Agrocybe cylindracea strain

Abstract

The invention provides an agrocybe cylindracea strain new variety 'Fu tea No.1' (WCS1-9), which is obtained through protoplast mononuclear hybridization by taking 'Zhongshi white tea No.1' with strong disease resistance and pure white mushroom body and 'copper cap mushroom' with strong capability of degrading cellulose and lignin in a matrix as parents, stipe fluff is less, the color is relatively white, pleats are distributed in a breaking and forking manner, the color is relatively light, and the yield is relatively high, so that the agrocybe cylindracea strain new variety 'Fu tea No.1' (WCS1-9) can be obtained through protoplast mononuclear hybridization, and the agrocybe cylindracea strain new variety 'Fu tea No.1'. The fruiting uniformity is good; the method has the characteristics of high yielding ability, high quality, strong disease resistance and the like, the commodity character is excellent, and the method has good production application value.

Description

Technical Field

[0001] This invention relates to the field of edible fungi technology, specifically to a strain of *Agrocybe aegerita*. Background Technology

[0002] Tea tree mushroom ( Agrocybe aegerita (V.Brig.)Singer) is a fungus used for both food and medicine. It contains a variety of amino acids needed by the human body and has special effects such as anti-aging, cholesterol reduction, cancer prevention and anti-cancer.

[0003] Currently, the only commonly used methods for breeding *Agrocybe aegerita* strains are wild domestication and hybridization breeding. The improvement of edible fungi strains in my country, especially hybridization breeding, started late and is at a low level. Existing cultivated varieties cannot meet the needs of rapidly developing production. Therefore, developing new varieties is fundamental to the vigorous development of the edible fungi cultivation industry. In the process of edible fungi breeding, protoplast monokaryotic hybridization is a common method. By hybridizing two monokaryotic strains, the genetic material of the hybrid strains will recombine or exchange. Compared with other breeding methods, this method retains the superior traits of other strains and is not limited by seasonal conditions.

[0004] The nutrients required for the growth and development of edible fungi are mainly provided by the cultivation substrate. The mycelium in the substrate produces extracellular enzymes that break down large-molecule nutrients, ultimately utilizing smaller-molecule nutrients for absorption, transformation, and utilization. Artificially cultivated *Agrocybe aegerita* (tea tree mushroom) often uses cottonseed hulls as the cultivation substrate, which is rich in natural polymers such as cellulose, hemicellulose, lignin, and starch. This substrate can induce the mycelium to produce various extracellular degrading enzymes, including carboxymethyl cellulase, amylase, and laccase. Under the action of these extracellular enzymes, exogenous nutrients are degraded, yielding abundant carbon and nitrogen sources. Extracellular degrading enzymes play a crucial role in the growth and development of *Agrocybe aegerita*. The activity level of these enzymes is critical to the efficiency of nutrient utilization in the cultivation substrate, thus affecting the characteristics and quality of the fruiting bodies.

[0005] Therefore, guided by industry needs, the selection and breeding of *Agrocybe aegerita* strains with genetic stability, high extracellular enzyme activity, short production cycle, strong substrate degradation ability, and excellent commercial characteristics has become the focus and challenge of new strain research. Summary of the Invention

[0006] This invention provides a strain of *Agrocybe aegerita*, which is characterized by high yield, high quality, and strong disease resistance. The fruiting bodies are clustered, white, with hemispherical caps that taper inward after maturity, clear marbled patterns on the cap surface, wavy gills, moderately long and hard stipes with few hairs, a whitish color, and broken, forked gills that are light in color. The fruiting is uniform, with excellent commercial characteristics and good production and application value.

[0007] In a first aspect of the present application, a tea tree mushroom strain named WCS1-9 is provided, wherein an InDel marker of the tea tree mushroom strain is located at 49bp-50bp, and the nucleotide sequence is GG; and / or an InDel marker of the tea tree mushroom strain is located at 124bp-424bp, and the nucleotide sequence is TGTCGGAAACCCTGGGAAAGCCCGATCAGGCCGCTAGCTGATTACAAACGAGGAAGCCTGATTAGACATAATCAAGGGAAAAGCCGGCCTGATCAAGTGGCCAGCAGCTAAACGGTTGTCATAGCGTGGAGTTGGATTAGAAAAACTGTCAGCCCTTTGGCTCAGTGGTTTTGATCGTTAGTAATGGTGTCGGCTACATTACATTAGTTGTAGTCATTATGCTTTTGGTTCGAGTCCCCACCTTGACAATAAATAAACCCCGCCTGATTATTGAAAAAGTTGCCTAATCATCAAAGTTGGGGTTCTAGATCGTGTCTGATCAGCTTCGCCTCTCGGACCGGGCCTGATTAGCCTGATTAGGCTTTGCCAGGGTTTCCGACATTTTAGGTTAACTAGTAGGC; and / or an InDel marker of the tea tree mushroom strain is located at 544bp-554bp, and the nucleotide sequence is CTCCTCTGCCC; and / or an InDel marker of the tea tree mushroom strain is located at 327bp-328bp, and the nucleotide sequence is CT; and / or an InDel marker of the tea tree mushroom strain is located at 330bp-331bp, and the nucleotide sequence is TC; and / or an InDel marker of the tea tree mushroom strain is located at 388bp-390bp, and the nucleotide sequence is CGC; and / or an InDel marker of the tea tree mushroom strain is located at 452bp-475bp, and the nucleotide sequence is ATGTGGATGATGGTAACGGATCGA; and / or an InDel marker of the tea tree mushroom strain is located at 486bp-487bp, and the nucleotide sequence is GG; and / or an InDel marker of the tea tree mushroom strain is located at 124bp-130bp, and the nucleotide sequence is GGTGTGG; and / or the InDel marker of the Agrocybe aegerita strain is located at 296bp-320bp, and the nucleotide sequence is GTGGTGGTGGTGGCGGTGGTCGACG; and / or the InDel marker of the Agrocybe aegerita strain is located at 430bp-516bp, and the nucleotide sequence is GGGAGTGGGCACACGGAGGATGATGTGGATGATGGTAACGGATCGACATCGATGTAGGCGATGGTGGCGATGACGGTTCCCCCTGGG.

[0008] Preferably, the Agrocybe aegerita strain is preserved in the China General Microbiological Culture Collection Center-CGMCC on June 18, 2025, the preservation number is CGMCC NO.42034, and the preservation address is No.3, Yuanmingyuan Road, Beijing, China.

[0009] In a second aspect, the application provides the application of the Agrocybe aegerita strain WCS1-9 in the breeding field as a parent.

[0010] In a third aspect, the application provides the application of the Agrocybe aegerita strain in food processing.

[0011] Compared with the prior art, the Agrocybe aegerita strain provided by the application has at least the following beneficial effects: The new Agrocybe aegerita variety 'Fucha No.1' (WCS1-9) provided by the application takes 'Zhongjunbaitian No.1' (BC1) with strong disease resistance and white mushroom body and 'Tongmaogu' (CS3) with strong ability to degrade cellulose and lignin in the substrate as parents, and is obtained by the method of protoplast mononuclear hybridization. The fruiting body of the excellent hybrid strain 'Fucha No.1' (WCS1-9) is scattered, the cap color is lighter than that of the control, the stem is light yellow and white, hollow, and has less surface fluff, the gill is light brown and wavy, and the above characteristics are obviously different from those of the control. After multiple passages, the production is stable, the characteristic traits are obvious, and good production stability is obtained.

[0012] In summary, the new variety 'Fucha No.1' (WCS1-9) provided by the application has the advantages of high yield, high quality, high uniformity, short mushroom picking time, excellent commodity traits, and the like, and has good production application value. BRIEF DESCRIPTION OF DRAWINGS

[0013] Figure 1 is a photo of the antagonistic (front) test results of the hybrid strain and the parent; Figure 2 is a photo of the antagonistic (back) test results of the hybrid strain and the parent; Figure 3Fig. 1 is a mycelium morphology chart of WCS1-9 and its control strains at different temperatures; Figure 4 Fig. 2 is a fruiting body morphology chart of WCS1-9 and its control strains; Figure 5 Fig. 3 is an InDel-PCR amplification result electrophoretogram of the tea tree mushroom strain WCS1-9. DETAILED DESCRIPTION

[0014] In order to make the objectives, technical solutions and advantages of the present application clearer, further detailed description will be made to the present application by combining with specific embodiments and referring to the drawings.

[0015] Tested strains ‘Zhongjunbaicha No. 1’ (BC1): The strain was provided by Kunming Mushroom Research Institute of China National General Supply and Marketing Cooperative, and the cap of the strain is white tea tree mushroom, and the fruiting body is relatively neat.

[0016] ‘Tongmaoshu’ (CS3): The strain was provided by Jiannian Mushroom Research Institute of Gutian County, and the cap of the strain is gray tea tree mushroom, which is the main variety at present.

[0017] Example 1: Breeding of ‘Fucha No. 1’ WCS1-9 strain The breeding of the new variety ‘Fucha No. 1’ (WCS1-9) specifically includes the following steps: 1.1 Preparation of single nucleus strain Five tea tree mushroom blocks (10 mm in diameter) were inoculated into liquid PDA rich medium, and cultured at 25℃ in the dark for 8 days. The mycelium was collected by four layers of non-woven fabric, washed twice with 0.6 mol / L mannitol solution, and the excess water was absorbed with absorbent paper. 500 mg of mycelium was weighed and placed in a 10 mL centrifuge tube. A 0.22 µm bacterial filter was used to add 5 mL of 1.5% lywallzyme solution (purchased from Beijing Solabio Technology Co., Ltd.) to the centrifuge tube containing the mycelium, shaken, mixed, and enzymolyzed at 30℃ for 2.5 h. The protoplast enzymolysis was observed under a microscope every 30 min. After the enzymolysis was completed, the enzymolysis liquid was filtered into a 10 mL centrifuge tube with four layers of non-woven fabric, and was balanced with 0.6 mol / L mannitol solution. The supernatant was discarded after centrifugation at 4℃ and 876g for 20 min. The precipitate was resuspended in 200 μL of 0.6 mol / L mannitol solution to prepare a protoplast suspension. 10 μL was taken and spread on the regeneration medium, and cultured at 25℃ in the dark for 9 days. On the 9th day, smaller star-shaped colonies were picked and transferred to PDA rich medium, and cultured at 25℃.

[0018] The preparation of the regeneration medium is as follows: 200 g of potato, 20 g of anhydrous glucose, 205.38 g of sucrose, 1 g of maltose, 20 g of agar, and distilled water to 1000 ml, pH natural, sterilized at 115°C for 30 min.

[0019] 1.2 Obtaining mycelium 1.2.1 Monokaryon strain: After the mycelium of the single colony to be picked grows, it is observed under an optical microscope to determine whether it is a monokaryon strain. If there is lock-like combination, it is not a monokaryon strain; otherwise, it is a monokaryon strain. Four generations of culture are used to observe whether lock-like combination occurs to determine the stability of the monokaryon strain.

[0020] The single colonies picked are observed under a microscope. 12 monokaryon strains are obtained from BC1, and 1 monokaryon strain is obtained from CS3. Compared with the preparation of monokaryon strains from protoplasts of BC1, the preparation of monokaryon strains from CS3 is more difficult.

[0021] 1.2.2 Diakaryon hybrid strain: Single-single hybridization is used to hybridize two parent monokaryon strains, which are cultured in a 25°C constant temperature incubator. The area covered by the mycelium of both parent monokaryon strains is transferred to a new culture medium for 3 days of culture. The culture is observed under an optical microscope. If there is lock-like combination, it is a hybrid strain. The hybrid strain is inoculated into PDA rich solid medium and cultured in a 25°C incubator. This operation is performed four times in succession to determine the stability of the hybrid strain. The hybridization of the monokaryon strains of the two parents obtains 10 hybrid strains, which are named WCS1-1, WCS1-2, WCS1-3, WCS1-4, WCS1-5, WCS1-6, WCS1-7, WCS1-8, WCS1-9, and WCS1-10 in sequence.

[0022] Example 2 Antagonistic test Three different strains (parent and hybrid strains) are inoculated on the same PDA rich solid medium with a diameter of 8 mm and cultured in a 25°C constant temperature incubator. The mycelial growth is observed, and the antagonistic phenomenon is observed after about one week. The strength of the antagonistic line is compared and determined.

[0023] The antagonistic experiment of the hybrid strain and the parent is shown in Figure 1 and Figure 2 All hybrid strains have antagonistic lines with the parent. Compared with the parent CS3, the antagonistic lines of all hybrid strains with the parent BC1 are more obvious. Among them, WCS1-9 has very obvious antagonistic lines with the parent CS3 and the parent BC1.

[0024] Example 3 Analysis of properties of new varieties 3.1 Mycelial growth test at different temperatures The mycelial growth at different temperatures was tested, and the results showed that the growth rate of different strains increased first and then decreased with the increase of temperature, and reached the highest at 25°C. Specifically, when the culture temperature was 10°C, the strains were in the germination state, and the cold resistance of BC1 was relatively strong, and there was no significant difference among the other strains; when the culture temperature was 25°C, the growth rate of different strains from high to low was WCS1-9>BC1>CS3>CS2, and the growth rate of WCS1-9 was 11.09±0.13 mm / d, which was higher than that of the control varieties and the main cultivated variety; the mycelium of WCS1-9 showed good roundness, the colony was relatively dense, and the mycelium was white Figure 3 ). When the culture temperature was 30°C, the growth rate of different strains from high to low was WCS1-9>CS3>BC1>CS2, and the heat resistance of WCS1-9 strain was stronger than that of the other strains.

[0025] 3.2 Description of mushroom characteristics The cap morphology and gill distribution morphology of WCS1-9 were the same as those of the main cultivated variety CS2; in terms of cap color, WCS1-9 and CS2 were both dark brown, which gradually became lighter from the middle to the outside; in terms of stem color and hair, the main cultivated variety CS2 was dark brown with the same color on the upper and lower parts and dense hair, and WCS1-9 was light brown with the same color on the upper and lower parts and sparse hair; in terms of stem, the stem of WCS1-9 was white before and after drying, which was significantly different from that of the main cultivated variety CS2; in terms of gill color, WCS1-9 was light brown, and the main cultivated variety CS2 was dark brown, which could be seen from Figure 4 .

[0026] 3.3 Main yield and agronomic performance 3.3.1 Main yield performance: 'Fucha No. 1' WCS1-9 was cultivated for 60 days, the first flush of mushrooms was harvested for 10 days, the average fresh mushroom yield was 158.53 g / bag, the second flush of mushrooms was harvested for 25 days, the average fresh mushroom yield was 195.40 g / bag, and the average fresh mushroom yield of the first two flushes was 353.93 g / bag. Gucha No. 2 (control) was cultivated for 60 days, the first flush of mushrooms was harvested for 11 days, the average fresh mushroom yield was 145.26 g / bag, the second flush of mushrooms was harvested for 25 days, the average fresh mushroom yield was 181.00 g / bag, and the average fresh mushroom yield of the first two flushes was 326.26 g / bag. Compared with the control, 'Fucha No. 1' WCS1-9 had a 1-day shorter first flush of mushrooms and an 8.48% higher yield of the first two flushes (see Table 1). The average cap diameter and thickness of 'Fucha No. 1' WCS1-9 were 34.53 mm and 15.20 mm, respectively, at the time of first flush harvesting, and the average stem length and diameter were 17.42 cm and 9.18 mm, respectively. The average cap diameter and thickness of Gucha No. 2 (control) were 30.79 mm and 11.01 mm, respectively, at the time of harvesting, and the average stem length and diameter were 13.73 cm and 7.39 mm, respectively (see Table 2). Field yield measurement showed that the new variety of 'Fucha No. 1' WCS1-9 had obvious characteristics, high yield, shortened mushrooming period, good commercial traits, and better overall performance than the control variety.

[0027] Table 1 Comparison of field yield

[0028] Table 2 Comparison of field yield measurement of agronomic traits

[0029] 3.3.2 Agronomic trait performance: The third test results of 'Fucha No. 1' (WCS1-9) at the Fuzhou Mushroom Research Institute of Fujian Agriculture and Forestry University showed (see Table 3): 'Fucha No. 1' (WCS1-9) had a cluster type of fruiting body, a small cap, an umbrella shape, and a deep brown color that gradually lightened from the center to the outside; the stem color was light brown, which was significantly different from the main cultivar; the stem had sparse hairs and was completely hollow at the center; the gills were distributed in a broken and forked manner, and the color was lighter than the control, with high mushrooming uniformity.

[0030] Table 3 Agronomic traits of 'Fucha No. 1' (WCS1-9) fruiting body

[0031] Example 4 DNA fingerprint identification of new variety The target new variety is further identified by Indel marker method. The total DNA of Agrocybe aegerita is extracted according to the instruction of Ezup column fungus genomic DNA extraction kit. The total DNA of WCS1-9, BC1 and CS3 is sent to Shengong Bioengineering (Shanghai) Co., Ltd. for whole genome sequencing. The Genome Anlysis Toolkit (GATK) software is used for analysis by using HaplotypeCaller algorithm. The InDel fragment is obtained by comparing the genome sequence information of WCS1-9 with BC1 and CS3 as reference genome. The specific primers for verifying the InDel fragment of WCS1-9 are designed by Primer Premier 5 software at the corresponding site of the reference genome, and the primer sequences are listed in Table 4, and the synthesis is entrusted to Shengong Bioengineering (Shanghai) Co., Ltd. The genomic DNA of WCS1-9, BC1 and CS3 is amplified by InDel-PCR using the specific amplification primers in Table 4.

[0032] The InDel-PCR reaction system is as follows: 1 μL of each of the upstream and downstream primers, 1 μL of DNA template, 12.5 μL of 2×EasyTaq PCR SuperMix (Beijing Quanshi Gold Biotechnology Co., Ltd.), and 9.5 μL of ddH2O.

[0033] The InDel-PCR reaction program is as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 67℃ annealing for 30 s, 72℃ extension for 1 min, 33 cycles, 72℃ extension for 5 min, and 4℃ storage.

[0034] The amplification product is detected by 1% agarose gel electrophoresis at 120V.

[0035] The target fragment is cut off and recovered according to the method provided in the instruction of Gel Extraction Kit D2500 gel recovery kit. The purified DNA sample is sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing.

[0036] Table 4 WCS1-9 InDel fragment amplification primer

[0037] The amplification results of InDel-PCR of Agrocybe aegerita strain WCS1-9 are shown in Table 6. Figure 5 As shown in Table 6, two groups of primers can amplify a single and specific band.

[0038] The sequencing comparison results of WCS1-9, BC1 and CS3 are shown in Table 5.

[0039] After sequencing and alignment of the fragment amplified by No. 1 InDel primer, it was found that WCS1-9 and CS3 sequences have some differences, relative to CS3, WCS1-9 has three InDel sequences with lengths of 2 bp, 301 bp and 10 bp at different sites.

[0040] After sequencing and alignment of the fragment amplified by No. 29 InDel primer, it was found that WCS1-9 and BC1 sequences have some differences, relative to BC1, WCS1-9 has four InDel sequences with lengths of 2 bp, 2 bp, 3 bp, 24 bp and 2 bp at different sites.

[0041] After sequencing and alignment of the fragment amplified by No. 29 InDel primer, it was found that WCS1-9 and CS3 sequences have some differences, relative to CS3, WCS1-9 has three InDel sequences with lengths of 6 bp, 24 bp and 87 bp at different sites.

[0042] Table 5 Difference sequence information of WCS1-9 and BC1, CS3

[0043] In summary, the tea tree mushroom new variety 'Fucha No. 1' (WCS1-9) provided by the application takes 'Zhongjunbaitian No. 1' (BC1) with strong disease resistance and white mushroom body and 'Tongmaogu' (CS3) with strong ability of degrading cellulose and lignin in substrate as parents, and an excellent hybrid strain 'Fucha No. 1' (WCS1-9) is obtained through the method of protoplast mononuclear hybridization. The multiple batch test results of cultivation production test and agronomic trait identification show that when the cultivation period is 60 days, the average yield of 'Fucha No. 1' (WCS1-9) is 366.19 g / bag, the average yield of the control variety is 329.64 g / bag, and the average yield is increased by 11.09%.

[0044] There is no obvious difference in the main nutritional component composition between 'Fucha No. 1' (WCS1-9) and the main cultivar (CS3), the content of crude protein is increased by 31.09% compared with the control, and the production period is shortened by 7-10 days. The fruiting body is scattered, the cap color is lighter than the control, the stipe is light yellow white, hollow, and the surface has less fluff, the gill is light brown and wave-shaped, and the above characteristics are obviously different from the control; after multiple passages, the production is stable, the characteristic traits are obvious, and good production stability is achieved.

[0045] The new variety 'Fucha No. 1' (WCS1-9) provided by the application has the advantages of high yield, high quality, high uniformity, short mushroom picking time and the like, has excellent commodity traits, and has good production application value.

[0046] The above-described specific embodiments further illustrate the purpose, technical solutions and beneficial effects of the present application, and it should be understood that the above-described is only a specific embodiment of the present application and is not intended to limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application should be included in the protection scope of the present application.

Claims

1. A strain of *Agrocybe aegerita*, named WCS1-9, characterized in that, The InDel marker of the *Agrocybe aegerita* strain is located at 49bp-50bp, and the nucleotide sequence is GG. And / or the InDel marker of the tea tree mushroom strain is located at 124bp-424bp, and the nucleotide sequence is TGTCGGAAACCCTGGGAAAGCCCGATCAGGCCGCTAGCTGATTACAAACGAGGAAGCCTGATTAGACATAATCAAGGGAAAAGCCGGCCTGATCAAGTGGCCAGCAGCTAAACGGTTGTCATAGCGTGGAGTTGGATTAGAAAAACTGTCAGCCCTTTGGCTCAGTGGTTTTGATCGTTAGT AATGGTGTCGGCTACATTACATTAGTTGTAGTCATTATGCTTTTGGTTCGAGTCCCCACCTTGACAATAAATAAACCCCGCCTGATTATTGAAAAAGTTGCCTAATCATCAAAGTTGGGGTTCTAGATCGTGTCTGATCAGCTTCGCCTCTCGGACCGGGCCTGATTAGCCTGATTAGGCTTTGCCAGGGTTTCCGACATTTTAGGTTAACTAGTAGGC; And / or the InDel marker of the aforementioned Agrocybe aegerita strain is located at 544bp-554bp, with the nucleotide sequence CTCCTCTGCCC; And / or the InDel marker of the aforementioned *Agrocybe aegerita* strain is located at 327bp-328bp, with a nucleotide sequence of CT; And / or the InDel marker of the aforementioned *Agrocybe aegerita* strain is located at 330bp-331bp, with the nucleotide sequence TC; And / or the InDel marker of the aforementioned Agrocybe aegerita strain is located at 388bp-390bp, and the nucleotide sequence is CGC; And / or the InDel marker of the aforementioned Agrocybe aegerita strain is located at 452bp-475bp, with the nucleotide sequence ATGTGGATGATGGTAACGGATCGA; And / or the InDel marker of the aforementioned *Agrocybe aegerita* strain is located at 486bp-487bp, with a nucleotide sequence of GG; And / or the InDel marker of the aforementioned Agrocybe aegerita strain is located at 124bp-130bp, with the nucleotide sequence GGTGTGG; And / or the InDel marker of the aforementioned Agrocybe aegerita strain is located at 296bp-320bp, with the nucleotide sequence GTGGTGGTGGTGGCGGTGGTCGACG; And / or the InDel marker of the aforementioned *Agrocybe aegerita* strain is located at 430bp-516bp, with the nucleotide sequence GGGAGTGGGCACACGGAGGATGATGTGGATGATGGTAACGGATCGACATCGATGTAGGCGATGGTGGCGATGACGGTTCCCCCTGGG.

2. The *Agrocybe aegerita* strain according to claim 1, characterized in that, The *Agrocybe aegerita* strain was deposited on June 18, 2025, at the China General Microbiological Culture Collection Center (CGMCC), with accession number CGMCCNO.42034, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing.

3. The application of the tea tree mushroom strain WCS1-9 as described in claim 1 or 2 as a parent in the field of breeding.

4. The application of the *Agrocybe aegerita* strain according to claim 1 or 2 in food processing.

Images