Method for detecting pseudomonas aeruginosa in food and application thereof
By combining a fluorescence spectrometer with colloidal gold and terbium-based metal-organic frameworks (Tb-MOFs), and utilizing the specific binding of aptamers to Pseudomonas aeruginosa, a rapid and sensitive quantitative detection of Pseudomonas aeruginosa has been achieved. This solves the problems of slow response speed and complicated operation in existing methods and is suitable for the real-time detection of Pseudomonas aeruginosa in food.
Patent Information
- Application Number
- CN202511188881.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-25
- Publication Date
- 2025-11-21
AI Technical Summary
Existing methods for detecting Pseudomonas aeruginosa suffer from slow response, complex operation, and poor sensitivity and specificity, making it difficult to meet the demand for rapid and immediate detection in food.
A fluorescence spectrometer was used in conjunction with colloidal gold and terbium-based metal-organic frameworks (Tb-MOFs) to achieve rapid and sensitive detection of Pseudomonas aeruginosa by utilizing the specific binding of aptamers to the bacteria and observing changes in fluorescence intensity.
It achieves highly sensitive quantitative detection of Pseudomonas aeruginosa, with a detection range of 1–10⁶ CFU/mL and a detection limit of 0.63 CFU/mL. It is suitable for solution systems such as water and beverages and is easy to operate.
Smart Images

Figure CN120992570A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biosensor technology, specifically relating to a method for detecting Pseudomonas aeruginosa in food and its application. Background Technology
[0002] Pseudomonas aeruginosa is a common waterborne pathogen, widely found in various types of water. It exhibits strong resistance to disinfectants, ultraviolet light, and other physical and chemical factors, as well as adverse environmental conditions. As an opportunistic pathogen, it can cause diseases such as acute enteritis, sepsis, and skin inflammation. Pseudomonas aeruginosa can contaminate drinking water, milk, meat, fruits, and vegetables, and is frequently transmitted through bottled or barrelled drinking water. Its tenacious vitality in various environments poses a serious threat to food safety; therefore, the detection of Pseudomonas aeruginosa has become an indispensable part of food sampling inspections.
[0003] Currently, the main detection methods for Pseudomonas aeruginosa include plate culture, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA). These methods suffer from drawbacks such as slow response, long processing time, and poor sensitivity and specificity. Furthermore, they rely on preliminary culture and complex processing steps, which are not conducive to rapid and immediate detection in food. Therefore, a detection method with high sensitivity, strong specificity, and simple operation is needed to overcome the limitations of existing methods. Summary of the Invention
[0004] To address the problems and shortcomings of existing technologies, the purpose of this invention is to provide a novel method for detecting Pseudomonas aeruginosa using a fluorescence spectrometer. This method utilizes the fluorescence quenching properties of colloidal gold on terbium-based metal-organic framework materials to achieve rapid and sensitive detection of Pseudomonas aeruginosa.
[0005] To achieve the above objectives, the technical solution of the present invention is as follows:
[0006] A method for detecting Pseudomonas aeruginosa in food includes the following steps: Step 1: Mixing and incubating a Pseudomonas aeruginosa aptamer solution with a colloidal gold solution, then adding NaCl solution and mixing to obtain a mixed solution; Step 2: Mixing and incubating the mixed solution with a sample solution to be tested, then adding Tb-MOFs solution and mixing to obtain a precursor solution to be tested; Step 3: Measuring the fluorescence intensity of the precursor solution to be tested.
[0007] In some embodiments of the present invention, the detection is a quantitative detection, and the detection method further includes the steps of plotting a standard curve and performing quantitative analysis based on the standard curve.
[0008] In some embodiments of the present invention, the step of plotting a standard curve and performing quantitative analysis based on the standard curve specifically includes: preparing standard solutions of Pseudomonas aeruginosa at different concentrations; mixing the mixed solution with standard solutions of Pseudomonas aeruginosa at different concentrations respectively; then adding terbium-based metal-organic framework (Tb-MOFs) solution and incubating; after incubation, detecting the fluorescence intensity of each solution respectively; establishing a standard curve based on the linear relationship between fluorescence intensity and Pseudomonas aeruginosa concentration; substituting the fluorescence intensity of the precursor solution to be tested into the standard curve to calculate the content of Pseudomonas aeruginosa in the sample solution to be tested.
[0009] In some embodiments of the present invention, the concentration of colloidal gold in step 1 is 400 nM to 800 nM, the concentration of the aptamer solution is 150 nM to 300.0 nM, and the concentration of the NaCl solution is 140.0 mM to 280.0 mM.
[0010] In some embodiments of the present invention, the concentration of the Tb-MOFs solution in step 2 is 0.25 mg / mL to 0.5 mg / mL.
[0011] In some embodiments of the present invention, when preparing the precursor solution to be tested, the volume ratio of the aptamer solution, the colloidal gold solution, the NaCl solution, the sample solution to be tested, and the Tb-MOFs solution is (50-100):(200-400):(100-200):(20-40):(120-240).
[0012] In some embodiments of the present invention, the temperature for mixing and incubating in steps 1 and 2 is 25°C to 40°C, and the time is 10 min to 20 min, respectively.
[0013] In some embodiments of the present invention, the mixing reaction temperatures in steps 1 and 2 are 25°C to 40°C, and the times are 10 min to 20 min, respectively.
[0014] In some embodiments of the present invention, the preparation method of the Tb-MOFs is as follows: TbCl3·6H2O is dissolved in a mixed solution of DMF and H2O, stirred evenly, and then 3,5-dicarboxyphenylboronic acid is added to obtain a reaction solution; the reaction solution is transferred to a polytetrafluoroethylene container in an autoclave and kept at 120℃~200℃ for 6h~18h; after the reaction is completed, the precipitate is collected by centrifugation, and the precipitate is washed and dried to obtain the terbium-based metal-organic framework Tb-MOFs.
[0015] In some embodiments of the present invention, the food includes bottled drinking water and beverages.
[0016] The present invention also provides the application of the detection method described above in the detection of Pseudomonas aeruginosa in food.
[0017] In some embodiments of the present invention, the food includes drinking water and beverages.
[0018] Beneficial effects:
[0019] This invention proposes a novel method for detecting Pseudomonas aeruginosa in food, which can be achieved using a fluorescence spectrometer with a detection range of 1–10. 6 The detection limit is 0.63 CFU / mL. This method is the first to use Tb-MOFs as fluorescent signal elements and aptamers as target recognition elements, exhibiting good anti-interference capabilities and applicability to solution systems such as water and beverages. Furthermore, this method eliminates the need for bacterial culture, offering advantages such as ease of operation and high sensitivity. Attached Figure Description
[0020] Figure 1 This is a schematic diagram of the detection method for Pseudomonas aeruginosa of the present invention.
[0021] Figure 2 These are scanning electron microscope (SEM) images of the Tb-MOFs material prepared in Example 1, where A and B are images at low magnification, and C and D are images at high magnification.
[0022] Figure 3 This is the ultraviolet absorption spectrum of colloidal gold.
[0023] Figure 4 The images show the fluorescence spectra of the Tb-MOFs material prepared in Example 1, where A is the fluorescence absorption spectrum and B is the fluorescence emission spectrum.
[0024] Figure 5 This is a zeta potential diagram of Tb-MOFs materials, colloidal gold, and colloidal gold aptamer complexes.
[0025] Figure 6 Example 2 shows the detection of standard Pseudomonas aeruginosa solutions at different concentrations, where A is the detection fluorescence spectrum and B is the detection standard curve.
[0026] Figure 7 Example 3 describes the detection of Pseudomonas aeruginosa in bottled drinking water.
[0027] Figure 8 Example 4 describes the detection of Pseudomonas aeruginosa in orange juice beverages. Detailed Implementation
[0028] The present invention will be described in more detail below with reference to the embodiments. It should be understood that the implementation of the present invention is not limited to the embodiments below, and any modifications or alterations made to the present invention will fall within the protection scope of the present invention.
[0029] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other.
[0030] In the following examples, unless otherwise specified, the reagents, materials, and equipment used are commercially available, prepared by conventional methods, or commonly used in the industry. Unless otherwise specified, all percentages are in units of mass.
[0031] Pseudomonas aeruginosa is a common opportunistic pathogen that can cause foodborne illnesses by contaminating food, especially packaged drinking water. This poses a significant health risk to vulnerable populations such as the elderly, the sick, children, and pregnant women, easily leading to diseases like acute enteritis. Rapid, accurate, and highly sensitive detection and analysis techniques for Pseudomonas aeruginosa are crucial for preventing its spread. Commonly used detection methods for Pseudomonas aeruginosa, such as plate culture, polymerase chain reaction (PCR), and enzyme-linked immunosorbent assay (ELISA), require complex equipment and expertise in molecular biology. These methods are time-consuming, have limited sensitivity, and require extended detection times, making them unsuitable for rapid, real-time detection of Pseudomonas aeruginosa. Among numerous fluorescent materials, fluorescent metal-organic frameworks (MOFs) possess unique advantages in optical tunability, rich fluorescence properties, and diversity in structural and functional components, making them ideal materials for constructing high-performance fluorescence sensing methods. Among them, metal-organic frameworks based on lanthanide metal ions have excellent fluorescence properties and low toxicity. Fluorescent biosensing technologies established using lanthanide metal-organic framework materials have advantages such as fast response speed, high sensitivity, strong anti-interference ability and high stability, making them a detection tool with broad market prospects.
[0032] Based on this, this application provides a method for detecting Pseudomonas aeruginosa in food, aiming to solve the problems of limited sensitivity, high equipment and technical requirements, cumbersome operation steps, and long detection time of traditional detection methods, which cannot meet the rapid detection needs in various scenarios. This invention develops a novel fluorescent aptamer sensing detection method for food sample detection by focusing on two aspects: the selection of fluorescent materials and the improvement of binding aptamer sensitivity.
[0033] The detection method in the example will be explained in more detail below.
[0034] This application provides a method for detecting Pseudomonas aeruginosa in food, comprising the following steps:
[0035] Step 1: Mix and incubate the Pseudomonas aeruginosa aptamer solution with colloidal gold solution, then add NaCl solution and mix well to obtain a mixed solution;
[0036] Step 2: Mix the mixed solution with the sample solution to be tested and incubate, then add Tb-MOFs solution and mix well to obtain the precursor solution to be tested;
[0037] Step 3: Measure the fluorescence signal of the precursor solution to be tested.
[0038] Specifically, please combine Figure 1 The detection principle of this invention is as follows: Dispersed colloidal gold can quench the fluorescence of Tb-MOFs materials. However, under high-concentration salt ion conditions, colloidal gold solutions will aggregate. Aggregated colloidal gold has a weak effect on the fluorescence intensity of Tb-MOFs materials. The aptamer for Pseudomonas aeruginosa can protect colloidal gold from aggregation caused by high-concentration salt ions. In the presence of Pseudomonas aeruginosa, the target bacterium specifically binds to the aptamer, pulling the aptamer away from the colloidal gold surface. Without the protection of the aptamer, the colloidal gold will aggregate under the induction of high-concentration salt ions. Compared with the solution system containing the target bacterium, the fluorescence intensity value of the solution system containing the target bacterium is higher. The higher the concentration of Pseudomonas aeruginosa in the solution, the greater the fluorescence intensity value of the precursor solution. Therefore, the precise quantitative detection of Pseudomonas aeruginosa can be achieved by observing changes in the fluorescence signal.
[0039] This invention creatively utilizes the fluorescence properties of Tb-MOFs materials and the high selectivity of aptamers for target analytes to achieve highly sensitive quantitative detection of *Pseudomonas aeruginosa*. Compared with traditional luminescent materials, lanthanide-based MOFs possess unique fluorescence properties, mainly attributed to their unique 4f electronic structure, strong spin-orbit coupling, and efficient antenna effect; they also feature simple synthesis methods and low cost, reducing detection costs. Furthermore, the Tb-MOFs materials synthesized in this invention are stable in aqueous solutions, thus enabling their application in the detection of food samples such as drinking water and beverages. Based on this, this invention provides a detection technique for *Pseudomonas aeruginosa* in food solution samples that offers a stable fluorescence signal source and high selectivity.
[0040] Furthermore, in some embodiments of the present invention, the aptamer sequence is CCCCCGTTGCTTTCGCTTTTCCTTTCGCTTTTGTTCGTTTCGTCCCTGCT TCCTTTCTTG. This aptamer can specifically bind to *Pseudomonas aeruginosa*, thereby recognizing *Pseudomonas aeruginosa* in food samples. The amount of *Pseudomonas aeruginosa* added has a specific relationship with the fluorescence value. Specifically, the less *Pseudomonas aeruginosa* in the sample, the more colloidal gold is dispersed in the NaCl solution, and the more colloidal gold reacts with the Tb-MOFs material, the more obvious the fluorescence quenching phenomenon, and vice versa. The aptamer is diluted to a specific concentration with Tris-HCl buffer before use.
[0041] In some embodiments of the present invention, the detection is a quantitative detection, and the detection method further includes the steps of plotting a standard curve and performing quantitative analysis based on the standard curve. The present invention utilizes the relationship between the concentration of *Pseudomonas aeruginosa* bacterial suspension and the detection fluorescence signal to achieve quantitative analysis of the target analyte, which is key to constructing a novel detection method. Tb-MOFs, as excellent converters, can convert bacterial suspension concentration into a fluorescence signal output, thereby achieving highly sensitive quantitative detection.
[0042] Specifically, in some embodiments of the present invention, the steps of plotting a standard curve and performing quantitative analysis based on the standard curve include:
[0043] Standard solutions of Pseudomonas aeruginosa at different concentrations were prepared. The mixed solutions were mixed with standard solutions of Pseudomonas aeruginosa at different concentrations and reacted. Then, terbium-based metal-organic framework (Tb-MOF) solution was added, mixed, and incubated. After incubation, the fluorescence intensity of each solution was detected. A standard curve was established based on the linear relationship between fluorescence intensity and Pseudomonas aeruginosa concentration.
[0044] The fluorescence intensity of the precursor solution to be tested is substituted into the standard curve to calculate the content of Pseudomonas aeruginosa in the sample solution to be tested.
[0045] Specifically, in some embodiments of the present invention, the established standard curve regression equation is Y = 131.82logC + 1065.15, where Y is the fluorescence intensity value of the solution and C is the concentration of Pseudomonas aeruginosa in the sample.
[0046] In some embodiments of the present invention, the concentration of colloidal gold in step 1 is 400 nM to 800 nM, the concentration of the aptamer solution is 150 nM to 300.0 nM, and the concentration of the NaCl solution is 140.0 mM to 280.0 mM.
[0047] In a specific embodiment of the present invention, the concentration of the colloidal gold solution in step 1 is 400 nM, the concentration of the aptamer solution is 150.0 nM, and the concentration of the NaCl solution is 140.0 mM.
[0048] In some embodiments of the present invention, the concentration of the Tb-MOFs solution in step 2 is 0.25 mg / mL to 0.5 mg / mL.
[0049] In some embodiments of the present invention, when forming the precursor solution to be tested, the volume ratio of colloidal gold solution, aptamer solution, NaCl solution, sample solution to be tested and Tb-MOFs solution is (200-400):(50-100):(100-200):(20-40):(120-240).
[0050] In some embodiments of the present invention, the temperature for mixing and incubating in steps 1 and 2 is 25°C to 40°C, and the time is 10 min to 20 min, respectively.
[0051] In a specific embodiment of the present invention, the mixing and incubation temperatures in steps 1 and 2 are 37°C and the incubation times are 10 min, respectively.
[0052] In some embodiments of the present invention, the mixing reaction temperatures in steps 1 and 2 are 25°C to 40°C, and the times are 10 min to 20 min, respectively.
[0053] In a specific embodiment of the present invention, the mixing reaction temperature in steps 1 and 2 is 37°C and the time is 10 min, respectively.
[0054] In some embodiments of the present invention, the preparation method of Tb-MOFs is as follows: TbCl3·6H2O is dissolved in a mixed solution of DMF and H2O, stirred evenly, and then 3,5-dicarboxyphenylboronic acid is added to obtain a reaction solution; the reaction solution is transferred to a polytetrafluoroethylene container in an autoclave and kept at 120℃~200℃ for 6h~18h; after the reaction is completed, the precipitate is collected by centrifugation, and the precipitate is washed and dried to obtain the terbium-based metal-organic framework Tb-MOFs.
[0055] In a specific embodiment of the present invention, the preparation method of Tb-MOFs is as follows: 37.3 mg of terbium chloride hexahydrate (TbCl3·6H2O) is accurately weighed and dissolved in 10 mL of a DMF / H2O mixed solution (7:3). Then, under magnetic stirring, 20.9 mg of 3,5-dicarboxyphenylboronic acid (5-BOP) is added to the solution until completely dissolved. The mixed solution is placed in a polytetrafluoroethylene-lined high-pressure reactor and reacted at 150°C for 12 h. After the reaction is completed, the reactor is allowed to cool slowly to room temperature. The obtained material is collected by centrifugation and repeatedly washed with DMF and anhydrous ethanol. Finally, it is dried overnight at 50°C in a constant temperature drying oven to obtain a white powder, which is the Tb-MOFs.
[0056] In this invention, Tb-MOFs synthesized via a solvothermal method exhibit excellent fluorescence properties and stability. Tb-MOFs can continuously emit high fluorescence for up to one month, and the effect of ionic strength from 0.1 to 0.8 mM on Tb-MOFs is negligible, indicating excellent stability under long-term and high ionic strength conditions. Furthermore, Tb-MOFs exhibit strong fluorescence over a wide pH range (pH = 4-10), but are quenched under strongly acidic (pH = 1-3) and alkaline (pH = 11-14) conditions, demonstrating good luminescence performance in neutral and slightly acidic / alkaline environments. These advantages make this fluorescent material suitable for the detection of microorganisms in food, particularly in neutral and slightly acidic foods, such as drinking water and orange juice.
[0057] In some embodiments of the present invention, the colloidal gold solution is prepared by heating a tetrachloroauric acid solution to boiling on a magnetic stirrer, rapidly adding sodium citrate solution to the boiling solution, observing that the color of the solution changes from pale yellow to wine red during heating, and maintaining stirring for 20 minutes.
[0058] In some embodiments of the present invention, the tetrachloroauric acid solution has a mass fraction of 1% w / w, the sodium citrate solution has a mass fraction of 1% w / w, the volume ratio of addition is 3:7, and the boiling temperature is 110℃~130℃.
[0059] In some embodiments of the present invention, the food includes bottled drinking water and orange juice beverages.
[0060] This invention also provides the application of the detection method described above in the detection of Pseudomonas aeruginosa in food. In some embodiments of this invention, the food includes drinking water and beverages.
[0061] The implementation process of the present invention will be described in detail below through examples.
[0062] Example 1
[0063] This embodiment provides a method for preparing colloidal gold and Tb-MOFs.
[0064] Preparation of colloidal gold: Colloidal gold was synthesized using the sodium citrate reduction method. 1.5 mL of 1% (w / v) HAuCl4 solution was diluted to 100 mL with water and heated to boiling on a magnetic stirrer. 3.5 mL of 1% (w / v) sodium citrate solution was quickly added to the boiling solution. During heating, the solution color changed from pale yellow to wine red. Stirring was maintained for 20 min. After the solution cooled to room temperature, the prepared colloidal gold was placed in a light-proof brown bottle and stored in a refrigerator at 4°C for later use.
[0065] Preparation of Tb-MOFs: Tb-MOFs were synthesized via a solvothermal method. 37.3 mg of terbium chloride hexahydrate (TbCl3·6H2O) was accurately weighed and dissolved in 10 mL of a DMF / H2O mixed solution (7:3). Then, under magnetic stirring, 20.9 mg of 3,5-dicarboxyphenylboronic acid (5-BOP) was added until completely dissolved. The mixed solution was placed in a polytetrafluoroethylene-lined high-pressure reactor and reacted at 150 °C for 12 h. After the reaction, the reactor was allowed to cool slowly to room temperature. The collected material was collected by centrifugation and repeatedly washed with DMF and anhydrous ethanol. Finally, it was dried overnight at 50 °C in a constant-temperature drying oven to obtain a white powder.
[0066] Figure 2 Scanning electron microscope images of the terbium-based metal-organic framework material prepared for this example show that the prepared material is in a rod-like dispersion state with a length between 0 and 1.5 μm; Figure 3 The image shows the ultraviolet absorption spectrum of colloidal gold, indicating that colloidal gold has a characteristic ultraviolet absorption peak at 520 nm. Figure 4 The fluorescence absorption and emission spectra of the prepared terbium-based metal-organic framework material show that the optimal absorption wavelength of the prepared terbium-based metal-organic framework material is 256 nm, and the optimal emission wavelengths are 503 nm and 556 nm, respectively, providing basic test conditions for fluorescence value determination. Figure 5 The zeta potential diagrams for colloidal gold, terbium-based metal-organic frameworks, and colloidal gold-aptamer complexes show that terbium-based metal-organic frameworks are positively charged, colloidal gold is negatively charged, and colloidal gold-aptamer complexes are nearly negatively neutral, providing potential evidence for the reaction between colloidal gold and fluorescent materials.
[0067] Example 2
[0068] This embodiment provides a method for detecting Pseudomonas aeruginosa.
[0069] (1) Preparation of standard bacterial suspensions: The concentration of the cultured bacterial suspensions was determined using a UV spectrophotometer. The original bacterial suspensions were serially diluted to obtain 10⁻⁶ standard suspensions. 6CFU / mL, 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 Standard bacterial solutions with concentrations of CFU / mL and 10 CFU / mL.
[0070] (2) Fluorescence sensing detection: Accurately pipette 50 μL of aptamer solution and add it to 200 μL of colloidal gold solution, incubate at 37 °C for 10 min. Add 100 μL of NaCl solution to the colloidal gold aptamer mixture and incubate at 37 °C for 10 min. Then, add 20 μL of standard bacterial solutions of different concentrations to the above mixture respectively; finally, add 120 μL of Tb-MOFs suspension to the above mixture and react for 10 min to prepare the precursor solution to be tested. Use a fluorescence spectrometer to record the change in fluorescence intensity of the precursor solution at 556 nm at an excitation wavelength of 256 nm, and plot a standard curve.
[0071] Figure 6 The figures show the fluorescence spectrum and standard curve obtained using standard bacterial solutions. It can be seen that this method can produce fluorescence signal responses to bacterial solutions of different concentrations. The relationship between the fluorescence intensity at 556 nm and the bacterial solution concentration is Y = 131.82logC + 1065.15, R... 2 =0.9909, indicating that the detection method has good accuracy.
[0072] Example 3
[0073] This embodiment provides a method for detecting Pseudomonas aeruginosa in bottled drinking water.
[0074] (1) Sample pretreatment: Take 10 mL of liquid sample and dilute it tenfold with 90 mL of deionized water to prepare a 1:10 sample homogenate, and add bacterial suspensions of a certain concentration gradient to form the sample solution to be tested.
[0075] (2) Fluorescence sensing detection: Accurately pipette 50 μL of aptamer solution and add it to 200 μL of colloidal gold solution, incubate at 37 °C for 10 min. Add 100 μL of NaCl solution to the colloidal gold aptamer mixture and incubate at 37 °C for 10 min. Then, add 20 μL of the bacterial culture to be tested to the above mixture; finally, add 120 μL of Tb-MOF suspension to the above mixture and react for 10 min to prepare the precursor solution; use a fluorescence spectrometer to record the fluorescence intensity value of the precursor solution at 556 nm at an excitation wavelength of 256 nm, and calculate the content of Pseudomonas aeruginosa in the sample based on the fluorescence intensity value and the standard curve.
[0076] Furthermore, the homogenized sample was compared and measured using the plate culture method.
[0077] Figure 7 The results of the detection of Pseudomonas aeruginosa in bottled drinking water samples show that the method is effective in 10... 2 10 4 10 6 The concentration of Pseudomonas aeruginosa detected at CFU / mL gradient concentrations was close to that of the actual added bacterial solution, with a small error. The detection effect was better than that of the plate culture method, which verified the reliability of this method in drinking water samples.
[0078] Example 4
[0079] This embodiment provides a method for detecting Pseudomonas aeruginosa in orange juice beverages.
[0080] The sample processing method was performed according to Example 3. The detection method was performed according to Example 3, and the sample homogenate was compared and measured using the plate culture method.
[0081] Figure 8 The results of the detection of Pseudomonas aeruginosa in orange juice samples show that the method is effective in 10... 2 10 4 10 6 The concentration of Pseudomonas aeruginosa detected at CFU / mL gradient concentrations was similar to that of the actual added bacterial solution, and the detection effect was better than that of the plate culture method, which verified the reliability of this method in actual orange juice beverage samples.
Claims
1. A method for detecting Pseudomonas aeruginosa in food, characterized in that, Includes the following steps: Step 1: Mix and incubate the Pseudomonas aeruginosa aptamer solution with colloidal gold solution, then add NaCl solution and mix well to obtain a mixed solution; Step 2: Mix the mixed solution with the sample solution to be tested and incubate, then add terbium-based metal-organic framework (Tb-MOFs) solution and mix well to obtain the precursor solution to be tested; Step 3: Measure the fluorescence signal of the precursor solution to be tested.
2. The detection method according to claim 1, characterized in that, The detection is a quantitative detection, and the detection method further includes the steps of plotting a standard curve and performing quantitative analysis based on the standard curve.
3. The detection method according to claim 2, characterized in that, The steps for plotting the standard curve and performing quantitative analysis based on the standard curve specifically include: Standard solutions of Pseudomonas aeruginosa at different concentrations were prepared. The mixed solutions were mixed with standard solutions of Pseudomonas aeruginosa at different concentrations and reacted. Then, terbium-based metal-organic framework (Tb-MOF) solution was added, mixed, and incubated. After incubation, the fluorescence intensity of each solution was detected. A standard curve was established based on the linear relationship between fluorescence intensity and Pseudomonas aeruginosa concentration. The fluorescence intensity value of the precursor solution to be tested is substituted into the standard curve to calculate the content of Pseudomonas aeruginosa in the sample solution to be tested.
4. The detection method according to claim 1, characterized in that, In step 1, the concentration of the colloidal gold is 400 nM to 800 nM, the concentration of the aptamer solution is 150 nM to 300.0 nM, and the concentration of the NaCl solution is 140.0 mM to 280.0 mM; and / or, The concentration of the terbium-based metal-organic framework (Tb-MOFs) solution in step 2 is 0.25 mg / mL to 0.5 mg / mL.
5. The detection method according to claim 1, characterized in that, When preparing the precursor solution to be tested, the volume ratio of the aptamer solution, the colloidal gold solution, the NaCl solution, the sample solution to be tested, and the terbium-based metal-organic framework (Tb-MOFs) solution is (50-100):(200-400):(100-200):(20-40):(120-240).
6. The detection method according to claim 1, characterized in that, The mixing and incubation temperatures in steps 1 and 2 are 25℃~40℃, and the incubation times are 10min~20min, respectively; and / or, The mixing reaction temperatures in steps 1 and 2 are 25℃ to 40℃, and the time is 10 min to 20 min, respectively.
7. The detection method according to claim 1, characterized in that, The preparation method of the terbium-based metal-organic frameworks (Tb-MOFs) in step 2 is as follows: Dissolve TbCl3·6H2O in a mixed solution of DMF and H2O, stir well, and then add 3,5-dicarboxyphenylboronic acid to obtain the reaction solution. The reaction solution was transferred to a polytetrafluoroethylene container in an autoclave and reacted at 120℃~200℃ for 6h~18h. After the reaction was completed, the precipitate was collected by centrifugation. The precipitate was washed and dried to obtain the terbium-based metal-organic framework Tb-MOFs.
8. The detection method according to any one of claims 1 to 7, characterized in that, The food includes drinking water and beverages.
9. The application of the detection method according to any one of claims 1 to 8 in the detection of Pseudomonas aeruginosa in food.
10. The application according to claim 9, characterized in that, The food includes drinking water and beverages.