Csabf2 gene for bud dormancy control in cymbidium and coding sequence and application thereof

Abstract

This invention discloses a gene for controlling the dormancy of Cymbidium orchid buds. CsABF2 Its coding sequence and applications belong to the field of plant molecular biology. This invention discovers that... CsABF2 The highest expression was observed in the stems of Cymbidium goeringii; it was also observed at different flower development stages in Cymbidium goeringii. CsABF2 The expression trend was that the expression level decreased after S1 and gradually increased after S2; in the tissue parts of mature flowers of Cymbidium goeringii, CsABF2 It is expressed most highly in the lip. Heterologous expression in Arabidopsis thaliana. CsABF2 Later, it was discovered that Arabidopsis thaliana exhibited a delayed flowering phenotype. (Silent in Cymbidium orchids) CsABF2 CsABF2 Subsequently, an earlier flowering phenotype may appear. The flowering regulatory gene of Cymbidium goeringii of this invention can be used to study the molecular mechanisms of flower differentiation in orchids and to improve the flowering traits of plants.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant molecular biology, and particularly relates to a Cymbidium hybridum bud dormancy control gene CsABF2 and an encoding sequence thereof and application. BACKGROUND

[0002] As a key plant hormone, abscisic acid (ABA) regulates flower bud dormancy and flowering time through its core signaling pathway and downstream ABF (ABA-responsive element binding factors) transcription factors. ABA signaling starts with the recognition of ABA by the receptor PYR / PYL, which inhibits the activity of PP2C phosphatase, thereby activating SnRK2 kinase. The activated SnRK2 phosphorylates ABF transcription factors (such as ABF1, ABF3 / ABF4, ABI5, etc.) to drive the expression of target genes. ABA plays an important role in plant flower bud dormancy and flowering, and the target points in different species and different development stages are significantly different. For example, ABA down-regulates expansin or cell wall loosening enzyme genes, inhibits cell expansion of floral organs, and delays flower opening. Studies in rice have found that the ABA signaling component SnRK2 kinase SAPK8 can phosphorylate ABF1 to enhance its direct inhibition of FT homologous genes Ehd1 and Ehd2, and ultimately delay flowering. In addition, it is worth noting that ABA is usually induced to express by low temperature to enhance the stress response of plants to low temperature, but under long-term low temperature conditions, the ABA content decreases, promoting the release of dormant flower buds. For example, during the transition from internal dormancy to ecological dormancy of pear tree buds, with the accumulation of low temperature, the expression levels of ABA and ABA biosynthesis genes decrease, and the levels of ABA catabolism genes increase.

[0003] Cymbidium is one of the ten traditional famous flowers in China and is widely welcomed in the domestic and foreign markets. However, Cymbidium needs to go through a 4-6 month flower bud dormancy period from the differentiation of flower buds to the development of flower organs and the opening of flowers. During the dormancy period, a long period of low temperature is needed for normal flowering, otherwise it will cause flower bud abortion. In-depth understanding of the regulatory role of ABF genes in Cymbidium flower bud dormancy and flowering can provide important gene resources for future molecular breeding, flowering trait improvement using gene editing technology, and provide strong technical guidance for efficient growth and rapid flowering of plants. SUMMARY

[0004] In order to overcome the shortcomings and deficiencies of the prior art, the purpose of the present application is to provide a Cymbidium hybridum bud dormancy control gene CsABF2 and an encoding sequence thereof and application.

[0005] The application overcomes the problems of long cycle and difficult to predict traits in traditional hybrid breeding, and realizes the trait improvement of national orchid flowering, and breaks through the key bottleneck problem of requiring flower bud dormancy period for most varieties by using molecular biology means to mine the gene resources applicable to plant flowering trait improvement.

[0006] The purpose of the application is achieved by the following technical solutions:

[0007] The application provides a national orchid flower bud dormancy control gene CsABF2 , which is isolated from the flower bud cDNA of a typical representative of national orchid, Cymbidium hybridum ( Cymbidium sinense ) variety 'Xiaoxiang', has a nucleotide sequence of 1224 bases, and is named CsABF2 .

[0008] The second purpose of the application is to provide a protein encoded by the national orchid flowering regulation gene, which is composed of 407 amino acid residues, and is shown as SEQ ID NO: 2.

[0009] The third purpose of the application is to provide an expression cassette containing the CsABF2 gene, a recombinant plant expression vector, a transformed bacterium or transgenic material.

[0010] The expression vector is any binary vector that can be used for Agrobacterium transformation of plants or a vector that can be used for plant microprojectile attack, such as pTRV vector, pCAMBIA series vector, pBI series vector, pBin series vector or GatewayTM series vector, and the application uses overexpression vector pBI series vector and viral silencing vector pTRV plasmid.

[0011] The starting bacterium of the transformed bacterium is Agrobacterium, preferably Agrobacterium GV3101 and Agrobacterium EHA105.

[0012] The fourth purpose of the application is to provide the CsABF2 gene, the encoded protein, the expression cassette containing the CsABF2 gene, the recombinant plant expression vector, the transformed bacterium or the transgenic material, and the application is one of the following applications:

[0013] (a) application in improving national orchid varieties;

[0014] (b) application in regulating plant flowering time.

[0015] Preferably, overexpression of the CsABF2 gene delays plant flowering, and silencing of the CsABF2 gene advances plant flowering.

[0016] The silencing of the CsABF2The gene is silenced by using a virus-induced gene silencing technique CsABF2 The gene is silenced.

[0017] Preferably, the plant is Arabidopsis thaliana, Cymbidium, etc.

[0018] A fifth object of the present application is to provide a method for delaying flowering of a plant, comprising the step of silencing the gene in Cymbidium by using a virus-induced gene silencing technique. CsABF2 The gene is introduced into a plant cell, tissue or organ, and the transformed plant cell, tissue or organ is cultivated into a plant, so that the gene is expressed in the plant to delay flowering time of the plant. CsABF2 The gene is introduced into a plant cell, tissue or organ, and the transformed plant cell, tissue or organ is cultivated into a plant, so that the gene is expressed in the plant to delay flowering time of the plant. CsABF2 The gene is introduced into a plant cell, tissue or organ by a plant expression vector.

[0019] Preferably, the plant is Arabidopsis thaliana, Cymbidium, etc.

[0020] A sixth object of the present application is to provide a method for advancing flowering of a plant, comprising the step of silencing the gene in Cymbidium by using a virus-induced gene silencing technique to advance flowering time of Cymbidium. CsABF2 The gene is introduced into a plant cell, tissue or organ, and the transformed plant cell, tissue or organ is cultivated into a plant, so that the gene is expressed in the plant to delay flowering time of the plant.

[0021] The present application discloses that overexpression of the Cymbidium flower organ development regulatory gene in Arabidopsis thaliana can change flowering traits and cause flowering delay, and silencing of the gene in Cymbidium can advance flowering.

[0022] The present application has the following advantages and effects relative to the prior art:

[0023] The present application discloses a key flower development gene ABF , which is isolated from flower bud cDNA of the Cymbidium sinense var. CsABF2 'Xiaoxiang' and named CsABF2 . Time-space expression pattern analysis shows that the gene is expressed most highly in Cymbidium sinense stems; in different flower development stages of Cymbidium sinense, CsABF2 the expression trend is down-regulation after S1 and gradual increase after S2; in tissue parts of mature flowers of Cymbidium sinense, CsABF2 the expression is highest in labellum. After heterologous expression of the gene in Arabidopsis thaliana, CsABF2 it is found that Arabidopsis thaliana has a flowering delay phenotype. After silencing of the gene in Cymbidium, CsABF2 an advanced flowering phenotype can be obtained. The Cymbidium flowering regulatory gene of the present application can be used for research on molecular mechanisms of flower differentiation of Orchidaceae plants and improvement of flowering traits of plants. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 In Example 1 of the present application,CsABF2 Gene homologous sequence alignment.

[0025] Figure 2 In Embodiment 1 of the present invention, CsABF2 Phylogenetic analysis of proteins.

[0026] Figure 3 In Embodiment 2 of the present invention, CsABF2 Expression pattern analysis in different organs of *Cymbidium goeringii*; where A: phenotypes of different organs; B: CsABF2 Expression level analysis chart.

[0027] Figure 4 In Embodiment 2 of the present invention, CsABF2 Expression pattern analysis at different flower development stages of Cymbidium goeringii; where A: phenotypes at different flower development stages S1–S5; B: CsABF2 Expression level analysis chart.

[0028] Figure 5 In Embodiment 2 of the present invention, CsABF2 Analysis of expression patterns in different floral tissues of Cymbidium goeringii; where A: phenotypes of different floral tissues; B: CsABF2 Expression level analysis chart.

[0029] Figure 6 In embodiment 3 of the present invention, CsABF2 Screening and Validation of Transgenic Arabidopsis thaliana and Phenotypic Analysis; Note: A: CsABF2 Transgenic Arabidopsis late-flowering phenotype; B: CsABF2 Flowering time of transgenic Arabidopsis thaliana; C: CsABF2 Statistics on rosette leaves of transgenic Arabidopsis thaliana.

[0030] Figure 7 In embodiment 4 of the present invention, CsABF2 Phenotypic diagram of silent strains in Cymbidium goeringii; Note: A: TRV2- gene-silenced plants CsABF2 A: Phenotypes that promote flowering; B: TRV2- gene-silenced plants CsABF2 middle CsABF2 Expression level detection; C: TRV2- gene-silenced plants CsABF2 Statistics on flowering time in [the region / area]. Detailed Implementation

[0031] To make the objectives, technical solutions, and beneficial effects of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the embodiments described in this specification are merely for explaining the invention and are not intended to limit the invention. The parameters, proportions, etc., of the embodiments can be selected according to local conditions without substantially affecting the results.

[0032] Example 1 CsABF2Gene cloning and sequence analysis

[0033] 1. RNA extraction

[0034] Take 2g of flower buds from the Cymbidium goeringii cultivar 'Xiaoxiang', extract total RNA using the "Fastpure Universal Plant Total RNA Isolation Kit", and reverse transcribe it into cDNA (HiScript III 1st Strand cDNASynthesis Kit (+gDNA wiper)).

[0035] 2. Target gene CsABF2 The acquisition

[0036] by CsABF2 -F(SEQ ID NO:3,ATGAACTTCAGGGGCTTCG) and CsABF2 -R (SEQ ID NO: 4, TTACCAGGAAACAGTCTGTGTC) was used as the primer. Using the cDNA obtained in the previous step as a template, PCR was performed using a high-fidelity enzyme (2x PhantaFlashMaster Mix (Dye Plus)) under the following conditions: 95℃ for 30 seconds, then 35 cycles (95℃ for 10 seconds, 58℃ for 5 seconds, 72℃ for 5 seconds), and finally 72℃ for 10 minutes. The PCR product was detected by agarose gel electrophoresis, showing a clear and single band, approximately 1200 bp in size. The target band was excised and recovered, and the recovered product was ligated into a cloning vector (5 min TA / Blunt-Zero Cloning Kit) and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Sequencing analysis revealed that the amplified fragment contained the target gene. CsABF2 The complete CDS sequence, consisting of 1224 bases, is shown in SEQ ID NO: 1, and is named the Cymbidium orchid organ development regulatory gene. CsABF2 Genes, using SnapGene software to... CsABF2 The nucleotide sequence was translated into a protein sequence (as shown in SEQ ID NO: 2), which encodes a protein with an amino acid sequence consisting of 407 amino acid residues, named CsABF2 protein, a protein regulating organ development in Cymbidium goeringii. The obtained protein contains... CsABF2 The Escherichia coli is currently preserved at the Institute of Environmental Horticulture, Guangdong Academy of Agricultural Sciences.

[0037] 3. CsABF2 Gene sequence analysis

[0038] Analysis of the conserved domains of the CsABF2 protein using the Conserved Domain Search function in the NCBI database revealed that CsABF2 possesses a domain unique to the bZIP gene family (Basicleucine zipper (bZIP) domain).

[0039] The CsABF2 gene of Cymbidium goeringii was searched for homologous sequences in NCBI, and the encoded amino acids of the homologous sequences were compared using MEGA software. Figure 1 ), and construct an evolutionary tree ( Figure 2 The results showed that CsABF2 was highly homologous to Cymbidium ensifolium TRAB1-like (Cymbidium ensifolium QEO19181.1), with 98.53% homology. It was also highly homologous to Dendrobium catenatum TRAB1-like (Dendrobium catenatum XP_020696018.1) at 79.26%, to Phalaenopsis equestris ABI5-like (Phalaenopsis equestris XP_020575475.1) at 72.33%, to Apostasia shenzhenica ABI5-like (Apostasia shenzhenica PKA50001.1) at 61.92%, and to Typha angustifolia bZIP46 (Typha angustifolia XP_072978418.1) and Typha latifolia bZIP46. The homology between XP_072995146.1 and oil palm bZIP46 (Elaeis guineensis XP_010943073.1) is 62.59%, and the homology is 62.18%.

[0040] The phylogenetic tree results show that CsABF2 They cluster together with CeTRAB1-like plants, and orchids also cluster together due to close kinship.

[0041] Example 2 CsABF2 Expression patterns in the Mexican

[0042] 1. RNA extraction

[0043] Two g samples were taken from different organs (roots, stems, leaves, flowers, and fruits), different flower development stages (S1-S5), and different tissue parts (sepia, petals, lip, and column) of the Cymbidium goeringii cultivar 'Xiao Xiang'. Total RNA was extracted from these samples using the plant "Fastpure Universal Plant Total RNA Isolation Kit". Two μL of the extracted RNA was reverse transcribed into cDNA using the ThermoScientific RevertAid First Strand cDNASynthesis Kit.

[0044] 2. Quantitative PCR

[0045] Using primers CsABF2 -RT-F (SEQ ID NO: 5, GCGGAGATGACACTCGAGGAG) and CsABF2 -RT-R (SEQ ID NO: 6, TCGAGAAGAAGCCAACGCAT) was used to detect different organs, different flower development stages, and different tissue parts of mature flowers in Cymbidium goeringii. CsABF2 Gene expression levels were detected using real-time quantitative PCR. CsActin -RT-F (SEQ ID NO: 7, CAATGAGCTTCGTGTTGCCC) and CsActin -RT-R (SEQ ID NO: 8, GATACGAACCAGTTGTGCGG) was used as primer, and Actin was amplified as an internal control. The following procedure was followed: pre-denaturation at 95℃ for 30 seconds, followed by 40 cycles (95℃ for 10 seconds, 60℃ for 30 seconds, 95℃ for 15 seconds), and extension at 72℃ for 10 minutes. Amplification was performed using the iCycler IQ Real-time PCR Detection System (Bio-Rad, USA), following the instructions for the Taq Pro Universal SYBR qPCR Master Mix kit.

[0046] 3. Expression Analysis

[0047] The PCR results were analyzed using iCycler real-time detection system software (version 7.0). The results showed... CsABF2 The gene was expressed most highly in different organs of Cymbidium sinense, with the highest expression in the stem, followed by the leaves. Figure 3 ); in different stages of the development of Cymbidium goeringii, CsABF2 Expression levels were downregulated in the early stages of flower development, reaching their lowest level at S2, then gradually increasing, and finally peaking at S5. Figure 4In different floral tissues of Cymbidium goeringii, CsABF2 The highest expression was observed on the labrum, and the lowest expression was observed on the column. Figure 5 ).

[0048] Example 3 Arabidopsis thaliana CsABF2 Gene functional analysis

[0049] 1. Construction of high expression vectors in Arabidopsis thaliana

[0050] The high-expression vector pBI121 plasmid was double-digested with SacI and SmaI enzymes (Takara Bio Engineering (Dalian) Co., Ltd.), and the resulting linear vector was purified. Based on the sequences of the double-digestion sites, a design was developed. CsABF2 Homologous recombination primers that seamlessly connect with pBI121 CsABF2 -pBI121-F (SEQ ID NO: 9, ggactctagaggatccccgggATGAACTTCAGGGGCTTCGTAA) and CsABF2 The target fragment, pBI121-R (SEQ ID NO: 10, cgatcggggaaattcgagctcTTACCAGGAAACAGTCTGTGTCCTC), was recovered and purified. Homologous recombination of the linear vector and the target fragment was performed using the CloneExpress Ultra OneStep Cloning Kit. Sequencing confirmed the plasmid was named pBI121-. CsABF2 .

[0051] 2. Transformation of Arabidopsis thaliana plants

[0052] 2.1 Transformation of Agrobacterium GV3101

[0053] The competent Agrobacterium GV3101 cells were removed from the -80℃ freezer and thawed on ice. After 5 minutes, 1 µL of plasmid pBI121- was added. CsABF2 The culture was incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. Then, 700 μL of antibiotic-free LB broth was added to a clean bench and mixed thoroughly by pipetting. The mixture was then incubated in a shaking incubator at 28°C and 200 rpm. After 2 hours, the culture was collected by centrifugation (5000 rpm, 1 min). The supernatant was removed in a clean bench, and the remaining approximately 100 μL of bacterial culture was spread onto LB solid medium containing 50 mg / L Kan + 25 mg / L Rif antibiotics. The culture was then incubated upside down in a 28°C incubator for 2 days.

[0054] Two days later, single colonies were transferred to LB medium containing 50 mg / L Kan + 25 mg / L Rif antibiotics and incubated at 28°C and 200 rpm for one day. 50 µL of the correct bacterial suspension was then transferred to 50 mL of LB medium containing 50 mg / L Kan + 25 mg / L Rif antibiotics and incubated at 28°C and 200 rpm until the OD value reached 0.8–1. The bacterial suspension was centrifuged at 4°C (5000 rpm, 10 min), the supernatant was discarded, and the bacterial clumps were collected. The clumps were mixed with 5% sucrose solution and resuspended until the OD value reached 0.6–0.7. 0.15% acetylsylphenone (AS) was added, and the suspension was allowed to stand for 2 hours. Finally, 0.02% Silwet-77 was added to prepare for infection.

[0055] 2.2 Transformation of Arabidopsis thaliana by inflorescence infection method

[0056] Before infection, the siliques and open flowers on the plants should be removed. The Arabidopsis inflorescences should be immersed in the Agrobacterium suspension obtained in step 2.1 for 30 seconds, ensuring the suspension fully covers the inflorescence surface. The treated plants should then be placed in a dark environment with a temperature of 23–25°C and high humidity for 16 hours. After treatment, they should be returned to their original conditions for further cultivation. This process should be repeated weekly for the next two weeks, for a total of three infections, to improve transformation efficiency.

[0057] 2.3 Screening of Arabidopsis thaliana transformants

[0058] The T0 generation seeds harvested after three inoculations were collected into centrifuge tubes and dried in a 37°C oven for 7 days. The Arabidopsis seeds were then sown on 1 / 2 MS medium containing 50 mg / L Kan resistance using the method described above. When the seedlings were ready for transplanting, Arabidopsis with green leaves were selected from the medium (only positive plants will show green leaves in the medium containing Kan antibiotic, while false positive plants will have yellow leaves) and transplanted together with wild-type Col-0 under the same culture conditions as described above.

[0059] 3. Phenotypic analysis of transgenic Arabidopsis thaliana

[0060] DNA was extracted from the leaves of the transgenic plant and tested using primers (pBI121-F (SEQ ID NO: 11, GACTCTAGAGGATCCCCGGG)) to verify the correctness of Agrobacterium tumefaciens. CsABF2PCR was performed using pBI121-R (SEQ ID NO: 10, cgatcggggaaattcgagctcTTACCAGGAAACAGTCTGTGTCCTC), with Arabidopsis Col-0 (WT) as a control. The PCR products were added to the wells of a gel for electrophoresis. If a DNA band of the expected size was observed, the plant was identified as a positive plant, indicating that the target DNA fragment had been successfully inserted into the plant genome. Seeds from each positive plant were collected individually and planted in the T2 generation to obtain a stable plant phenotype, denoted as 35S. CsABF2 The flowering time was calculated from sowing to flower opening, and the number of rosette leaves at the time of flowering was recorded. Other phenotypes were also analyzed.

[0061] Research has found that, CsABF2 The flowering time of transgenic Arabidopsis plants was on average 8 days later than that of wild-type plants, and the number of rosette leaves did not change significantly, remaining at around 14 in both cases. CsABF2 ).

[0062] Example 4: In Cymbidium goeringii Figure 6 Gene functional analysis

[0063] 1. Construction of viral silencing vector

[0064] The viral silencing vector pTRV2 plasmid was double-digested with enzymes (BamHI and SmaI, Takara Bio Engineering (Dalian) Co., Ltd.), and the resulting linear vector was purified. Based on the sequence of the double-digestion sites, a design was developed. CsABF2 Homologous recombination primers that are seamlessly linked to pTRV2 CsABF2 -pTRV2-F (SEQ ID NO: 12, agaaggcctccatggggatccCGTTGGTATTGGTGATTCGGTT) and CsABF2 The target fragment, pTRV2-R (SEQ ID NO: 13, gggacatgcccgggcctcgagGTGTAAGCCTGTTTCCTGGCC), was recovered and purified. Homologous recombination of the linear vector and the target fragment was performed using the CloneExpress Ultra One Step Cloning Kit. Sequencing confirmed the plasmid was named pTRV2- CsABF2 .

[0065] 2. Transformation of Cymbidium goeringii plants

[0066] 2.1 Transformation of Agrobacterium EHA105

[0067] The competent cells of Agrobacterium EHA105 were removed from the -80℃ freezer and thawed on ice. After 5 minutes, 1 µL of pTRV2- was added. CsABF2 The plasmids were incubated sequentially on ice for 5 min, in liquid nitrogen for 5 min, in a 37°C water bath for 5 min, and in an ice bath for 5 min. Then, 700 μL of antibiotic-free LB medium was added to a clean bench and mixed thoroughly by pipetting. The mixture was then incubated in a shaking incubator at 28°C and 200 rpm. After 2 hours, the culture was collected by centrifugation (5000 rpm, 1 min). The supernatant was removed in a clean bench, and the remaining approximately 100 μL of bacterial culture was spread onto LB solid medium containing 50 mg / L Kan + 25 mg / L Rif antibiotics. The culture was then incubated upside down at 28°C for 2-3 days. The empty vector pTRV2 and pTRV1 plasmids were then transformed into Agrobacterium using the same method.

[0068] Two days later, single colonies were picked and transferred to LB medium containing 50 mg / L Kan and 25 mg / L Rif antibiotics. The culture was incubated at 28°C and 200 rpm for one day. 50 µL of the correct bacterial culture was then transferred to 50 mL of LB medium containing 50 mg / L Kan antibiotics and incubated at 28°C and 200 rpm until the OD value reached 1. The bacterial culture was centrifuged at 4°C (5000 rpm, 7 min), the supernatant was discarded, and the bacterial clumps were collected. The clumps were then resuspended and diluted to the correct OD value using a buffer containing 10 mM MgCl2, 10 mM MES, and 200 μM acetylsyringone. 600 All are 0.5. The obtained pTRV1, pTRV2, and pTRV2- CsABF2 The infection solutions were mixed in a 1:1 volume ratio to obtain infection solutions pTRV1+pTRV2 and pTRV1+pTRV2-. CsABF2 Let it stand for 2-3 hours before use.

[0069] 2.2 Agrobacterium infection in Cymbidium goeringii

[0070] Randomly selected Cymbidium plants with uniform development, healthy pseudobulb growth, and no pests or diseases were used to gently make small incisions on their pseudobulbs with a blade. The treated plant bulbs were then immersed in the control group (pTRV1+pTRV2) and the experimental group (pTRV1+pTRV2-). CsABF2 Soak the infected plants in Agrobacterium tumefaciens infection solution under vacuum for 5 minutes. Rinse the surface of the infected plants with clean water to remove the bacterial solution, then incubate them in a dark environment at room temperature for 12-16 hours. Finally, return the infected plants to the artificial intelligence climate chamber for normal incubation.

[0071] 2.3 Phenotypic Observation

[0072] Selecting newly grown, normally developing flower buds from the infected plants revealed that pTRV2-CsABF2 The experimental group plants showed obvious early flowering, while the flower buds of the pTRV2 control group flowered later than those of the experimental group. CsABF2 The results indicate that the silencing vector can function normally within Cymbidium plants.

[0073] 2.4 Detection of viral vector silencing effect

[0074] DNA was extracted from the floral organs of gene-silenced plants. Viral vector infection was examined using primers pTRV1-F (SEQ ID No: 14, CGTGTTGCATTTCGATGAA), pTRV1-R (SEQ ID No: 15, GACAACGCCACGATTAAGT), pTRV2-F (SEQ ID No: 16, GGTCAAGGTACGTAGTAGAG), and pTRV2-R (SEQ ID No: 17, TTGCCTTTGTAACCATCATC). Flower buds from the pTRV2 control group were used as a control (denoted as TRV2(-)). PCR products were added to the wells of a gel for electrophoresis. If a DNA band of the expected size was observed, the plant could be identified as a gene-silenced plant (denoted as TRV2-). Figure 7 ). Take TRV2- gene-silenced plants. CsABF2 RNA was extracted from flower organs and primers were used. CsABF2 -RT-F and CsABF2 -RT-R was used to perform real-time quantitative PCR to detect the silencing effect of the recombinant expression vector on CsABF2 expression level in Cymbidium goeringii. The PCR detection method and analysis are as described in Example 2. Cs... CsABF2 -RT-F and Cs Actin -RT-R was used as a primer, and Actin was used as an internal control for amplification.

[0075] Studies have found that gene-silenced plants with TRV2- Actin The flowering time is on average 11.75 days earlier than the wild type. CsABF2 In addition, viral-mediated silencing Figure 7 The expression level in the flower bud lines was significantly downregulated compared to the control group, indicating that... CsABF2 CsABF2 Transcription levels were suppressed, with downregulation levels ranging from 40% to 60%.

[0076] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. CsABF2, a dormancy control protein in Cymbidium orchid buds, is characterized by: Its amino acid sequence is shown in SEQ ID NO:

2.

2. A Cymbidium bud dormancy control gene encoding the Cymbidium bud dormancy control protein CsABF2 as described in claim 1. CsABF2 .

3. The Cymbidium orchid bud dormancy control gene according to claim 2 CsABF2 Its features are: Its nucleotide sequence is shown in SEQ ID NO:

1.

4. The biomaterial related to the Cymbidium goeringii bud dormancy control protein CsABF2 as described in claim 1, characterized in that, It can be any one or more combinations of the following biological materials: (1) Contains the gene described in claim 2 or 3 CsABF2 The expression box; (2) Contains the gene described in claim 2 or 3 CsABF2 Recombinant plant expression vectors; (3) A recombinant plant expression vector containing the expression cassette described in (1); (4) Contains the gene described in claim 2 or 3 CsABF2 Transforming bacteria; (5) Transforming bacteria containing the expression cassette described in (1); (6) Transforming bacteria containing the recombinant plant expression vector described in (2) or (3).

5. The biomaterial according to claim 4, characterized in that: The originating bacteria of the transforming bacteria is Agrobacterium.

6. The Cymbidium orchid bud dormancy control protein CsABF2 as described in claim 1, and the Cymbidium orchid bud dormancy control gene as described in any one of claims 2 to 3. CsABF2 Or the application of the biological material described in any one of claims 4 to 5 in the improvement of Cymbidium varieties.

7. The Cymbidium orchid bud dormancy control protein CsABF2 as described in claim 1, and the Cymbidium orchid bud dormancy control gene as described in any one of claims 2 to 3. CsABF2 Or the application of the biomaterial according to any one of claims 4 to 5 in regulating the flowering time of plants, characterized in that: overexpression CsABF2 After gene insertion, flowering in plants is delayed; silence. CsABF2 After gene modification, plants flower earlier; The plants mentioned are Arabidopsis thaliana and Cymbidium goeringii.

8. The application according to claim 7, characterized in that: The silence CsABF2 The genetic method utilizes virus-induced gene silencing technology. CsABF2 Gene silencing.

9. A method for delaying plant flowering, characterized in that, Includes the step of: taking the gene as described in any one of claims 2 to 3 CsABF2 The transformed plant cells, tissues, or organs are introduced and then cultured into plants, allowing the genes to be transferred. CsABF2 Expressed in plants to delay flowering time; The plants mentioned are Arabidopsis thaliana and Cymbidium goeringii.

10. A method for advancing plant flowering, characterized in that, The steps include: using virus-induced gene silencing technology to silence the gene described in any one of claims 2 to 3 in Cymbidium orchids. CsABF2 By remaining silent, the flowering time of Cymbidium orchids can be brought forward.

Images