Rice stalk-strengthening gene qCel6 linked molecular marker and application thereof
By developing the InDel marker STS-qCel6 linked to the rice stem strength gene qCel6, the problem of insufficient application of QTLs related to rice stem strength was solved, achieving efficient and low-cost identification of cellulose content and improving the breeding efficiency and stem strength of lodging-resistant rice.
Patent Information
- Application Number
- CN202511422704.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2025-11-21
AI Technical Summary
There are few existing QTLs related to rice stem strength that can be directly applied to production practices, making it difficult to meet the needs of breeding practices and affecting the breeding efficiency and quality of lodging-resistant rice varieties.
A molecular marker linked to the rice stem-strengthening gene qCel6 was developed. Genotype identification was performed using the InDel marker STS-qCel6. Differences in the 1-938,283bp region of rice chromosome 6 were detected by PCR, providing an efficient and low-cost method for identifying cellulose content.
This method enables efficient and low-cost identification of cellulose content in rice stems, improving the efficiency and level of lodging-resistant rice breeding and enhancing stem strength.
Smart Images

Figure CN120989293A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to rice breeding, in particular, to a strong stem gene of rice qCel6 and its application. BACKGROUND
[0002] Rice is the first grain crop in China, and its high yield and stability are of great significance to food security in China. The promotion of high-yield rice varieties with large panicles and the widespread application of simplified cultivation techniques such as direct seeding and throwing seedlings often result in lodging during the middle and late growth stages of rice. After lodging occurs, grain filling is blocked, and it is prone to mold and germination, affecting the yield and quality of rice (Lang et al., 2012). It is reported that the annual yield reduction caused by rice lodging is about 10-30%, which seriously restricts rice production (Zhu Zhonglin et al., 2024). Therefore, it is of great practical significance to breed high-yield rice varieties with lodging resistance.
[0003] The cell wall of rice stem is divided into primary wall and secondary wall. Studies have shown that the thickened secondary wall is the structural basis of mechanical tissue, and its physical and chemical properties and quantity determine the stem strength and affect the lodging resistance of rice (Liu Chang et al., 2016; Zhang et al., 2021; Zhu Zhonglin et al., 2024). The components of secondary wall of rice stem mainly include cellulose, hemicellulose and lignin, etc., which provide mechanical support for plant growth and development and response to the external environment (Kameshwar and Qinet, 2016; Zhao et al., 2025).
[0004] Cellulose is the most abundant component in the cell wall, and its content in mature rice stem reaches 40-50%. Many studies have directly proved that the level of cellulose content is directly related to the stem strength (Ishimaru et al., 2008; Zhang Baocai et al., 2015; Zhang et al., 2021; Xu et al., 2023). The transcription factor OsSWAF1 The increase of expression level can significantly increase the cellulose content in rice stem, thereby enhancing the stem strength and improving the lodging resistance of the plant (Huang et al., 2015); knocking out the negative regulation gene of cellulose content IIP4 After that, the secondary wall cellulose content of the mutant stem increased, the secondary wall thickness increased significantly, and the stem strength increased (Zhang et al., 2018).
[0005] Currently, based on the cloning and functional studies of stem strength-related genes, we have a relatively deep understanding of the genetic mechanisms regulating stem strength. However, there are few relevant QTLs that can be directly applied to production practices, which is insufficient to meet the needs of breeding practices. Therefore, it is necessary to further identify the QTLs controlling stem strength and develop efficient molecular markers for identifying these genes, which can provide genetic resources and technical support for the molecular design of strong-stemmed, lodging-resistant rice varieties. Summary of the Invention
[0006] To address the current shortage of QTLs related to stem strength that can be directly applied in production practices, this invention provides a rice stem strength gene. qCel6 Linked molecular markers and their applications are of great significance for improving the breeding efficiency and level of strong-stem, lodging-resistant rice.
[0007] To achieve the above objectives, the present invention provides a method for addressing rice stem-strengthening genes. qCel6 Tightly linked molecular markers, qCel6 The site is located in the 1-938,283bp region of chromosome 6 of rice. The molecular marker is an InDel marker designed by the difference of 31 nucleotides from position 301 to 331 of SEQ ID NO.1. The corresponding primer pairs are shown in SEQ ID NO.2-SEQ ID NO.3.
[0008] SEQ ID No. 1: TTGGATGTTTTTTCTTTAATTTTCTACGGCTTTTCAGCCATAGGCCATAGATCAAACGATTAGAATAGAATCGTCAGCTCAAGCTGCCGTTATCTTTCAACGATTTCTTCAACTGGTATAAAGCGGAGTCTTGTGAGAAAGTACACACTGAAGATGGCTGAAAGAAAGTTGTATACTTGGTGACTCTGCTGGCAAAGCTTTACTGATAATTAAATTACCTACTTTTTCGTTCTGAATTATCTACGAGCCATATTAAAATGGTACTGTAATTAACACTAGTTCCAAGTATCGAACAAACTT[TTTCATGCCATTTTTTTCTTCAATGTGCAGT / -------------------------------]GACAGTTAGGCGCTAGAAAATGCTCCTGACGTACATGCGCGCCTCGGCGGCGCTGCTGGTGCTGTCGGCGGTGGCGCACTGCGCCGGAGTGTACACCGTCGCCGGCCTCTCCGAGCTGGTCCCCGCCGTGGTCGCCGCCGGCCGCCGGCGGGGTCGTCTTCGCCGCGTCCATGCTCGTCGATCGCTCACTACGTCGTCCTCGACATACCAAAGCATAATTAAATTTGAAAATATACATTTCATTCAATTTTTTCTCGGGAATATTCGAGACGTAAAATTTTTTGCAAAAAACATATTGTC, wherein "-------------------------------" represents the corresponding base deletion; SEQ ID No. 2: 5'-GCATGTACGTCAGGAGCATT-3'; SEQ ID No. 3: 5'-TGGTATAAAGCGGAGTCTTGTG-3'.
[0009] qCel6 The genotype of the locus is Homo GLA genotype or Homo NP genotype, when the to-be-tested rice or the candidate rice qCel6 The genotype of the locus is Homo GLA is a to-be-tested rice or a candidate material with high cellulose content; when qCel6 The genotype of the locus is HomoNP genotype of the to-be-tested rice or the candidate material is low in cellulose content.
[0010] The second aspect of the present application provides the use of the above-mentioned molecular marker in any one of the following: (1) identifying or assisting in identifying the cellulose content of rice stems; (2) preparing a product for identifying or assisting in identifying the cellulose content of rice stems; (3) rice assisted breeding; (4) preparing a rice assisted breeding product.
[0011] Specifically, in the use of (2) or (4), the product is a PCR reagent or a kit containing the primer pair.
[0012] The third aspect of the present application provides a breeding method for increasing the cellulose content of rice stems, selecting qCel6 a rice with a genotype of Homo GLA at the locus as a parent for breeding, so as to breed a rice variety with high cellulose content in stems.
[0013] Through the above technical solutions, the present application achieves the following beneficial effects: The present application provides an InDel marker STS-qCel6 closely linked to the rice stem strength gene qCel6 STS-qCel6, which is developed based on InDel technology and can detect the difference between the 845113th and 845144th bases of chromosome 6 of the rice genome in high throughput, and the present application applies the InDel marker to genotype identification of the rice strength gene qCel6 STS-qCel6, which is developed based on InDel technology and can detect the difference between the 845113th and 845144th bases of chromosome 6 of the rice genome in high throughput, and the present application applies the InDel marker to genotype identification of the rice strength gene qCel6 STS-qCel6, which is developed based on InDel technology and can detect the difference between the 845113th and 845144th bases of chromosome 6 of the rice genome in high throughput, and the present application applies the InDel marker to genotype identification of the rice strength gene BRIEF DESCRIPTION OF DRAWINGS
[0014] qCel6 is the phenotype and genetic background analysis of GLA and substitution line C72, A) the plant type of GLA and substitution line C72, the scale is 15 cm; B) cellulose content determination; C) genetic background analysis of substitution line C72 and molecular markers for detecting target fragments, the blue rectangular box represents the genome of japonica rice variety Nipponbare, and the red rectangular box represents the genome of indica rice variety Guangluai; Figure 1 is Figure 2 the electrophoretogram of the linked molecular marker STS-qCel6, P1 is Guangluai, P2 is Nipponbare, and P1+P2 represents the parental genotype, i.e., the heterozygous genotype; qCel6It carries the GLA haplotype under the background of Japanese sunshine. Figure 3 Near-isogenic line (NIL-GLA), A) Genetic background analysis of NIL-GLA, with blue rectangles representing the Nipponbare japonica rice genome and red rectangles representing the Guanglu dwarf indica rice genome; B) Plant type of NIL-GLA, with a scale bar of 15 cm. Detailed Implementation
[0015] The specific embodiments of the present invention will be described in detail below with reference to examples. It should be understood that the specific embodiments described herein are for illustration and explanation only and are not intended to limit the present invention.
[0016] Example 1: Rice Strong Stem Gene qCel6 Positioning Using the indica rice variety Guangluai (GLA) as the recipient parent and the japonica rice variety Nipponbare (NP) as the donor parent, a set of chromosome segment substitution lines containing 175 lines (C1-C175) was constructed (Zhu JY, Niu YC, Tao YG, et al. Plant Breeding, 2015, 134(2):156-163.). The heading date of the 175 substitution lines was systematically recorded. After the plants had headed for 25 days, the second internode from the top of the main stem panicle with normal development was selected, and 10 plants from each line were taken. The samples were mixed, ground into powder, and analyzed by Huang et al. ( qCel6 The Plant The method reported in 2015, 27(6): 1681-1696, was used to determine the cellulose content in the second-to-last stem section. Each sample was measured three times. The results showed that the cellulose content in the stem of the substitution line C72 was 455.59±3.79 mg / g, while the cellulose content in the recipient parent GLA was 495.11±12.78 mg / g. Analysis of the cellulose determination results using one-way ANOVA in SPSS 23.0 showed that the cellulose content in the stem of the substitution line C72 was significantly lower than that of GLA. p =0.0081), indicating that C72 carries the QTL that regulates cellulose content ( Cell (AB); Analysis of the genetic background of the substitution line C72 revealed that C72 carries only one introduced segment on each of chromosomes 3, 4, and 6 ( ). Figure 1 According to the MSU RGAP Release 7-Genomic Sequences, the physical locations of the three imported fragments carried by C72 are SL1: Chr.3 10,852,161-127457751bp, SL2: Chr.4 19,232,106-23,282,977bp, and SL3: Chr.6 1-938,283bp.
[0017] A F2 segregating population of 152 lines was obtained by crossing C72 with GLA and selfing. To accurately locate the genes regulating cellulose content, 3 pairs of SSR molecular markers (https: / / www.gramene.org / ) with polymorphisms between GLA and NP in the physical interval corresponding to the 3 introduced fragments in C72 were screened for tracking the 3 introduced fragments in C72. Figure 1 In the middle C). First, DNA extraction was performed on 500 single plants, and genotype analysis was performed on the 500 single plants using the 3 pairs of molecular markers described above. The DNA extraction and genotype detection methods are as follows: 1) DNA extraction: CTAB method was used to extract the DNA of the tender leaves of the above-mentioned 500 single plants: 2) Genotype analysis: 20 μL PCR reaction system was used to amplify the target fragments using the above-mentioned molecular markers. The reaction system was: genomic DNA 2.5 μL, primer premix 17.5 μL (optimal primer mix ratio: in a 96-well system, forward primer Primer F concentration 10 μM, volume 80 μL, reverse primer Primer R concentration 10 μM, volume 80 μL, Nanjing Nuowezan Biotechnology Co., Ltd. 2x Taq Master Mix 800 μL, ddH2O 960 μL). The PCR amplification program was: 95 °C pre-denaturation for 5 min; 94 °C denaturation for 40 s, selection of appropriate annealing temperature (50-58 °C) annealing for 40 s, 72 °C extension for 40 s, 32 cycles; after the cycles, 72 °C extension for 10 min, and finally 18 °C incubation. Finally, the amplification products were detected by electrophoresis in a 3% agarose gel.
[0018] Note: The above reaction system is the optimal reaction system, and other reasonable reaction systems can also achieve the same detection purpose. The above is the recommended detection method, and other detection methods that can achieve the same detection purpose can also be used.
[0019] Through the above analysis, 8 single plants carrying only the SL1 introduced fragment were obtained, numbered SL1-1~SL1-8, 10 single plants carrying the SL2 introduced fragment were obtained, numbered SL2-1~SL2-10, and 9 single plants carrying the SL3 introduced fragment were obtained, numbered SL3-1~SL3-9. The progeny test results showed that the cellulose content of single plants carrying only the SL3 introduced fragment was significantly lower than that of the recipient parent GLA (Table 1).
[0020] Table 1 Determination results of stem cellulose content of dye single fragment substitution
[0021] Note: The significance level is set to P<0.05, extremely significant level is set as P <0.01, same below.
[0022] Therefore, it is shown that the QTL carried by the substitution line C72 for regulating cellulose content is located on the introduced fragment carried by the 6th chromosome, and is named as Figure 1 The positioning interval is 1-938,283 bp.
[0023] Example two Strong culm gene qCel6, Development of linkage molecular marker STS-qCel6 According to the genomic nucleotide sequence information of GLA and NP in the 3K rice database (http: / / ricevarmap.ncpgr.cn / two_cultivars_compare / ), it is found that there is a 31 bp base difference between GLA and NP at the position of 845,113 bp, and the flanking sequences of 300 bp on the left and right of the site are selected as the sequence table SEQ ID NO. 1. Preferably, 5 groups of InDel primers are designed by using Primer6.0 software, and after rice whole genome Blast analysis is performed by using NCBI (https: / / www.ncbi.nlm.nih.gov / ), a pair of primers STS-qCel6 are selected for polymorphism verification, and the results show that the primer has good polymorphism between the two parents (Table 1) qCel6 ), the sequence information is that the sequence of SEQ ID No. 2: Primer F: 5'-GCATGTACGTCAGGAGCATT-3' and SEQ ID No. 3 Primer R: 5'-TGGTATAAAGCGGAGTCTTGTG-3'; the sequences of SEQ ID NO. 2 and SEQ ID NO. 3 are single-stranded DNA of the 114th-135th and the 350th-368th of the sequence table SEQ ID NO. 1. When the variety GLA is amplified by using STS-qCel6, the target fragment size is 225 bp; when the variety NP is amplified, the target fragment size is 256 bp Figure 2 ). The genotypes of 500 single plants in example one are detected by using the molecular marker STS-qCel6. 120 single plants carrying homozygous GLA genotype (Homo GLA ), 124 single plants carrying homozygous NP genotype (Homo NP ), and 256 single plants with parent genotypes, which are consistent with the genetic segregation ratio of 1:2:1 (χ²= 0.352<5.991). It is shown that STS-qCel6 can be used to identify whether the candidate rice carries GLA haplotype Figure 3 .
[0024] The application characteristics of the above-mentioned marker are: the rice to be tested or the candidate riceqCel6 The genotype is Homo GLA At that time, the rice or candidate material to be tested was high in cellulose content; qCel6 The genotype at the locus is Homo NP When considering genotypes, the rice varieties being tested or candidate materials are those with low cellulose content. Among them, Homo... GLA Genotype represents the rice genome as described in the text. qCel6 The nucleotide sequence at the site is identical to that of GLA, indicating homozygosity; Homo NP Genotype represents the rice genome qCel6 The nucleotide sequence at the site is identical to that of Nipponbare, indicating it is homozygous.
[0025] Example 3 Strong Straw Gene qCel6 Application of the linked molecular marker STS-qCel6 in marker-assisted selection of rice varieties with high fiber content To verify STS- qCel6 To assess the reliability of the molecular markers, indica rice variety GLA was used as the donor parent and japonica rice variety NP as the recipient parent. Combined with STS-qCel6 molecular marker detection, a backcross was employed to construct a GLA-type gene carrier in the NP background. qCel6 The near-isogenic line (NIL) was obtained. Five backcrosses were performed, yielding four BC5F1 individuals. Each of these four individuals self-pollinated to produce 20 BC5F2 individuals, resulting in a total of 80 individuals. Combined with the detection of the molecular marker STS-qCel6, each population carried Homo. GLA Two haploid plants were identified, bringing the total to eight. The cellulose content of the BC5F3 lines derived from these eight haploid plants was analyzed. The results showed that the cellulose content of all eight lines was significantly higher than that of the NP line (Table 2).
[0026] Table 2 Results of cellulose content determination
[0027] Further random selection of the second strain, namely strain number 2 (Wuhan Shuanglvyuan Co., Ltd.), for background analysis showed that its genetic background had basically reverted to the Nipponbare background, with the introduced fragment only carried on chromosomes 6 and 12. qCel6 This line can serve as a candidate for carrying GLA haplotypes against a Nipponbare background. Figure 3 The above results further confirm the NIL. qCel6 qCel6 The authenticity of the gene was verified, indicating its high applicability in screening for strong rice plants. It also showed that the use of the molecular marker STS-qCel6 to screen for high fiber content plants was efficient and yielded stable results.
[0028] The preferred embodiments of the present application are described in detail above, but the present application is not limited to the specific details of the above-described embodiments, and various simple modifications can be made to the technical solutions of the present application within the technical concept of the present application, and these simple modifications all belong to the protection scope of the present application.
[0029] In addition, it should be noted that each specific technical feature described in the above specific embodiments can be combined in any appropriate manner without contradiction, and in order to avoid unnecessary repetition, the present application will not further describe various possible combinations.
[0030] In addition, various different embodiments of the present application can also be combined in any manner, as long as it does not deviate from the idea of the present application, and it should also be considered as disclosed by the present application.
Claims
1. A molecular marker closely linked to a strong culm gene in rice (Oryza sativa L.) which is characterized by, qCel6 qCel6 The site is located in the interval 1-938,283bp of the 6th chromosome of rice, and the molecular marker is an InDel marker designed by the difference of 31 nucleotides of 301-331 of SEQ ID NO. 1, and the corresponding primer pair is shown as SEQ ID NO. 2-SEQ ID NO.
3. 2. The molecular marker of claim 1, wherein qCel6 the genotype of the locus is Homo GLA the genotype or Homo NP the genotype, when the test rice or candidate rice qCel6 the genotype of the locus is Homo GLA the test rice or candidate material with high cellulose content; when qCel6 the genotype of the locus is Homo NP the test rice or candidate material with low cellulose content.
3. Use of the molecular marker of claim 1 or 2 in any one of: (1) identifying or assisting in identifying the stem cellulose content of rice; (2) making a product for identifying or assisting in identifying the stem cellulose content of rice; (3) rice assisted breeding; (4) making a product for rice assisted breeding.
4. Use according to claim 3, characterized in that, In application (2) or (4), the product is a PCR reagent or kit containing the primer pair.
5. A breeding method for increasing the stem cellulose content of rice, characterized by, Selecting qCel6 The genotype of the site is Homo GLA Rice as the parent breeding, for breeding stem containing high cellulose rice varieties.