Application of rice OsRVED gene in regulating salt stress tolerance of rice

Abstract

The application relates to the field of biotechnology, in particular to application of rice biological clock gene OsRVED in regulation of salt stress tolerance of rice, and provides the rice OsRVED gene as shown in SEQ ID NO. 1, the rice OsRVED gene CDS sequence as shown in SEQ ID NO. 2 and application of the protein as shown in SEQ ID NO. 3 in regulation of salt stress response of plants. The application obtains transgenic rice with OsRVED gene mutation through CRISPR editing technology. After 180mM NaCl simulated salt stress treatment on the transgenic rice OsRVED gene knockout mutant, the survival rate is calculated by observing the phenotype, the osrved mutant is confirmed to present a salt tolerance phenotype compared with the receptor rice No. 11, and it is indicated that OsRVED plays an important role in the process of responding to the salt stress of rice.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, and particularly relates to the application of rice OsRVED gene in regulating salt stress tolerance of rice. BACKGROUND

[0002] Soil salinization is a key factor limiting the sustainable development of global land resources. At present, more than 20% of global irrigated farmland is affected by salt stress, and by 2050, the area of global salinized farmland will increase to 50%, and the land losing productivity due to salinity will reach 2 500-5 000 km 2 Rice is the most salt-sensitive among the three major crops, and 30 mM NaCL will cause a rapid decline in rice yield, and the area of rice planted under salt stress will reach 20% of the total cultivated area, of which Na + is one of the main factors causing salt damage to rice. At present, important progress has been made in the study of plant response to salt stress, and a number of key genes have been identified, such as Na+ / H+ antiporter (OsNHX1 / 2 / 3 / 5) and Na+ efflux transporter (OsHKT2;1 / 2;3 / 2;4 family), but there are still few studies on the relationship between biological clock genes and salt tolerance. Therefore, it is of great significance to further explore the salt tolerance of rice biological clock genes and improve the yield of rice in high-salt rice-growing areas to ensure the safe production of food in high-salt rice-growing areas.

[0003] The plant biological clock system is a key hub for the connection between plants and environmental signals, whether it is external salt signals or internal growth and development processes. The biological clock system plays an important role in both. In-depth exploration of the internal relationship between circadian rhythms and plant response mechanisms is of great significance for plants to respond to unknown external signals and develop reasonable adaptive survival strategies. However, there is still a large gap in our understanding of the rice biological clock system. In particular, whether the components of the biological clock have the ability to simultaneously perceive and process multiple stress signals such as high salt and drought, and how the underlying molecular network supports the adaptive response of rice. In this context, mining and utilizing genes that can confer broad-spectrum resistance to crops undoubtedly opens up a crucial new way to breed new varieties with high yield and strong adaptability for the future.

[0004] The rice salt stress regulatory factor OsRVED involved in this report belongs to one of the early components of the biological clock. This study found that after CRISPR gene editing knockout of OsRVED gene, compared with the receptor rice Zhonghua 11, the osrved knockout mutant showed salt tolerance phenotype after salt stress treatment, proving that OsRVED gene plays an important role in mediating the process of biological clock and rice salt stress. Further research on OsRVED and its downstream regulation of rice salt stress response is of great significance. SUMMARY

[0005] The primary object of the present application is to provide the application of rice OsRVED gene in regulating salt stress tolerance of rice. By knocking out the OsRVED gene in rice plants, it is found that compared with Zhonghua 11, the mutant plants show salt tolerance phenotype after salt stress treatment, that is, the salt stress phenotype of the target plants is successfully changed.

[0006] An object of the present application is to provide a polypeptide, i.e. protein OsRVED, whose amino acid sequence is shown in SEQ ID NO: 3. After knocking out the OsRVED gene, the expression amount of OsRVED protein is greatly reduced, which can make the plant show salt tolerance phenotype.

[0007] Another object of the present application is to provide an oligonucleotide encoding the aforementioned polypeptide, i.e. OsRVED gene, whose nucleotide sequence is shown in SEQ ID NO: 2. After knocking out the OsRVED gene in rice, the expression amount is greatly reduced, which can make the plant show salt tolerance phenotype.

[0008] In order to achieve the above-mentioned objects of the present application, the present application provides the following technical solutions:

[0009] The present application provides the application of rice OsRVED gene in regulating salt stress tolerance of rice, and the nucleotide sequence of the rice OsRVED gene is shown in SEQ ID NO. 1.

[0010] Preferably, the nucleotide sequence of the CDS sequence of the rice OsRVED gene is shown in SEQ ID NO. 2.

[0011] Preferably, the amino acid sequence of the protein encoded by the CDS sequence of the rice OsRVED gene is shown in SEQ ID NO. 3.

[0012] Preferably, the regulation is negative regulation.

[0013] The present application also provides a method for cultivating transgenic rice with improved salt tolerance, which comprises gene editing of the rice OsRVED gene to make it functionally deficient or low expression, thereby improving the salt tolerance of rice.

[0014] Preferably, the gene editing comprises a CRISPR / Cas9 gene editing system.

[0015] Preferably, the CRISPR / Cas9 system comprises an sgRNA vector expressing a target to the rice OsRVED gene.

[0016] Preferably, the target sequence of the sgRNA vector is the nucleotide sequence described in SEQ ID NO. 6.

[0017] Compared with the prior art, the beneficial effects of the present application are as follows:

[0018] The present application proves by experiments that knocking down the OsRVED gene in wild-type rice can obtain transgenic rice with salt stress phenotype changes. Compared with the receptor rice, the expression of the OsRVED gene in the transgenic rice is reduced.

[0019] The present application has important theoretical significance for further elucidating the molecular mechanism of plant regulation of salt stress and cultivating new salt-tolerant crop varieties through genetic engineering. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor on the basis of the provided drawings.

[0021] Figure 1 Figure 4 is a phenotype diagram of wild-type ZH11 and mutant osreved after 180 mM NaCl salt stress treatment.

[0022] Figure 2 Figure 5 is a survival rate statistical diagram of homozygous mutant osreved and wild-type ZH11 three-week-old seedling materials after salt stress recovery.

[0023] Figure 3 Figure 6 is the mutant type of OsRVED gene in ZH11 background obtained by using CRISPR / Cas9 technology, named osreved. DETAILED DESCRIPTION

[0024] The technical solutions provided by the present application will be described in detail below in combination with embodiments, but they should not be understood as limiting the scope of protection of the present application. All raw materials and reagents in the following embodiments are commercially available.

[0025] The experimental material used in the present study is the commonly used japonica rice variety Zhonghua 11 (Zhonghua 11, abbreviated as ZH11).

[0026] The CRISPR / Cas9 vector system used in the following examples is described in the following paper (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu Y-G (2015) A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant 8: 1274-1284) and was kindly provided by the laboratory of Prof. Liu Yaoguang, South China Agricultural University, which is available to the public from South China Agricultural University for use in repeating the experiments of this application and not for other purposes.

[0027] The Agrobacterium EHA105 competent cells used in the following examples were made by the laboratory itself and can also be purchased on the market.

[0028] Nutrient solution Murashige B formula: 5:5:1:1 ratio of A stock solution, B stock solution, EDTA-Fe stock solution and trace element stock solution per liter of nutrient solution. Among them, 1 L (200X) of A stock solution contains (NH4)2SO49.64 g, KNO33.7 g, KH2PO44.96 g, K2SO43.18 g and MgSO4·7H2O 29.965 g; 1 L (200X) of B stock solution contains Ca(NO3)2·4H2O 17.235 g; 1 L (1000X) of EDTA-Fe stock solution: first dissolve 5.57 g of FeSO4·7H2O in 200 mL of distilled water, then heat and dissolve 7.45 g of Na2EDTA in 200 mL of distilled water, continuously stir and mix the FeSO4·7H2O solution and Na2EDTA solution, and then cool and dilute to 1 L. 1 L (1000X) of trace element stock solution contains: H3BO42.86 g, CuSO4·H2O 0.08 g, ZnSO4·7H2O 0.22 g, MnCl2·4H2O 1.81 g and NaMO4·H2O 0.09 g. Add 300 ng of sodium silicate per liter of nutrient solution, and then adjust the pH to 6.0 with concentrated hydrochloric acid.

[0029] The rice seedling material culture method used in the following examples of the present application is as follows: select well-developed and plump seeds, soak in distilled water in a 37℃ incubator for 48 hours, and change the water every 12 hours, then wrap with a wet cloth and continue to germinate for 12 hours. Select seeds with consistent germination and place them in a 96-well plate without a bottom, and place them in a culture box containing Kimura B nutrient solution for growth. The greenhouse growth conditions are 10 hours of light / 14 hours of darkness, and the temperature is 30℃. Change the fresh rice nutrient solution every 3 days during the culture.

[0030] Example 1: Cloning of rice salt stress response gene OsRVED

[0031] The present application isolates and clones a salt stress response rice gene OsRVED from rice variety Zhonghua No. 11, as shown in SEQ ID NO 1, and names the encoded protein OsRVED protein, as shown in SEQ ID NO 3.

[0032] Total RNA of rice variety Zhonghua No. 11 is extracted and reverse transcribed into cDNA, and PCR amplification is carried out with primers F (as shown in SEQ ID NO 4): ATGGCGGCAATGGCG and R (as shown in SEQ ID NO 5): TTAAGCAGATAGATTAGCTTCGAGATTCT. The amplification system is: KOD enzyme 1 μL, 2×KOD buffer 25 μL, dNTPs 10 μL, primers F and R each 1 ul, ZH11 cDNA 1 μg, ddH2O to 50 μL, all components are mixed uniformly, and placed in a PCR instrument, the reaction program is: 94℃ pre-denaturation 2min; 94℃ denaturation 30s, 54℃ annealing 30s, 72℃ extension 30s, 35 cycles; 72℃ extension 5min. The PCR product is detected by 1% agarose gel, the target band is about 800bp, and finally Sanger sequencing is carried out. The sequencing result shows that the nucleotide sequence of the PCR amplification product is as shown in SEQ ID NO 1, the coding sequence is the 1-882th nucleotide of SEQ ID NO 2, and the encoded protein OsRVED (the 1-293th amino acid of SEQ ID NO 3) is as shown in SEQ ID NO 3. The DNA as shown in SEQ ID NO 1 is named as OsRVED gene.

[0033] SEQ ID NO:1

[0034] Genomic nucleotide sequence of OsRVED gene

[0035]

[0036] SEQ ID NO: 2

[0037] OsRVED gene CDS sequence

[0038] ATGGCGGCAATGGCGGCGGCGGCGGCGGGGACGAAGAAGAAGGCGAGGAAGCCGTACACGATCACGAGGCCGCGGGAGAGGTGGTCCGCCGAGGAGCACGAGCGCTTCCTTGACGCCCTGATTCTGTTCGGCCGTGACTGGAAGAGGATCGAAGCGTTCGTCGCCACCAAGACGGCCATCCAGGTAGGCCATCGATTGATCGATTTGTCCCTCTGCAAGATCATCAATGGCGGCTTCAGAATCCAAGATCGAGTTCGTTTCTTGGATTTTTTTTTTCACTTTTGCTTGCAAGCCCTGATCGATTTGCCATGGTCAATTATCCAGATTCGCAGCCATGCCCAGAAGCATTTTCTGAAGGCCCGCAAGTTCGGCCTCGCCGGTGGGCTCCCGCCGCCGCTTCACCCTCGCCGTGCCACGCTGCTCCGGGCCAACGCCGCGGCGGCGGACATGATGCCGCCCCCGTGGCTGCCATCGGCCGGCGGCGGCTCCATCGGTTGCTCGGCGCCACCGTCCGGCGTGCAGCAGAGCATGGCCGGCAGGTCGCCGGCGTGCTACTCAACTGATGAAGCTTCTTTCCGGCCATTGATTCATAGCAATGACAATGACTGTTCATTCATCGAGACACCAAGCTGCATCGGATCAGGTGGCGAATCATGGATCGGTGATGATGCCTTCTTCATGCAGGATGAAACAATTCGGCTCCCAATTTCTCCAGATGACCTGGGATTCGCTCAGGTGTACAAGTTCGTCGGCGACATGTTCGGCTCCGGCGAGCGGCGGCCGGTGGAGGCTCACCTGCGGAGGCTGCAGGGCATGGACCCTGCCATCTCGGAGACGATCTTGCTGGTGCTTAAGAATCTCGAAGCTAATCTATCTGCTTAA.

[0039] SEQ ID NO:3

[0040] OsRVED protein amino acid sequence

[0041] MAAMAAAAAGTKKKARKPYTITRPRERWSAEEHERFLDALILFGRDWKRIEAFVATKTAIQVGHRLIDLSLCKIINGGFRIQDRVRFLDFFFHFCLQALIDLPWSIIQIRSHAQKHFLKARKFGLAGGLPPPLHPRRATLLRANAAAADMMPPPWLPSAGGGSIGCSAPPSGVQQSMAGRSPACYSTDEASFRPLIHSNDNDCSFIETPSCIGSGGESWIGDDAFFMQDETIRLPISPDDLGFAQVYKFVGDMFGSGERRPVEAHLRRLQGMDPAISETILLVLKNLEANLSA*.

[0042] Construction of OsRVED deletion mutant rice of Example 2

[0043] (1) Construction of vector and recombinant bacteria

[0044] The DNA sequence shown in SEQ ID NO 1 was used to screen suitable target points on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html). In combination with the score and target position, TCCTTGACGCCCTGATTCTGTGAG (the nucleotide sequence shown in SEQ ID NO 6) located on the first exon of the OsRVED gene genomic nucleotide sequence was selected as one of the CRISPR / Cas9 target points. The pCRISPR / Cas9 plasmid construction was performed according to the literature (Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu Y-G (2015) A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Mol Plant 8: 1274-1284), and the vector pCRISPR / Cas9-OsRVED was finally obtained. The plasmid pCRISPR / Cas9-OsRVED was first transformed into E. coli DH5α, and Sanger sequencing was correct, and then transformed into Agrobacterium EHA105 competent cells to obtain the recombinant Agrobacterium pCRISPR / Cas9-OsRVED.

[0045] (2) Transformation of pCRISPR / Cas9-OsRVED into rice

[0046] The genetic transformation of rice was completed by Wuhan Boyuan Biotechnology Co., Ltd., and the T0 generation transgenic line of CRISPR / Cas9-OsRVED in the ZH11 background, i.e., the rice osrved mutant T0 generation, was obtained.

[0047] Example 3 Identification of transgenic rice CRISPR / Cas9-OsRVED T0 generation plants

[0048] The leaf of the T0 generation of the rice OsRVED mutant was extracted to extract DNA, and the extracted DNA was used as a template to perform PCR amplification with specific primers of the OsRVED gene, and the primer sequences were F (as shown in SEQ ID NO 7): GGCGGGGACGAAGAAGAA; R (as shown in SEQ ID NO 8): GCAAAAGTGAAAAAAAAAATCC. The amplification system is: KOD enzyme 1 μL, 2×KOD buffer 25 μL, dNTPs 10 μL, primers F and R each 1 μl, ZH11 cDNA 1 μg, ddH2O supplement 50 μL, all components are mixed uniformly, and placed in a PCR instrument, and the reaction program is: the PCR reaction program is: 94°C pre-denaturation 2 min; 94°C denaturation for 30 s, 54°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 5 min. The PCR product is subjected to Sanger sequencing to check whether the mutation occurs at the target position.

[0049] The leaf DNA is extracted according to the CTAB method: the rice leaf of about 3 cm is placed into a 2.0 mL centrifuge tube, and a steel ball is used to grind into powder. 500 μL of CTAB extraction solution is added to the centrifuge tube, and shaken and mixed. An equal volume of chloroform and phenol (1:1) mixed liquid is added, shaken and mixed, and centrifuged at 12000 rpm for 10 min. 200 μL of supernatant is taken, an equal volume of chloroform is added, and shaken and mixed, and centrifuged at 12000 rpm for 10 min. 100 μL of supernatant is taken, and two times the volume of anhydrous ethanol is added to precipitate at -20°C for 30 min. 4°C, 12000 rpm, centrifugation for 10 min. Remove the supernatant, wash twice with 500 μL of 75% ethanol, blow dry, and then add 30 μL of ddH2O to dissolve.

[0050] The identification results show that one independent transgenic plant with mutation of the OsRVED gene is finally identified, and the mutation site is as shown in Figure 3 The OsRVED gene is increased by 1 bp, which causes a frame mutation of the OsRVED gene, resulting in loss of function.

[0051] Example 4: Salt tolerance analysis of OsRVED mutant plants

[0052] Similarly, according to the above culture conditions, the wild type ZH11 and osrved mutant material were grown for three weeks, and then subjected to 180 mM NaCl stress treatment. After 14 days of treatment and 14 days of recovery, the materials were photographed as shown in Figure 1The photographs were taken (firstly before treatment, 180 mM NaCl was added into the nutrient solution during treatment, the photographs were taken after 14 days of treatment, then normal nutrient solution without salt was added during recovery, the photographs were taken after 14 days of recovery), wherein Figure 1 osrved represents OsRVED gene mutant strain, and ZH11 represents wild type Zhonghua No. 11. After 14 days of recovery treatment, the survival rates of ZH11 and osrved were counted, as shown in Figure 2 The survival rate of ZH11 is about 10%, while the survival rate of osrved is about 35%, which indicates that the loss of function of OsRVED leads to more tolerance of plants to salt stress. It can be seen that OsRVED plays a negative regulatory role in the process of plant response to salt stress.

[0053] The above merely describes the preferred embodiments of the present application, and it should be noted that, for those skilled in the art, some improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.

Claims

1. The application of the rice OsRVED gene in regulating rice salt stress tolerance, characterized in that, The nucleotide sequence of the rice OsRVED gene is shown in SEQ ID NO.1; The regulation involves gene editing of the rice OsRVED gene to render it non-functional, thereby improving the rice's salt tolerance.

2. The application according to claim 1, characterized in that, The nucleotide sequence of the CDS sequence of the rice OsRVED gene is shown in SEQ ID NO.

2.

3. The application according to claim 2, characterized in that, The amino acid sequence of the protein encoded by the CDS sequence of the rice OsRVED gene is shown in SEQ ID NO.

3.

4. A method for cultivating transgenic rice with enhanced salt tolerance, characterized in that, The method involves gene editing of the rice OsRVED gene as described in claim 1 to render it functionally deficient, thereby improving the rice's salt tolerance.

5. The method according to claim 4, characterized in that, The gene editing includes the CRISPR / Cas9 gene editing system.

6. The method according to claim 5, characterized in that, The CRISPR / Cas9 system includes an sgRNA vector that expresses a gene targeting the rice OsRVED gene.

7. The method according to claim 6, characterized in that, The target sequence of the sgRNA vector is the nucleotide sequence described in SEQ ID NO. 6.

Images