Protein detection signal amplifier, kit and method for detecting target protein in sample

Abstract

The invention relates to the technical field of biosensors, and discloses a protein detection signal amplifier, a kit and a method for detecting target protein in a sample. The signal amplifier and the method provided by the invention have the advantages of high specificity, high sensitivity, high detection result accuracy and the like. Moreover, the method provided by the invention can realize at least dual-mode reading of the result, and compared with a detection mode of single-mode reading of the result in the prior art, the accuracy and reliability of the detection result are greatly improved. Besides, the method provided by the invention does not depend on expensive professional instruments, cheap and convenient equipment can be adopted for detection, the dosage of the enzyme reagent with higher price in the detection process is less, and the detection cost and the requirement on the technical level of detection personnel are effectively reduced, so that the method is very suitable for popularization and application in the basic level.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biosensors, in particular to a protein detection signal amplifier, a kit and a method for detecting target proteins in a sample. BACKGROUND

[0002] In the fields of biology and medicine, proteins are often detected as characteristic markers to characterize the activities of tissues, organs or bodies in biological activities. For example, thrombin is an important protein produced by non-active prothrombin through a series of enzyme cleavage processes, which is an intermediary of a series of intracellular information reactions, related to tumor metastasis and cardiovascular diseases, and is often used as a tumor marker for diagnosing lung metastasis.

[0003] Therefore, the development of high-sensitivity and high-selectivity protein detection methods plays an important role in biological research, clinical medicine and early diagnosis of diseases. In the past few decades, scientists have established a variety of protein detection methods including ELISA, electrochemical analysis, fluorescence analysis, chemiluminescence and surface-enhanced Raman scattering. Among the reported detection strategies, fluorescence analysis is favored by researchers due to its high sensitivity and selectivity.

[0004] However, most of the current detection methods rely on the participation of multiple enzymes, and require complex design, optimization of enzyme reaction process and expensive experimental equipment, thereby limiting their further clinical application in bedside detection. Therefore, it is urgent to develop new protein detection tools and methods that are simpler, faster, more sensitive, more specific, and require less expensive experimental equipment and reagents. SUMMARY

[0005] The present application aims to overcome the above-mentioned problems existing in the prior art, and provides a protein detection signal amplifier, a kit and a method for detecting target proteins in a sample. The signal amplifier provided by the present application has the advantages of high specificity and high sensitivity, so that the protein detection method designed based on the signal amplifier can quickly, efficiently and accurately detect target proteins in a sample.

[0006] In order to achieve the above-mentioned purpose, the present application provides a protein detection signal amplifier, which comprises a target protein capture probe, a target protein aptamer, a hairpin probe H1 and a hairpin probe H2.

[0007] At least part of the sequence in the target protein capture probe is complementary to the target protein aptamer to form a double-stranded structure DNA fragment, and the double-stranded structure DNA fragment can be opened in the presence of target proteins.

[0008] The target protein capture probe also has a sequence that initiates the alternate hybridization of hairpin probes H1 and H2 to form a double-stranded structure long sequence.

[0009] The second aspect of the present application provides a kit for detecting a protein, which comprises the following contents:

[0010] (1) the protein detection signal amplifier according to the first aspect; and

[0011] Optionally, (2) an enzyme.

[0012] The third aspect of the present application provides a method for detecting a target protein in a sample, which comprises: contacting and reacting the sample with the protein detection signal amplifier according to the first aspect, and detecting the reaction product by using a detection reagent, or detecting the sample by using the kit according to the second aspect.

[0013] By the above technical solution, the present application can at least achieve the following beneficial effects:

[0014] (1) The method provided by the present application is designed based on the nucleic acid aptamer technology and the HCR technology, and has the advantages of both the sensitivity of the nucleic acid aptamer to the target detection object and the HCR reaction that can be carried out under constant temperature and without enzymes, so that the method provided by the present application can realize high sensitivity and high accuracy in detecting the target protein in the sample without using a large amount of expensive enzyme reagents.

[0015] (2) The method provided by the present application can realize double-mode detection of the target protein, that is, the sample can be detected by both fluorescence detection and enzyme reaction product detection, avoiding the problem that the commonly used method in the prior art only uses single-mode detection, which is easy to produce false positive results and cause doubts about the accuracy and reliability of the detection. By optimizing the type of enzyme reaction used in the detection process, the sample can be detected by using a portable blood glucose meter and other inexpensive portable devices, greatly facilitating the application of bedside detection and other on-site detection.

[0016] (3) The method provided by the present application is simple to operate during the detection process, and does not need to rely on relatively expensive professional instruments, and is very suitable for large-scale popularization and use at the grassroots level. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 is a standard curve of fluorescence concentration versus thrombin concentration drawn in Example 1.

[0018] Figure 2 is a standard curve of glucose content in the enzyme reaction product versus thrombin concentration drawn in Example 1. DETAILED DESCRIPTION

[0019] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0020] Hybridization chain reaction (HCR) is an isothermal nucleic acid amplification technique developed in recent years. It has advantages such as simple operation, high amplification efficiency, and no enzyme-mediated operation. Compared with traditional PCR methods, it is less expensive, easier to use, and requires less personnel and equipment.

[0021] Nucleic acid aptamers are a new type of biorecognition molecule that has been developed in recent years. They have advantages such as high specificity, small molecular weight, simple synthesis, high stability, wide applicability, easy chemical modification, and good tissue penetration. In addition, nucleic acid aptamers also have excellent biocompatibility and controllable and predictable structure, providing an effective detection tool for biomacromolecule detection methods based on nucleic acid aptamers.

[0022] Biosensors are commonly used detection tools in current biological detection technologies. They typically consist of multiple nucleic acid probes with certain functional correlations, offering advantages such as high detection sensitivity and convenience. However, the inventors of this invention discovered during their research that most existing biosensors rely on single-mode readout, which can be susceptible to various interferences during detection, leading to false positive signals. Furthermore, it is difficult to directly detect and eliminate false positive signals, thus affecting the accuracy and reliability of detection methods using biosensors. In addition, existing methods often require re-testing the sample using methods different from the detection method to verify the correctness of the results. However, due to differences between different methods and potential variations in the sample itself across different batches, the accuracy and reliability of such re-testing results are questionable.

[0023] Through extensive research, the inventors ingeniously combined nucleic acid aptamers and hybridization chain reactions to develop a bimodal protein sensor based on an isothermal enzyme-free HCR amplification strategy. The nucleic acid probe molecules within this bimodal protein sensor are cleverly designed to detect the same processed product of the same sample using at least two different methods after processing, effectively avoiding the problem of false positive signals and reduced reliability that can occur with single-mode readouts. Furthermore, this protein sensor combines the advantages of simple, rapid, and low-cost HCR reactions (no need for expensive instruments and large amounts of enzyme reagents) with the high sensitivity and specificity of nucleic acid aptamer technology, providing a high-quality, inexpensive, convenient, and rapid new detection tool for protein detection.

[0024] Based on the above findings, the first aspect of the present invention provides a protein detection signal amplifier, the signal amplifier comprising a target protein capture probe, a target protein nucleic acid aptamer, a hairpin probe H1 and a hairpin probe H2;

[0025] In this embodiment, at least a portion of the sequence in the target protein capture probe is complementary to the target protein nucleic acid aptamer to form a double-stranded DNA fragment, which can be opened in the presence of the target protein;

[0026] The target protein capture probe also has a sequence that induces hairpin probes H1 and H2 to alternately hybridize and form a long double-stranded structure.

[0027] For ease of operation, according to a preferred embodiment of the present invention, the signal amplifier further includes a probe carrier, on which the target protein capture probe is immobilized. Considering the convenience of separation, washing, and other operational steps during the detection process, the probe carrier is preferably selected from micron-sized magnetic beads (e.g., iron tetroxide micron-sized magnetic beads, silicon oxide micron-sized magnetic beads, etc.).

[0028] According to a preferred embodiment of the present invention, the loading amount of the target protein capture probe on the probe carrier is not less than 5 pmol / mg, preferably 5-10 pmol / mg.

[0029] To facilitate the connection between the target protein capture probe and the probe carrier, according to a preferred embodiment of the present invention, the 3' end of the target protein capture probe has a modification group I for connection with the probe carrier, preferably the modification group I is selected from amino groups.

[0030] In this invention, there are no particular restrictions on the specific sequences and design methods of the target protein capture probe, target protein nucleic acid aptamer, hairpin probe H1 and hairpin probe H2 contained in the protein detection signal amplifier, as long as the complementary pairing relationship between the finally obtained nucleic acid aptamer and nucleic acid probe meets the aforementioned requirements.

[0031] According to some preferred embodiments of the present invention, the hairpin probe H1 includes segments H1-1 and H1-2, and the hairpin probe H2 includes segments H2-1 and H2-2, wherein the H1-1 segment (5'→3') of the hairpin probe H1 is complementary to the H2-1 segment (3'→5') of the hairpin probe H2, and the H1-2 segment (5'→3') of the hairpin probe H1 is complementary to the H2-2 segment (3'→5') of the hairpin probe H2. According to a preferred embodiment of the present invention, the 5' end of the hairpin probe H1 has a modifying group II, preferably selected from biotin and streptavidin.

[0032] According to a preferred embodiment of the present invention, the hairpin probe H2 has a stem-ring structure marked with a fluorescent group and a quenching group corresponding to the fluorescent group.

[0033] Since the target protein capture probe can form a double-stranded structure by complementary pairing with the target protein nucleic acid aptamer under enzyme-free conditions, and can also trigger hairpin probes H1 and H2 to form a long double-stranded structure by alternating complementary pairing through HCR reaction, in order to avoid mutual contamination and failure of the probes contained in the protein detection signal amplifier provided by the present invention before use, preferably, the target protein capture probe, hairpin probe H1 and hairpin probe H2 are stored independently before use.

[0034] Preferably, the signal amplifier further includes helper DNA, which can complementaryly pair with at least a portion of the sequence in the target protein capture probe to form a double-stranded DNA fragment. Preferably, the helper DNA includes a first sequence complementary to a portion of the hairpin probe H1 and a second sequence complementary to at least a portion of the sequence in the target protein capture probe. This invention does not impose any particular restrictions on the design of the helper DNA, as long as it conforms to the above complementary pairing principle.

[0035] In this invention, there are no particular restrictions on the specific selection of the target protein; it can be any protein that needs to be detected, such as common target proteins like enzymes and antibodies, or any other protein that needs to be qualitatively or quantitatively detected from a sample. Those skilled in the art, based on the basic design principles of nucleic acid probes and aptamers in the prior art, the characteristics of the target protein, and referring to the features of the nucleic acid probes and aptamers included in the aforementioned signal amplifier, can design signal amplifiers for the detection of different target proteins.

[0036] According to a preferred embodiment of the present invention, the target protein is selected from thrombin.

[0037] When thrombin is used as the target protein, preferably, the nucleotide sequence of the target protein capture probe is as shown in SEQ ID NO:1.

[0038] TTTTTTACCCCAACCTGCCCT(SEQ ID NO:1)

[0039] Preferably, the nucleotide sequence of the target protein aptamer is shown in SEQ ID NO:2. AGTCCGTGGTAGGGCAGGTTGGGGTGACTACCTG(SEQ ID NO:2)

[0040] Preferably, the nucleotide sequence of the hairpin probe H1 is shown in SEQ ID NO:3.

[0041] TACTCCCCCAGGTGCCCCTCAGACC(SEQ ID NO:3)

[0042] Preferably, the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO:4.

[0043] TTTTTTACCTGGGGGAGTAGGTCTGAGGGGC(SEQ ID NO:4)

[0044] Preferably, the nucleotide sequence of the helper DNA is shown in SEQ ID NO:5.

[0045] GGGGAGTAAGGGCAGGTTGGGGTAAAA(SEQ ID NO:5)

[0046] A second aspect of the present invention provides a kit for detecting proteins, the kit comprising the following contents:

[0047] (1) The protein detection signal amplifier as described in the first aspect; and

[0048] Optional, (2) enzyme.

[0049] According to a preferred embodiment of the present invention, the kit further includes a reagent providing a modifying group III, the modifying group III being capable of binding with a modifying group II;

[0050] Alternatively, the enzyme has a modifying group III that can bind to a modifying group II.

[0051] In this invention, the function of modification group III is to interact with modification group II modified on hairpin probe H1, thereby linking the enzyme to the long double-stranded nucleic acid structure formed by the alternating hybridization of hairpin probes H1 and H2. This allows for subsequent detection of the target protein based on the enzymatic reaction of the enzyme with the substrate. Therefore, the kit provided by this invention can directly provide an enzyme containing modification group III for detection, or it can be provided as a reagent containing modification group III, allowing the user to prepare the enzyme containing modification group III before detection.

[0052] In this invention, there are no particular limitations on the enzymes included in the kit. Any enzyme capable of performing an enzymatic reaction on a certain substrate and whose product can be detected in a simple and rapid manner is applicable to this invention. According to a preferred embodiment of the invention, the enzyme is selected from invertase (an enzyme capable of breaking down sucrose into glucose) and / or horseradish peroxidase (a commonly used enzyme in clinical testing reagents, applicable to common medical or biological detection methods such as UV absorbance detection, colorimetric kits, and blood glucose test strips). When the above enzymes are selected, the enzymatic reaction product (glucose) can be detected using compact, convenient, and inexpensive detection devices such as portable blood glucose meters, thereby meeting the needs of application scenarios such as point-of-care testing that require a certain level of accuracy and speed.

[0053] According to a preferred embodiment of the present invention, the kit further includes (3) a buffer solution, which includes: PBS buffer, HEPES buffer, MES buffer, and at least one of buffer A and buffer B, wherein buffer A includes 0.05-0.15M NaCl and 0.05-0.15M PBS buffer, with the remainder being water, and the pH is 7.2-7.5; buffer B includes 0.05-0.15M NaCl, 0.05-0.15M PBS buffer, and 0.01-0.1 vol% Tween 20, with the remainder being water, and the pH is 7.2-7.5. The above buffer solutions are the buffer solutions required for detecting target proteins using the protein detection signal amplifier provided by the present invention. The present invention does not particularly limit the source of the above buffer solutions; they can be related products obtained directly through commercial purchase or customization, or related products prepared according to existing technology.

[0054] Because the signal amplifier provided by this invention requires the connection of different components in the signal amplifier through the interaction of modifying groups with probe carriers or other modifying groups during assembly and use, or the connection of reagents (e.g., enzymes) required for detection with reaction products generated during detection, a certain activator (also known as an activator) is needed to treat the corresponding substances during connection. Therefore, in order to further improve the convenience of using the kit provided by this invention for target protein detection, according to some preferred embodiments of this invention, the kit further includes (4) an activator. Preferably, the activator includes:

[0055] (a) 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide, used to activate the probe carrier so that the target protein capture probe binds to the probe carrier via modification group I; and / or

[0056] (b) Sodium salt of 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid sulfonate succinimide and 2-iminothione are used to activate sucrose invertase and provide a reagent that provides the modifying group III, respectively, so that the modifying group III is bound to the sucrose invertase.

[0057] According to some preferred embodiments of the present invention, the kit further includes (5) a detection reagent, which is the conversion substrate corresponding to the enzyme. Preferably, it is sucrose (the enzyme provided in the kit is sucrose invertase) and / or 3,3',5,5'-tetramethylbenzidine (TMB) chromogenic substrate solution. In the present invention, there are no particular limitations on the form in which the detection reagent is provided; for example, it can be provided in the form of a solid preparation, which can be prepared into a solution of the corresponding concentration before use, or a solution of a specified concentration can be provided directly, further simplifying the detection operation.

[0058] A third aspect of the present invention provides a method for detecting a target protein in a sample, the method comprising: contacting and reacting the sample with the protein detection signal amplifier described in the first aspect, and detecting the reaction product using a detection reagent, or detecting the sample using a kit described in the second aspect.

[0059] According to a preferred embodiment of the present invention, the target protein is thrombin.

[0060] According to a preferred embodiment of the present invention, the method includes:

[0061] (i) Provide a probe carrier immobilized with a double-stranded DNA fragment formed by a thrombin capture probe and a thrombin nucleic acid aptamer, and then make a first contact between the probe carrier immobilized with the double-stranded DNA fragment formed by the thrombin capture probe and the thrombin nucleic acid aptamer and a sample. The thrombin in the sample causes the double-stranded structure of the DNA fragment to open and the thrombin nucleic acid aptamer to be released, thereby obtaining a probe carrier immobilized with a thrombin capture probe.

[0062] (ii) In the presence of helper DNA, the probe carrier immobilized with thrombin capture probe obtained in step (i) is brought into a second contact with hairpin probe H1 and hairpin probe H2. The thrombin capture probe causes hairpin probe H1 and H2 to undergo a hybridization chain reaction, forming a double-stranded long sequence through alternating hybridization. This long sequence is then linked to the thrombin capture probe immobilized on the probe carrier via helper DNA to obtain the second contact product.

[0063] (iii) Detect the probe carrier immobilized with the hybridization chain reaction product in the second contact product obtained in step (ii).

[0064] In the above method, step (i) involves the release of a double-stranded thrombin nucleic acid aptamer, which is complementary to the thrombin capture probe immobilized on the probe carrier, under the action of thrombin in the sample, thereby exposing the thrombin capture probe. The preparation method of the probe carrier immobilized with the double-stranded DNA fragment formed by the thrombin capture probe and the thrombin nucleic acid aptamer includes first linking the two through the interaction between the modification group I on the thrombin capture probe and the probe carrier (e.g., an amide reaction), and then adding the thrombin nucleic acid aptamer to the system to form a double-stranded structure complementary to the thrombin capture probe. In this invention, step (i) can include the above-described step of preparing a probe carrier immobilized with the double-stranded DNA fragment formed by the thrombin capture probe and the thrombin nucleic acid aptamer, or the probe carrier immobilized with the double-stranded DNA fragment formed by the thrombin capture probe and the thrombin nucleic acid aptamer can be prepared before detection and used directly during detection.

[0065] According to a preferred embodiment of the present invention, in step (i), the conditions for the first contact include: a temperature of 35-40°C and a time of 0.5-5h. For example, the time of the first contact can be 0.5h, 1h, 1.5h, 2h, 2.5h, 3h, 3.5h, 4h, 4.5h, or 5h, or it can be a range consisting of any two of the above values, or any intermediate value within that range.

[0066] Preferably, in step (i), the thrombin content in the sample is such that the thrombin concentration in the system during the first contact is not less than 3 pM. Preferably, it is between 10 pM and 50 nM. For example, it can be 10 pM, 20 pM, 50 pM, 100 pM, 200 pM, 500 pM, 1 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, or a range consisting of any two of the above values, or any intermediate value within that range.

[0067] Preferably, in step (i), the amount of probe carrier immobilized with the double-stranded DNA fragment formed by the thrombin capture probe and the thrombin nucleic acid aptamer is such that the concentration of the thrombin capture probe in the first contact system is not less than 0.1 μM. Preferably, it is 1-10 μM. For example, it can be 1 μM, 2 μM, 3 μM, 4 μM, 5 μM, 6 μM, 7 μM, 8 μM, 9 μM, 10 μM, or any range consisting of any two of the above values, or any intermediate value within that range.

[0068] In the above method, step (ii) involves the thrombin capture probe triggering the HCR reaction of hairpin probes H1 and H2, and the resulting HCR reaction product being indirectly linked to the probe carrier via complementary pairing with the thrombin capture probe using helper DNA. If the sample does not contain thrombin, the thrombin capture probe immobilized on the probe carrier will not be exposed after step (i), and the HCR reaction in step (ii) will not occur, resulting in no corresponding detection signal in subsequent detection. When the sample contains thrombin, the presence of a detection signal can be used for qualitative detection of thrombin in the sample. Alternatively, a standard curve can be plotted based on the relationship between the detection signal and thrombin concentration, and then the thrombin content in the sample can be quantitatively detected based on the standard curve and the intensity of the detection signal in the sample.

[0069] According to a preferred embodiment of the present invention, in step (ii), the conditions for the second contact include: 35-40°C and 1-5 hours.

[0070] Preferably, in step (ii), the amount of hairpin probe H1 used is such that the final concentration of hairpin probe H1 in the second contact system is 0.1-2 μM. For example, it can be 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, 1.2 μM, 1.5 μM, 1.8 μM, 2 μM, or it can be a range consisting of any two of the above values, or any intermediate value within that range.

[0071] More preferably, in the second contact system, the ratio of the number of hairpin probe H1 molecules to the number of thrombin capture probe molecules immobilized on the probe carrier is 1:5-10.

[0072] Preferably, in step (ii), the amount of hairpin probe H2 used is such that the final concentration of hairpin probe H2 in the second contact system is 0.1-2 μM. For example, it can be 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM, 0.6 μM, 0.7 μM, 0.8 μM, 0.9 μM, 1 μM, 1.2 μM, 1.5 μM, 1.8 μM, 2 μM, or it can be a range consisting of any two of the above values, or any intermediate value within that range.

[0073] More preferably, in the second contact system, the ratio of the number of hairpin probe H2 molecules to the number of thrombin capture probe molecules immobilized on the probe carrier is 1:5-10.

[0074] More preferably, in step (ii), the final concentration ratio of hairpin probe H1 to hairpin probe H2 in the second contact system is 0.8-1.2:1.

[0075] Preferably, in step (ii), the amount of helper DNA used is such that the final concentration of helper DNA in the second contact system is 0.1-2 μM.

[0076] More preferably, in the second contact system, the ratio of the number of helper DNA molecules to the number of thrombin capture probe molecules immobilized on the probe carrier is 1:5-10.

[0077] In the above method, step (iii) is the process of detecting the HCR reaction product obtained in step (ii) and attached to the probe carrier. Those skilled in the art can arbitrarily choose a suitable detection method based on the characteristics of the hairpin probes H1 and H2 selected in the signal amplifier provided by this invention.

[0078] To avoid interference from other substances contained in the second contact product system with the detection results, according to a preferred embodiment of the present invention, step (iii) further includes the operation of separating the probe carrier immobilized with the hybridization chain reaction product from the second contact product.

[0079] In this invention, there are no particular limitations on the specific detection method, which can be selected according to the actual situation. According to a preferred embodiment of the present invention, the detection method includes fluorescence detection and / or enzyme-catalyzed reaction product detection.

[0080] Preferably, the detection method is fluorescence detection and enzyme-catalyzed reaction product detection. Due to the characteristics of the signal amplifier and kit provided in this application, the method provided by this invention can perform fluorescence detection and enzyme-catalyzed reaction product detection separately on the same sample (to avoid damage to the fluorescent group during the enzyme-catalyzed reaction, which would cause a decrease in fluorescence intensity and affect the accuracy of fluorescence detection, fluorescence detection is usually performed first, followed by enzyme-catalyzed reaction detection). Furthermore, this method of using two methods to detect the same sample (i.e., dual-mode reading) can effectively avoid the problem of one detection method being interfered with, producing false positive signals, and thus reducing the accuracy of the detection results.

[0081] According to a preferred embodiment of the present invention, the fluorescence detection method includes: preparing a dispersion of the isolated probe carrier immobilized with the hybridization chain reaction product, and detecting the fluorescence value of the dispersion. Preferred fluorescence detection conditions include: excitation wavelength 488 nm and emission wavelength 500-620 nm.

[0082] According to a preferred embodiment of the present invention, the detection of the enzymatic reaction product includes: a third contact is made between an isolated probe carrier immobilized with the hybridization chain reaction product and an enzyme having a modification group III, so that the enzyme is linked to the hybridization chain reaction product through the action of modification groups II and III; the product of the third contact is then made into a fourth contact with a substrate to carry out an enzymatic reaction; and the product of the enzymatic reaction in the obtained fourth contact product is then detected. The "isolated probe carrier immobilized with the hybridization chain reaction product" can be obtained directly from the second contact product or can be obtained after fluorescence detection.

[0083] According to a preferred embodiment of the present invention, when using the method of detecting enzyme-catalyzed reaction products, the conditions of the enzyme-catalyzed reaction include: reaction temperature 25-65°C and reaction time 15-60 min.

[0084] For example, the reaction temperature can be 25℃, 30℃, 35℃, 40℃, 45℃, 50℃, 55℃, 60℃, or 65℃, or a range consisting of any two of the above values, or any intermediate value within that range. The reaction time can be 15min, 20min, 25min, 30min, 35min, 40min, 45min, 50min, 55min, or 60min, or a range consisting of any two of the above values, or any intermediate value within that range.

[0085] Those skilled in the art, referring to the specific operations and conditions for detecting thrombin using the method provided by this invention, as well as the design methods and principles of the nucleic acid probes and aptamers used in the aforementioned signal amplifier, and in conjunction with the characteristics of other target proteins to be detected, can reasonably infer the specific process and conditions for detecting other target proteins using the signal amplifier and method provided by this invention. This invention will not elaborate further here.

[0086] The present invention will be described in detail below through embodiments. It should be understood that the following embodiments are only used to further explain and illustrate the content of the present invention by way of example, and are not intended to limit the present invention.

[0087] Unless otherwise specified, all reagents or materials used in the following examples are commercially available products purchased from legitimate chemical or biological reagent / material suppliers, and all reagents are of analytical grade.

[0088] Unless otherwise specified, the operating temperature in the following embodiments is room temperature (25±3℃).

[0089] Preparation Example 1

[0090] (I) Synthesis of DNA probes, aptamers, and helper DNA

[0091] Using thrombin as an example of the target detection protein, and referring to Table 1, we commissioned Sangon Biotech (Shanghai) Co., Ltd. to synthesize DNA probes, aptamers, and helper DNA.

[0092] Table 1

[0093]

[0094] Note: The synthesized hairpin probes H1 and H2 are in a single-chain state and need to be annealed before use to form a stem-loop structure; in hairpin probe H2, the labeling group BHQ is attached to the T at the 6th position.

[0095] (II) Preparation of buffer solution

[0096] PBS buffer: 8mM Na2HPO4, 136mM NaCl, 2mM KH2PO4, 2.6mM KCl, pH = 7.2-7.4.

[0097] HEPES buffer: 100mM NaCl, 20mM MgCl2, pH=7.2.

[0098] Buffer A: 0.1M NaCl, 0.1M PBS buffer, pH=7.4.

[0099] Buffer B: 0.1M NaCl, 0.1M PBS buffer, pH=7.4, 0.05% Tween-20 (v / v).

[0100] MES buffer: 0.2M 2-(N-morpholine)ethanesulfonic acid, pH=6.

[0101] SSC buffer (5×): 0.75M NaCl, 0.075M sodium citrate, pH=7.

[0102] (III) Preparation of streptavidin-modified invertase

[0103] 2 mg of invertase was dissolved in buffer A to obtain an invertase solution with a final concentration of 20 mg / mL. 100 μL of the invertase solution was reacted with 0.3 mg sulfo-SMCC at room temperature for 1 h, and then washed 8 times with buffer A and an Amicon-50K ultrafiltration centrifuge tube to obtain activated invertase.

[0104] Streptavidin was dissolved in buffer B to obtain a streptavidin solution with a final concentration of 2.5 mg / mL. 100 μL of the streptavidin solution was then reacted with 3 mg of Traut reagent at room temperature for 1 h. Excess Traut reagent was then washed 8 times with buffer A and an Amicon-10K ultrafiltration centrifuge tube. Activated streptavidin was obtained.

[0105] Subsequently, the activated invertase was mixed with activated streptavidin and reacted at room temperature for 2 hours. Finally, the reaction product was washed 8 times using buffer A and an Amicon-100k ultrafiltration centrifuge tube to obtain streptavidin-modified invertase. It was then redispersed in 200 μL of buffer A and stored at 4°C for later use.

[0106] (iv) Immobilize the thrombin capture probe onto the probe carrier

[0107] Take 100 μL of magnetic beads (purchased from New England Biolabs, average diameter 1 μm, 1 mg / mL) dispersed in MES buffer, add 4 mg EDC and 4 mg NHS at room temperature and activate for 30 min, then remove excess EDC and NHS by magnetic separation, and redisperse in 100 μL PBS buffer to obtain activated magnetic bead dispersion.

[0108] Add 5 μL of thrombin capture probe (100 μM) to the activated magnetic bead dispersion and react at 37°C for 12 h to obtain the magnetic bead-thrombin capture probe conjugate (MB-CP). After magnetic separation (place the centrifuge tube on a magnetic rack for 30 s to allow the magnetic beads to be attracted to the bottom by magnetic force, and aspirate the supernatant, the same applies below), wash three times with PBS buffer, and then redisperse in 100 μL of PBS buffer to obtain the MB-CP dispersion, which is stored at 4°C for later use.

[0109] (v) Binding the thrombin nucleic acid aptamer to the probe vector

[0110] 100 μL of MB-CP conjugate dispersion (adjusted to 1 mg / mL before use) was mixed with 5 μL of thrombin nucleic acid aptamer (100 μM) and reacted at room temperature for 2 h to allow the thrombin capture probe and thrombin nucleic acid aptamer to form a double-stranded fragment, yielding the magnetic bead-thrombin capture probe-nucleic acid aptamer conjugate (MB-CP-AP). After magnetic separation, the conjugate was washed three times with PBS buffer and then redispersed in 100 μL of PBS buffer to obtain the MB-CP-AP dispersion, which was stored at 4 °C for later use.

[0111] Example 1

[0112] This embodiment illustrates the use of the signal amplifier provided by the present invention for thrombin detection.

[0113] (i) Take 100 μL of the MB-CP-AP dispersion obtained in Preparation Example 1 (adjusted to 0.5 mg / mL before use) and mix it with 20 μL of thrombin standard solutions of different concentration gradients (concentration gradients set at 0.05 nM, 1 nM, 2 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 80 nM, and 100 nM). Incubate at 37°C for 1 h to allow the double-stranded structure fragment formed by the thrombin capture probe and thrombin nucleic acid aptamer to open, releasing the thrombin nucleic acid aptamer and exposing the thrombin capture probe (i.e., obtaining MB-CP). After the reaction, perform magnetic separation on the product and wash it three times with PBS buffer. After the last wash, remove the washing solution by magnetic separation without adding buffer to obtain MB-CP.

[0114] (ii) Hairpin probes H1 and H2 were heated to 95°C in HEPES buffer solution and reacted for 5 minutes. Then they were slowly cooled (about 1°C / min) to room temperature and kept at room temperature for at least 2 hours to anneal hairpin probes H1 and H2 to form stem-ring structures.

[0115] The helper DNA in Table 1 and the hairpin probes H1 and H2 that form the stem-loop structure were prepared into 1 μM solutions using 5×SSC buffer. 50 μL of each solution was mixed with the MB-CP obtained in step (i) and HCR reaction was carried out at 37 °C for 2 h.

[0116] (iii) After the reaction in step (ii) is completed, the product is magnetically separated and washed three times with PBS buffer to obtain magnetic beads (MB-HCR product) with clean HCR reaction product attached. The product is then redispersed in 100 μL of PBS buffer to obtain MB-HCR product dispersion.

[0117] A. Fluorescence detection

[0118] The MB-HCR product dispersion was fluorescence detected using a fluorescence spectrometer (Shimadzu Corporation, Japan, RF-6000 model). The excitation wavelength was set to 488 nm, the emission wavelength to 500-620 nm, and both the excitation and emission slits were set to 5 nm.

[0119] A standard curve was plotted based on the test results to compare fluorescence concentration with thrombin concentration. See details below. Figure 1 .

[0120] B. Detection of enzyme reaction products

[0121] After fluorescence detection, 40 μL of the streptavidin-modified invertase dispersion obtained in Preparation Example 1 was mixed with the MB-HCR product dispersion and incubated at 37°C for 30 min. This yielded the magnetic bead-HCR product-sucrase enzyme (MB-HCR product-sucrase enzyme). After incubation, the enzyme was magnetically separated and washed three times with PBS (preheated to 37°C before use). The washed MB-HCR product-sucrase enzyme was then redispersed in 50 μL of sucrose solution (1M concentration). After reacting at 55°C with shaking at 300 rpm for 1 h, 5 μL of the reaction product was taken, and the glucose content was measured using a Roche ACCU-CHEK Performa portable blood glucose meter.

[0122] A standard curve was plotted based on the test results, comparing the glucose content and thrombin concentration in the enzyme-catalyzed reaction products. See details below. Figure 2 .

[0123] The same method was used to detect thrombin standard solution, except that sucrose invertase was replaced with horseradish peroxidase and sucrose was replaced with TMB chromogenic substrate solution. The results were similar to those described above when the detection was performed using a UV spectrophotometer.

[0124] Example 2

[0125] This embodiment is used to illustrate the sensitivity and specificity of the signal amplifier provided by the present invention.

[0126] (a) Sensitivity

[0127] Thrombin solutions with concentration gradients of 0.05 nM, 1 nM, 2 nM, 5 nM, 10 nM, 20 nM, 30 nM, 40 nM, 50 nM, 80 nM, and 100 nM were prepared and tested using the method described in Example 1 to investigate the sensitivity of the signal amplifier provided by the present invention.

[0128] The results showed that the detection limit of the signal amplifier provided by the present invention was 2.78 pM in the fluorescence detection method (using a fluorometer) and 9.42 pM in the enzyme-catalyzed reaction product detection method (using a blood glucose meter). The detection limit refers to the lowest final concentration of thrombin in the mixed system in step (i) that the signal amplifier can detect.

[0129] (II) Specificity

[0130] Protein sample solutions with a final concentration of 2 nM were prepared using four control proteins (BSA, IgG, HSA, and trypsin) and were tested according to the method described in Example 1.

[0131] The results showed that only very weak signals were observed when detecting BSA, IgG, HSA, and trypsin sample solutions, with signal intensity essentially the same as that in the blank control experiment. This demonstrates that the signal amplifier provided by this invention possesses extremely high specificity.

[0132] Example 3

[0133] This embodiment is used to illustrate the condition optimization in the thrombin detection method provided by the present invention.

[0134] (i) Reaction concentration of the capture probe

[0135] The 50 nM thrombin standard solution was tested according to the method in Example 1. The difference was that the MB-CP-AP dispersion used in step (i) was prepared according to the method in Preparation Example 1, but the concentration of the thrombin capture probe added to the activated magnetic bead dispersion was adjusted during the preparation process (the amount added was 5 μL in all cases). The effect of the thrombin capture probe concentration on the final detection result during the preparation of the MB-CP-AP dispersion was investigated. The results are shown in Table 2 below.

[0136] Table 2

[0137] Capture probe concentration / mM Fluorescence value (a.u.) Blood glucose meter signal (mM) 0.1 4682.9 13.2 0.5 5767.5 18.5 1 6518.4 22.7 2 7726.5 25.4 5 8295.6 27.5 10 7983.4 26.8

[0138] (II) Reaction time between MB-CP-AP dispersion and target analyte

[0139] The 50 nM thrombin standard solution was tested according to the method in Example 1, except that the reaction time between the MB-CP-AP dispersion and the thrombin standard solution in step (i) was adjusted to investigate the effect of the reaction time on the final detection result. The results are shown in Table 3 below.

[0140] Table 3

[0141] Reaction time / min Fluorescence value (a.u.) Blood glucose meter signal (mM) 15 4532.6 14.5 30 7642.4 23.4 60 8587.2 28.5 90 8368.3 28.1 120 8415.5 27.4

[0142] (III) Reaction concentrations of hairpin probes H1 and H2

[0143] The 50 nM thrombin standard solution was tested according to the method in Example 1, except that the concentrations of hairpin probes H1 and H2 in step (ii) were adjusted (the amount added was kept at 50 μL, and the concentration ratio of hairpin probes H1 and H2 was 1) to investigate the effect of the concentrations of hairpin probes H1 and H2 on the final detection results. The results are shown in Table 4 below (the probe concentration in Table 4 refers to the concentration of one of hairpin probes H1 and H2).

[0144] Table 4

[0145] Probe concentration / mM Fluorescence value (a.u.) Blood glucose meter signal (mM) 0.1 5456.3 19.5 0.2 6893.4 22.6 0.5 7335.2 25.1 1 8382.1 27.6 2 8290.2 27.3

[0146] (iv) Enzyme-catalyzed reaction temperature

[0147] The 50 nM thrombin standard solution was tested according to the method in Example 1, except that the reaction temperature in step (iii) of the enzymatic reaction detection process was adjusted to investigate the effect of the reaction temperature on the final detection result. The results are shown in Table 5 below.

[0148] Table 5

[0149] Reaction temperature / °C Blood glucose meter signal (mM) 25 17.6 30 20.3 35 22.5 40 23.8 45 24.9 50 26.3 55 28.7 60 24.6 65 21.8

[0150] (V) Enzyme-catalyzed reaction time

[0151] The 50 nM thrombin standard solution was tested according to the method in Example 1, except that the reaction time in step (iii) of the enzymatic reaction was adjusted to investigate the effect of the reaction time on the final test result. The results are shown in Table 6 below.

[0152] Table 6

[0153] Reaction time / min Blood glucose meter signal (mM) 5 3.7 10 7.1 15 12.3 20 16.5 25 22.8 30 24.7 35 26.1 40 27.6 45 28.2.

[0154] Example 4

[0155] This embodiment is used to illustrate the effect of using the signal amplifier provided by the present invention for actual sample detection.

[0156] The analysis and verification were performed using actual sample spiked recovery experiments. The specific method is as follows:

[0157] Thrombin was added to human serum samples diluted 10 times to form human serum thrombin solutions with concentrations of 1 nM, 2 nM, and 5 nM, and then tested according to the method described in Example 1.

[0158] The results showed that the spiked recoveries ranged from 96.0% to 107.0%, and the RSDs ranged from 4.1% to 6.5% (n=5). This demonstrates that the signal amplifier provided by this invention has extremely high specificity and exhibits good detection performance in complex biological samples such as human serum, making it suitable for use in practical testing scenarios such as point-of-care testing.

[0159] The preferred embodiments of the present invention have been described in detail above; however, the present invention is not limited thereto. Within the scope of the inventive concept, various simple modifications can be made to the technical solutions of the present invention, including combinations of various technical features in any other suitable manner. These simple modifications and combinations should also be considered as the content disclosed in the present invention and are all within the protection scope of the present invention.

Claims

1. A protein detection signal amplifier, characterized in that, The signal amplifier includes a target protein capture probe, a target protein nucleic acid aptamer, a hairpin probe H1, and a hairpin probe H2; In this embodiment, at least a portion of the sequence in the target protein capture probe is complementary to the target protein nucleic acid aptamer to form a double-stranded DNA fragment, which can be opened in the presence of the target protein; The target protein capture probe also has a sequence that induces hairpin probes H1 and H2 to alternately hybridize and form a long double-stranded structure.

2. The signal amplifier according to claim 1, wherein, The signal amplifier further includes a probe carrier, on which the target protein capture probe is fixed. Preferably, the probe carrier is a micron magnetic bead, and more preferably, the loading of the target protein capture probe on the probe carrier is not less than 5 pmol / mg. And / or, the 3' end of the target protein capture probe has a modification group I for attachment to the probe carrier, preferably the modification group I is an amino group; And / or, the hairpin probe H1 includes segments H1-1 and H1-2, and the hairpin probe H2 includes segments H2-1 and H2-2, wherein segment H1-1 of hairpin probe H1 is complementary to segment H2-1 of hairpin probe H2, and segment H1-2 of hairpin probe H1 is complementary to segment H2-2 of hairpin probe H2; Preferably, the 5' end of the hairpin probe H1 has a modifying group II, and more preferably, the modifying group II is selected from biotin and / or streptavidin; Preferably, the stem-ring structure of the hairpin probe H2 is marked with a fluorescent group and a quenching group corresponding to the fluorescent group; Preferably, the target protein capture probe, hairpin probe H1, and hairpin probe H2 are each stored independently before use; Preferably, the signal amplifier further includes helper DNA, which comprises a first sequence complementary to a portion of the hairpin probe H1 and a second sequence complementary to at least a portion of the target protein capture probe.

3. The signal amplifier according to claim 1 or 2, wherein, The target protein is selected from thrombin; Preferably, the nucleotide sequence of the target protein capture probe is shown in SEQ ID NO:1; Preferably, the nucleotide sequence of the target protein aptamer is shown in SEQ ID NO:2; Preferably, the nucleotide sequence of the hairpin probe H1 is as shown in SEQ ID NO:3; Preferably, the nucleotide sequence of the hairpin probe H2 is shown in SEQ ID NO:4; Preferably, the nucleotide sequence of the helper DNA is shown in SEQ ID NO:

5.

4. A reagent kit for detecting proteins, characterized in that, The kit contains the following: (1) The protein detection signal amplifier as described in any one of claims 1-3; and Optional, (2) enzyme.

5. The kit according to claim 4, wherein, The kit also includes a reagent that provides a modifying group III, which is capable of binding to a modifying group II; Alternatively, the enzyme has a modifying group III that can bind to a modifying group II; And / or, the enzyme is selected from sucrose invertase and / or horseradish peroxidase.

6. The kit according to claim 4 or 5, wherein, The kit further includes (3) buffers, which include: PBS buffer, HEPES buffer, MES buffer, and at least one of buffer A and buffer B, wherein buffer A includes 0.05-0.15M NaCl and 0.05-0.15M PBS buffer, with the remainder being water, and the pH is 7.2-7.5; buffer B includes 0.05-0.15M NaCl, 0.05-0.15M PBS buffer and 0.01-0.1 vol% Tween 20, with the remainder being water, and the pH is 7.2-7.5; And / or, the kit further includes (4) an activator, preferably the activator comprising: (a) 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride and N-hydroxysuccinimide, used to activate the probe carrier so that the target protein capture probe binds to the probe carrier via modification group I; and / or (b) Sodium salt of 4-(N-maleimidemethyl)cyclohexane-1-carboxylic acid sulfonate succinimide ester and 2-iminothione are used to activate sucrose invertase and provide a reagent that provides the modifying group III, so that the modifying group III is bound to the sucrose invertase. And / or, the kit further includes (5) a detection reagent, which is the conversion substrate corresponding to the enzyme, preferably sucrose and / or 3,3',5,5'-tetramethylbenzidine chromogenic substrate solution.

7. A method for detecting a target protein in a sample, characterized in that, The method includes: contacting and reacting the sample with the protein detection signal amplifier according to any one of claims 1-3, and detecting the reaction product using a detection reagent; or, detecting the sample using a kit according to any one of claims 4-6.

8. The method according to claim 7, wherein, The target protein is thrombin; Preferably, the method includes: (i) Provide a probe carrier immobilized with a double-stranded DNA fragment formed by a thrombin capture probe and a thrombin nucleic acid aptamer, and then make a first contact between the probe carrier immobilized with the double-stranded DNA fragment formed by the thrombin capture probe and the thrombin nucleic acid aptamer and a sample. The thrombin in the sample causes the double-stranded structure of the DNA fragment to open and the thrombin nucleic acid aptamer to be released, thereby obtaining a probe carrier immobilized with a thrombin capture probe. (ii) In the presence of helper DNA, the probe carrier immobilized with thrombin capture probe obtained in step (i) is brought into a second contact with hairpin probe H1 and hairpin probe H2. The thrombin capture probe causes hairpin probe H1 and H2 to undergo a hybridization chain reaction, forming a double-stranded long sequence through alternating hybridization. This long sequence is then linked to the thrombin capture probe immobilized on the probe carrier via helper DNA to obtain the second contact product. (iii) Detect the probe carrier immobilized with the hybridization chain reaction product in the second contact product obtained in step (ii).

9. The method according to claim 8, wherein, In step (i), the conditions for the first contact include: temperature 35-40°C and time 0.5-5h; Preferably, in step (i), the thrombin content in the sample is such that the concentration of thrombin in the system during the first contact is not less than 3 pM, and more preferably 10 pM-50 nM. Preferably, in step (i), the amount of probe carrier immobilized with the double-stranded DNA fragment formed by the thrombin capture probe and the thrombin nucleic acid aptamer is such that the concentration of the thrombin capture probe in the first contact system is not less than 0.1 μM, preferably 1-10 μM; And / or, in step (ii), the conditions for the second contact include: 35-40°C for 1-5 hours; Preferably, in step (ii), the amount of hairpin probe H1 used is such that the final concentration of hairpin probe H1 in the second contact system is 0.1-2 μM. Preferably, in the second contact system, the ratio of the number of hairpin probe H1 molecules to the number of thrombin capture probe molecules immobilized on the probe carrier is 1:5-10. Preferably, in step (ii), the amount of hairpin probe H2 used is such that the final concentration of hairpin probe H2 in the second contact system is 0.1-2 μM. More preferably, in the second contact system, the ratio of the number of hairpin probe H2 molecules to the number of thrombin capture probe molecules immobilized on the probe carrier is 1:5-10. More preferably, in step (ii), the final concentration ratio of hairpin probe H1 to hairpin probe H2 in the second contact system is 0.8-1.2:1; Preferably, in step (ii), the amount of helper DNA used is such that the final concentration of helper DNA in the second contact system is 0.1-2 μM. More preferably, in the second contact system, the ratio of the number of helper DNA molecules to the number of thrombin capture probe molecules immobilized on the probe carrier is 1:5-10.

10. The method according to claim 8, wherein, Step (iii) also includes the operation of separating the probe carrier immobilized with the hybridization chain reaction product from the second contact product; And / or, the detection methods include fluorescence detection and / or detection of enzyme-catalyzed reaction products; Preferably, the fluorescence detection method includes: preparing a dispersion of the probe carrier immobilized with the hybridization chain reaction product and detecting the fluorescence value of the dispersion. The preferred fluorescence detection conditions include: excitation wavelength 488 nm and emission wavelength 500-620 nm. Preferably, the method for detecting the enzyme-catalyzed reaction product includes: making a third contact between the isolated probe carrier immobilized with the hybridization chain reaction product and an enzyme with a modification group III, so that the enzyme is linked to the hybridization chain reaction product through the action of modification groups II and III; making a fourth contact between the product of the third contact and the substrate to carry out an enzyme-catalyzed reaction; and then detecting the enzyme-catalyzed reaction product in the obtained fourth contact product.

Images