, so it is necessary to find a fast, convenient and effective identification method. Summary of the Invention

[0007] The first objective of this invention is to provide an SSR molecular marker for identifying the superior Camellia oleifera variety 'Ganwu 2', comprising the SSR molecular markers est-SSR29 and / or CC_gSSR-19. The repeating motif of the SSR molecular marker est-SSR29 is (ACC)n, where n≥6, and its right-hand sequence is shown in SEQ ID NO.10, while its left-hand sequence is shown in SEQ ID NO.11. The repeating motif of the SSR molecular marker CC_gSSR-19 is (GGTCT)n, where n≥2, and its right-hand sequence is shown in SEQ ID NO.12, while its left-hand sequence is shown in SEQ ID NO.13.

[0008] The second objective of this invention is to provide a core primer set for identifying SSR molecular markers in the superior Camellia oleifera variety 'Ganwu 2', comprising primers for the SSR molecular marker est-SSR29 and / or primers for the SSR molecular marker CC_gSSR-19:

[0009] The primers for the SSR molecular marker est-SSR29 are as follows:

[0010] est-SSR29_F: 5'-ATGATGGATGGGAGATGAA-3';

[0011] est-SSR29_R: 5'-CACAACAGGCTGGAATGG-3';

[0012] The primers for the SSR molecular marker CC_gSSR-19 are as follows:

[0013] CC_gSSR-19_F: 5'-ACGGTGGAGAAGACGATTGT-3';

[0014] CC_gSSR-19_R: 5'-TCGCCGATTCCTTCTTCGTT-3'.

[0015] The third objective of this invention is to provide a rapid detection kit for identifying the superior Camellia oleifera variety 'Ganwu 2', which includes the core primer set of the aforementioned SSR molecular marker.

[0016] The fourth objective of this invention is to provide the application of the core primer set of the above-mentioned SSR molecular marker or the above-mentioned rapid detection kit in the identification of the superior Camellia oleifera variety 'Ganwu 2'.

[0017] The fifth objective of this invention is to provide a method for identifying a superior Camellia oleifera variety, 'Ganwu 2', which includes the following steps:

[0018] (1) Extract genomic DNA from the camellia oil sample to be tested;

[0019] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the core primer set of the SSR molecular markers described above;

[0020] (3) The PCR amplification products in step (2) are genotyped, and the genotype results are banded. If the PCR amplification products obtained by using primer pair est-SSR29-F / est-SSR29-R as primers have three specific bands of 266bp, 269bp and 272bp, and the PCR amplification products obtained by using primer pair CC_gSSR-19-F / CC_gSSR-19-R as primers have two specific bands of 138bp and 148bp, then the tea oil sample to be tested is 'Ganwu 2'. Otherwise, it indicates that the tea oil sample to be tested is not 'Ganwu 2'.

[0021] Preferably, the 266bp sequence is shown in SEQ ID NO.5, the 269bp sequence is shown in SEQ ID NO.6, the 272bp sequence is shown in SEQ ID NO.7, the 138bp sequence is shown in SEQ ID NO.8, and the 148bp sequence is shown in SEQ ID NO.9.

[0022] Preferably, the PCR reaction system comprises: 1 μL of 10×buffer, 1.2 μL of dNTP (2.5 mM), 0.6 μL of MgCl2 (25 mM), 1 μL of primer (1 μM), 0.07 μL of HotTaq 5 U / μL, 1 μL of sample DNA, 5.13 μL of ddH2O, and a total volume of 10 μL.

[0023] Preferably, the PCR reaction program is as follows: 95℃ for 2 min; denaturation at 95℃ for 20 s, annealing at 63℃~57.5℃ for 40 s, extension at 72℃ for 1 min, 11 cycles, with the temperature decreasing by 0.5℃ in each cycle; denaturation at 95℃ for 20 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min, 24 cycles; holding at 72℃ for 2 min; and storing the reaction product at 4℃.

[0024] The sixth objective of this invention is to provide the application of the above-described method in the rapid identification of superior Camellia oleifera variety 'Ganwu 2'.

[0025] Advantages of this invention:

[0026] This invention identifies the 'Ganwu 2' variety by directly measuring the est-SSR29 and CC_gSSR-19 markers, overcoming the uncertainty of identification based on external morphological characteristics. The method is simple to operate, highly efficient, and provides reliable and intuitive results, offering scientific and technical support for the identification of the superior Camellia oleifera variety 'Ganwu 2'. This invention is beneficial for the promotion and protection of this superior variety. Attached Figure Description

[0027] Figure 1 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S1-S30 using the core primers of the SSR molecular marker est-SSR29.

[0028] Figure 2 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S31-S60 using the core primers of the SSR molecular marker est-SSR29.

[0029] Figure 3 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S61-S90 using the core primers of the SSR molecular marker est-SSR29.

[0030] Figure 4 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S91-S109 using the core primers of the SSR molecular marker est-SSR29.

[0031] In the figure, S1-S109 represent the names of Camellia oleifera varieties (see Table 1). The horizontal axis represents the number of motifs, i.e., 0-10 indicates the number of motifs of the SSR amplified by the Camellia oleifera variety under this SSR primer. The vertical axis represents the density. The motif of this SSR is (ACC), where the fragment size at position 0 is 248bp, 1 indicates that the fragment contains 1 SSR motif with a fragment size of 251bp (248+3), 2 indicates that the fragment contains 2 SSR motifs with a fragment size of 254bp (248+6), and so on.

[0032] Figure 5 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S1-S30 using the core primers of the SSR molecular marker CC_gSSR-19.

[0033] Figure 6 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S31-S60 using the core primers of the SSR molecular marker CC_gSSR-19.

[0034] Figure 7 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S61-S90 using the core primers of the SSR molecular marker CC_gSSR-19.

[0035] Figure 8 This is a genotyping diagram of SSR amplification of Camellia oleifera varieties S91-S109 using the core primers of the SSR molecular marker CC_gSSR-19.

[0036] In the figure, S1-S109 represent the names of Camellia oleifera varieties (see Table 1). The horizontal axis represents the number of motifs, i.e., 0-8 indicates the number of motifs of the SSR amplified by the Camellia oleifera variety under this SSR primer. The vertical axis represents the density. The motif of this SSR is (GGTCT), where the fragment size at position 0 is 128bp, 1 indicates that the fragment contains 1 SSR motif with a fragment size of 133bp (128+5), 2 indicates that the fragment contains 2 SSR motifs with a fragment size of 38bp (128+10), and so on. Detailed Implementation

[0037] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0038] Example 1:

[0039] 300 pairs of SSR primer sequences were developed from the transcriptome data of Camellia oleifera. Primers with clear SSR electrophoresis bands were selected from these primers. SSR-Seq technology was then used to detect SSR sites in Camellia oleifera varieties. The markers est-SSR29 (est-SSR29_F: 5'-ATGATGGATGGGAGATGAA-3', est-SSR29_R: 5'-CACAACAGGCTGGAATGG-3') and CC_gSSR-19 (CC_gSSR-19_F: 5'-ACGGTGGAGAAGACGATTGT-3'; CC_gSSR-19_R: 5'-TCGCCGATTCCTTCTTCGTT-3') were selected to identify the superior Camellia oleifera variety 'Ganwu 2'. Among them, the marker est-SSR29 amplified three specific bands for the superior Camellia oleifera variety 'Ganwu 2', with band sizes of 266bp, 269bp, and 272bp, respectively.

[0040] The 266bp sequence is: ATGATGGATGGGAGATGAAGAAAGATGAGATGCCATTGTAGCA TGGGGATGGGGTACGGTGGTTGATGACAATATGTCACATTCCTGATCCGATTCCGACATGGGGCAATCCATGTTCACGCCAAACAGCCTCAGTCGCTTTGCTGCAGCTTTTCCATGGACCACCGGCACCGACTCGAATACCATAGGCTCAACTTCACTCTCACTGTTACCACCACCAC CACCACCAAAACCACTTTGCAATTGCACCATTCCAGCCTGTTTGTG(SEQ IDNO.5);

[0041] The 269bp sequence is: ATGATGGATGGGAGATGAAGAAAGATGAGATGCCATTGTAGCATGG GGATGGGGTACGGTGGTTGATGACAATATGTCACATTCCTGATCCGATTCCGACATGGGGCAATCCATGTTCACGCCAAACAGCCTCAGTCGCTTTGCTGCAGCTTTTCCATGGACCACCGGCACCGACTCGAATACCATAGGCTCAACTTCACTCTCACTGTTACCACCACCACCACCACCACCAAAACCACTTTGCAATTGCACCATTCCAGCCTGTTGTG (SEQ ID NO. 6);

[0042] The 272bp sequence is: ATGATGGATGGGAGATGAAGAAAGATGAGATGCCATTGTAGCATGG GGATGGGGTACGGTGGTTGATGACAATATGTCACATTCCTGATCCGATTCCGACATGGGGCAATCCATGTTCACGCCAAACAGCCTCAGTCGCTTTGCTGCAGCTTTTCCATGGACCACCGGCACCGACTCGAATACCATAGGCTCAACTTCACTCTCACTGTTACCACCACCACCACCACCACCACCAAAACCACTTTGCAATTGCACCATTCCAGCCTGTTGTG (SEQ ID NO. 7).

[0043] The marker CC_gSSR-19 amplified two specific bands for the improved Camellia oleifera variety 'Ganwu 2', with band sizes of 138bp and 148bp, respectively.

[0044] The 138 bp sequence is: ACGGTGGAGAAGACGATTGTTCCTTTGGGAGGATCCATTAAGT GTAAGAGCAGTGAGTGAGTGAGATGACGGGTAATGGTCTCCTCGTGGGGTTGGGTCTAG TCTGGTCTGGTCTTATAACGAAGAAGGAATCGGCGA (SEQ ID NO. 8);

[0045] The 148 bp sequence is: ACGGTGGAGAAGACGATTGTTCCTTTGGGAGGATCCATTAAGTGTA AGAGCAGTGAGTGAGATGACGGGTAATGGTCTCCTCGTGGGGTTGGGTCTAGTCT GGTCTGGTCTGGTCTGGTCTTATAACGAAGAAGGAATCGGCGA (SEQ ID NO. 9).

[0046] The combined application of the two markers can be used for the rapid identification and detection of the superior Camellia oleifera variety 'Ganwu 2'.

[0047] One hundred and nine Camellia oleifera cultivars (Table 1) were selected for further validation of est-SSR29 (est-SSR29_F: 5'-ATGATGGATGGGAGATGAA-3', est-SSR29_R: 5'-CACAACAGGCTGGAATGG-3') and CC_gSSR-19 (CC_gSSR-19_F: 5'-ACGGTGGAGAAGACGATTGT-3'; CC_gSSR-19_R: 5'-TCGCCGATTCCTTCTTCGTT-3'). Complete and uncontaminated genomic DNA was extracted from the 109 Camellia oleifera cultivars using a kit (TIANGEN, catalog number: DP360), and the genomic DNA was diluted to 20 ng / μL. The target region was amplified using multiplex PCR. The total reaction volume for the sample multiplex PCR was as follows: 1 μL of 10×buffer (TaKaRa, catalog number: R007WZ), 1.2 μL of dNTP (2.5 mM), 0.6 μL of MgCl2 (25 mM), 1 μL of primer (1 μM), 0.07 μL of HotTaq 5 U / μL (Takara, catalog number: R007WZ), 1 μL of sample DNA, and 5.13 μL of ddH2O, for a total volume of 10 μL. The PCR program was as follows: 95℃ for 2 min; denaturation at 95℃ for 20 s, annealing at 63℃~57.5℃ (temperature decreased by 0.5℃ per cycle) for 40 s, extension at 72℃ for 1 min, 11 cycles; denaturation at 95℃ for 20 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min, 24 cycles; hold at 72℃ for 2 min; the reaction products were stored at 4℃. After mixing the PCR products in equal volumes, tag sequences were added. Following quantitative mixing of the sample libraries, next-generation sequencing was performed. The motif (SSR core unit) of each read was identified based on the sequencing data, and the number of reads corresponding to different repeat numbers of the motif was counted. Based on the read count information, the geom_density tool in ggplot was used to plot the density distribution. The results are shown in Table 1 and... Figure 1-8As shown, primers for est-SSR29 amplified three specific bands for the superior Camellia oleifera variety 'Ganwu 2' (S82), with band sizes of 266bp, 269bp, and 272bp (SEQ ID NO. 5-7), respectively. Primers for CC_gSSR-19 amplified two specific bands for the superior Camellia oleifera variety 'Ganwu 2' (S82), with band sizes of 138bp and 148bp (SEQ ID NO. 8-9), respectively. No such results were observed for other varieties.

[0048] Table 1

[0049]

[0050]

[0051]

[0052]

[0053] This invention identifies the 'Ganwu 2' variety by directly measuring the est-SSR29 and CC_gSSR-19 markers, overcoming the uncertainty of identification based on external morphological characteristics. The method is simple to operate, highly efficient, and provides reliable and intuitive results, offering scientific and technical support for the identification of the superior Camellia oleifera variety 'Ganwu 2'. This invention is beneficial for the promotion and protection of this superior variety.

[0054] References introducing SSR-Seq technology and its applications:

[0055] 1.Sarhanova P,Pfanzelt S,Brandt R,et al.,SSR-seq:Genotyping ofmicrosatellites using next-generation sequencing reveals higher level ofpolymorphism as compared to traditional fragment size scoring.Ecol.Evol.2018,8,10817–10833.

[0056] 2.Yang J,Zhang J,Han R,et al.,Target SSR-Seq:A Novel SSR GenotypingTechnology Associate with Perfect SSRs in Genetic Analysis of CucumberVarieties.Front.Plant.Sci.2019,10,531.

[0057] 3.Cui X,Li C,Qin S,et al.,High-throughput sequencing-basedmicrosatellite genotyping for polyploids to resolve allele dosage uncertaintyand improve analyses of genetic diversity,structure and differentiation:Acase study of the hexaploid Camellia oleifera.,Mol.Ecol.Resources.2021,22,199-211.DOI:10.1111 / 1755-0998.13469.

[0058] 4.Li X,Wang J,Qiu Y,et al.SSR-Sequencing Reveals the Inter-andIntraspecific Genetic Variation and Phylogenetic Relationships among anExtensive Collection of Radish(Raphanus)Germplasm Resources,Biology 2021,10,1250.https: / / doi.org / 10.3390 / biology10121250.

[0059] SEQ ID NO.1

[0060] ATGATGGATGGGAGATGAA

[0061] SEQ ID NO.2

[0062] CACAACAGGCTGGAATGG

[0063] SEQ ID NO.3

[0064] ACGGTGGAGAAGACGATTGT

[0065] SEQ ID NO.4

[0066] TCGCCGATTCCTTCTTCGTT

[0067] SEQ ID NO.5

[0068] ATGATGGATGGGAGATGAAGAAAGATGAGATGCCATTGTAGCATGGGGATGGGGTACGGTGGTTGATGACAATATGTCACATTCCTGATCCGATTCCGACATGGGGCAATCCATGTTCACGCCAAACAGCCTCAGTCGCTTTGCTGCAGCTTTTCCATGGACCACCGGCACCGACTCGAATACCATAGGCTCAACTTCACTCTCACTGTTACCACCACCACCACCACCAAAACCACTTTGCAATTGCACCATTCCAGCCTGTTGTG

[0069] SEQ ID NO.6

[0070] ATGATGGATGGGAGATGAAGAAAGATGAGATGCCATTGTAGCATGGGGATGGGGTACGGTGGTTGATGACAATATGTCACATTCCTGATCCGATTCCGACATGGGGCAATCCATGTTCACGCCAAACAGCCTCAGTCGCTTTGCTGCAGCTTTTCCATGGACCACCGGCACCGACTCGAATACCATAGGCTCAACTTCACTCTCACTGTTACCACCACCACCACCACCACCAAAACCACTTTGCAATTGCACCATTCCAGCCTGTTGTG

[0071] SEQ ID NO.7

[0072] ATGATGGATGGGAGATGAAGAAAGATGAGATGCCATTGTAGCATGGGGATGGGGTACGGTGGTTGATGACAATATGTCACATTCCTGATCCGATTCCGACATGGGGCAATCCATGTTCACGCCAAACAGCCTCAGTCGCTTTGCTGCAGCTTTTCCATGGACCACCGGCACCGACTCGAATACCATAGGCTCAACTTCACTCTCACTGTTACCACCACCACCACCACCACCACCAAAACCACTTTGCAATTGCACCATTCCAGCCTGTTGTG

[0073] SEQ ID NO.8

[0074] ACGGTGGAGAAGACGATTGTTCCTTTGGGAGGATCCATTAAGTGTAAGAGCAGTGAGTGAGTGAGATGACGGGTAATGGTCTCCTCGTGGGGTTGGGTCTAGTCTGGTCTGGTCTTATAACGAAGAAGGAATCGGCGA

[0075] SEQ ID NO.9

[0076] ACGGTGGAGAAGACGATTGTTCCTTTGGGAGGATCCATTAAGTGTAAGAGCAGTGAGTGAGTGAGATGACGGGTAATGGTCTCCTCGTGGGGTTGGGTCTAGTCTGGTCTGGTCTGGTCTGGTCTTATAACGAAGAAGGAATCGGCGA

[0077] SEQ ID NO.10

[0078] ATGATGGATGGGAGATGAAGAAAGATGAGATGCCATTGTAGCATGGGGATGGGGTACGGTGGTTGATGACAATATGTCACATTCCTGATCCGATTCCGACATGGGGCAATCCATGTTCACGCCAAACAGCCTCAGTCGCTTTGCTGCAGCTTTTCCATGGACCACCGGCACCGACTCGAATACCATAGGCTCAACTTCACTCTCACTGTT

[0079] SEQ ID NO.11

[0080] AAAACCACTTTGCAATTGCACCATTCCAGCCTGTTGTG

[0081] SEQ ID NO.12

[0082] ACGGTGGAGAAGACGATTGTTCCTTTGGGAGGATCCATTAAGTGTAAGAGCAGTGAGTGAGTGAGATGACGGGTAATGGTCTCCTCGTGGGGTTGGGTCTAGTCT

[0083] SEQ ID NO.13

[0084] TATAACGAAGAAGGAATCGGCGA

Claims

1. An SSR molecular marker for identifying the superior Camellia oleifera variety 'Ganwu 2', characterized in that, The SSR molecular markers include est-SSR29 and / or CC_gSSR-19. The repeating motif of the SSR molecular marker est-SSR29 is (ACC)n, where n≥6, and its right-hand sequence is shown in SEQ ID NO.10, while its left-hand sequence is shown in SEQ ID NO.

11. The repeating motif of the SSR molecular marker CC_gSSR-19 is (GGTCT)n, where n≥2, and its right-hand sequence is shown in SEQ ID NO.12, while its left-hand sequence is shown in SEQ ID NO.

13.

2. A core primer set for SSR molecular markers used to identify the superior Camellia oleifera variety 'Ganwu 2', characterized in that, This includes primers for the SSR molecular marker est-SSR29 and / or primers for the SSR molecular marker CC_gSSR-19: The primers for the SSR molecular marker est-SSR29 are as follows: est-SSR29_F: 5'-ATGATGGATGGGAGATGAA-3'; est-SSR29_R: 5'-CACAACAGGCTGGAATGG-3'; The primers for the SSR molecular marker CC_gSSR-19 are as follows: CC_gSSR-19_F: 5'-ACGGTGGAGAAGACGATTGT-3'; CC_gSSR-19_R: 5'-TCGCCGATTCCTTCTTCGTT-3'.

3. A rapid detection kit for identifying the superior Camellia oleifera variety 'Ganwu 2', characterized in that, It includes the core primer set of the SSR molecular marker as described in claim 2.

4. The application of the core primer set of the SSR molecular marker as described in claim 2 or the rapid detection kit as described in claim 3 in the identification of the superior Camellia oleifera variety 'Ganwu 2'.

5. A method for identifying superior Camellia oleifera variety 'Ganwu 2', characterized in that, Includes the following steps: (1) Extract genomic DNA from the camellia oil sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the core primer set of the SSR molecular marker described in claim 2; (3) The PCR amplification products in step (2) are genotyped, and the genotype results are banded. If the PCR amplification products obtained by using primer pair est-SSR29-F / est-SSR29-R as primers have three specific bands of 266bp, 269bp and 272bp, and the PCR amplification products obtained by using primer pair CC_gSSR-19-F / CC_gSSR-19-R as primers have two specific bands of 138bp and 148bp, then the tea oil sample to be tested is 'Ganwu 2'. Otherwise, it indicates that the tea oil sample to be tested is not 'Ganwu 2'.

6. The method according to claim 5, characterized in that, The 266bp sequence is shown in SEQ ID NO.5, the 269bp sequence is shown in SEQ ID NO.6, the 272bp sequence is shown in SEQ ID NO.7, the 138bp sequence is shown in SEQ ID NO.8, and the 148bp sequence is shown in SEQ ID NO.

9.

7. The method according to claim 5, characterized in that, The PCR reaction system consisted of: 10×buffer 1 μL, dNTP (2.5 mM) 1.2 μL, MgCl2 (25 mM) 0.6 μL, primer (1 μM) 1 μL, HotTaq 5 U / μL 0.07 μL, sample DNA 1 μL, ddH2O 5.13 μL, and a total volume of 10 μL.

8. The method according to claim 5, characterized in that, The PCR reaction program was as follows: 95℃ for 2 min; denaturation at 95℃ for 20 s; annealing at 63℃~57.5℃ for 40 s; extension at 72℃ for 1 min; 11 cycles, with the temperature decreasing by 0.5℃ for each cycle. Denaturation at 95℃ for 20 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min, 24 cycles; hold at 72℃ for 2 min; store reaction product at 4℃.

9. The application of the method described in claim 5 in the rapid identification of superior Camellia oleifera variety 'Ganwu 2'.

Images