Molecular marker, primer group and kit for identifying improved variety Jiangxing 48 of camellia oleifera and application of molecular marker, primer group and kit

Abstract

The invention discloses a molecular marker, a primer group and a kit for identifying an improved variety Jiangxing 48 of camellia oleifera and application of the molecular marker, the primer group and the kit. The primer group comprises primer F: 5 '-CTCGGCCTCCGTGATTAT-3', primer F: 5 '-CTCGGCCTCCGTGATTAT-3', primer F: 5 '- According to the method, the 'Jixing 48' is identified by directly measuring the est-SSR25 marker of the 'Jixing 48', the uncertainty of the identification of the 'Jixing 48' by external morphological characteristics is overcome, the operation is simple, the detection efficiency is high, the result is reliable and visual, a scientific technical guarantee is provided for the identification of the oil tea improved variety 'Jixing 48', and the method is beneficial to the popularization and protection of the improved variety.

Description

Technical Field

[0001] This invention relates to the fields of identification of varietal resources and innovation of germplasm in bio-agriculture, specifically to a molecular marker, primer set, reagent kit, and application for identifying the superior Camellia oleifera variety 'Ganxing 48'. Background Technology

[0002] Camellia oleifera is a unique woody oilseed tree species in my country, integrating ecological, economic, and social benefits. With a cultivation history of 2300 years, it is considered one of the world's "four major woody oilseed plants," along with olive, oil palm, and coconut. Camellia oil is highly nutritious, with an unsaturated fatty acid content as high as 90%, and is rich in squalene, tocopherol, and other trace substances beneficial to human health. It possesses various medicinal properties and can effectively prevent various cardiovascular diseases such as hypertension, hyperlipidemia, and coronary heart disease. It is popularly known as "health oil," "longevity oil," and "postpartum oil," and is recognized worldwide as one of the healthiest edible oils.

[0003] Camellia oleifera, a unique woody oilseed tree species in my country, possesses the unique advantages and development potential of not competing with farmland or people for food. Making full use of barren hills and wastelands for Camellia oleifera planting, strengthening the transformation of existing low-yield and inefficient Camellia oleifera forests, and significantly increasing camellia oil production can effectively alleviate the contradiction between oilseed supply and demand and import pressure, enhance my country's food security capacity, and is an important measure to ensure national food and oil security.

[0004] Currently, most newly planted camellia oleifera forests are of the main varieties recommended by the state. However, the phenotypic differences among the main camellia oleifera varieties are small, making it difficult to effectively identify and distinguish them based on phenotypic alone. This poses challenges to variety identification and protection management. Therefore, it is necessary to conduct variety identification research on the existing main cultivated camellia oleifera varieties as soon as possible and develop a set of rapid technical measures for variety testing, which can better solve this problem in production.

[0005] Microsatellites (SSRs), as codominant molecular markers, are stable and efficient, enabling rapid and accurate analysis of allele segregation. They are one of the important molecular markers in molecular biology research and are often used in research such as forest tree germplasm identification.

[0006] 'Ganxing 48' is a high-quality camellia oleifera variety that has been promoted and applied in production. It has the characteristics of high oil content and strong resistance. However, it is difficult to distinguish the authenticity of the variety by its morphological characteristics during the seedling stage, which makes it difficult to effectively identify and supervise the variety. This has brought difficulties to the promotion of the variety. Therefore, it is necessary to find a fast, convenient and effective identification method. Summary of the Invention

[0007] The first objective of this invention is to provide an SSR molecular marker for identifying the superior Camellia oleifera variety 'Ganxing 48', wherein the repeating motif of the SSR molecular marker is (GCGGAG)n, where n≥1, the right-hand sequence is shown in SEQ ID NO.7, and the left-hand sequence is shown in SEQ ID NO.8.

[0008] The second objective of this invention is to provide an SSR primer set for identifying the superior Camellia oleifera variety 'Ganxing 48', wherein the SSR primer set comprises:

[0009] primer_F: 5'-CTCGGCTCCGTGATTAT-3';

[0010] primer_R: 5'-CTCTTTCCCTCCAACCTTC-3'.

[0011] The third objective of this invention is to provide a rapid detection kit for identifying the superior Camellia oleifera variety 'Ganxing 48', which includes the aforementioned SSR primer set.

[0012] The fourth objective of this invention is to provide the application of the above-mentioned SSR primer set or the above-mentioned rapid detection kit in the identification of the superior Camellia oleifera variety 'Ganxing 48'.

[0013] The fifth objective of this invention is to provide a method for identifying a superior Camellia oleifera variety, 'Ganxing 48', comprising the following steps:

[0014] (1) Extract genomic DNA from the camellia oil sample to be tested;

[0015] (2) Using the genomic DNA extracted in step (1) as a template, PCR amplification was performed using the above-mentioned SSR primer set;

[0016] (3) The PCR amplification products in step (2) are genotyped and the genotype results are banded. If the PCR amplification products have four specific bands of 161bp, 167bp, 179bp and 185bp, it indicates that the camellia oil sample to be tested is 'Ganxing 48'. Otherwise, it indicates that the camellia oil sample to be tested is not 'Ganxing 48'.

[0017] Preferably, the 161bp sequence is shown in SEQ ID NO.3, the 167bp sequence is shown in SEQ ID NO.4, the 179bp sequence is shown in SEQ ID NO.5, and the 185bp sequence is shown in SEQ ID NO.6.

[0018] Preferably, the PCR reaction system is as follows: 10×buffer 1 μL, dNTP (2.5 mM) 1.2 μL, MgCl2 (25 mM) 0.6 μL, primer (1 μM) 1 μL, HotTaq 5 U / μL 0.07 μL, sample DNA 1 μL, ddH2O 5.13 μL, total volume 10 μL.

[0019] Preferably, the PCR reaction program is as follows: 95℃ for 2 min; denaturation at 95℃ for 20 s, annealing at 63℃~57.5℃ for 40 s, extension at 72℃ for 1 min, 11 cycles, with the temperature decreasing by 0.5℃ in each cycle; denaturation at 95℃ for 20 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min, 24 cycles; holding at 72℃ for 2 min; and storing the reaction product at 4℃.

[0020] The sixth objective of this invention is to provide the application of the above-described method in the rapid identification of the superior Camellia oleifera variety 'Ganxing 48'.

[0021] Advantages of this invention:

[0022] This invention identifies 'Ganxing 48' by directly measuring the est-SSR25 marker, overcoming the uncertainty of identification based on external morphological characteristics. It is simple to operate, highly efficient, and provides reliable and intuitive results, offering scientific and technical support for the identification of the superior camellia oleifera variety 'Ganxing 48'. This invention is beneficial for the promotion and protection of this superior variety. Attached Figure Description

[0023] Figure 1 This is the amplification and typing diagram of Camellia oleifera varieties S1-S30.

[0024] Figure 2 This is the amplification and typing diagram of Camellia oleifera varieties S31-S60.

[0025] Figure 3 This is the amplification and typing diagram of Camellia oleifera varieties S61-S90.

[0026] Figure 4 This is the amplification and typing diagram of Camellia oleifera varieties S91-S109.

[0027] In the figure, S1-S109 represent the names of Camellia oleifera varieties (see Table 1). The horizontal axis represents the number of motifs, i.e., 0-8 indicates the number of motifs of the SSR amplified by the Camellia oleifera variety under this SSR primer. The vertical axis represents the density. The motif of this SSR is (GCGGAG), where the fragment size at position 0 is 155bp, 1 indicates that the fragment contains 1 SSR motif with a fragment size of 161bp (155+6), 2 indicates that the fragment contains 2 SSR motifs with a fragment size of 167bp (155+12), and so on. Detailed Implementation

[0028] The following embodiments are further illustrations of the present invention, but not limitations thereof.

[0029] Example 1:

[0030] 300 pairs of SSR primer sequences were developed from Camellia oleifera transcriptome data. Primers with clear SSR electrophoresis bands were selected from these primers. SSR-Seq technology was then used to detect SSR sites in Camellia oleifera varieties. The marker est-SSR25 (primer_F: 5'-CTCGGCCTCCGTGATTAT-3', primer_R: 5'-CTCTTTCCCTCCAACCTTC-3') was selected, which can amplify four specific bands for the superior Camellia oleifera variety 'Ganxing 48'. The band sizes are 161bp, 167bp, 179bp and 185bp, respectively, and can be used for rapid identification and detection of the superior Camellia oleifera variety 'Ganxing 48'.

[0031] Among them, 161bp is: CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCT CCAGCTCTTCGGTCTGGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTG ATCAATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGAAGGTTGGAGGGAAAGAG (SEQ ID NO. 3);

[0032] 167bp is: CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCA GCTCTTCGGTCTGGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATC AATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGCGGAGGAAGGTTGGAGGGAAAG AG (SEQ ID NO. 4);

[0033] 179 bp is: CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCA GCTCTTCGGTCTGGAGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATC AATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGCGGAGGCGGAGGCGGAGGAAG GTTGGAGGGAAAGAG (SEQ ID NO.5);

[0034] 185 bp is: CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCA GCTCTTCGGTCTGGAGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATC AATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGCGGAGGCGGAGGCGGAGGCG GAGGAAGGTTGGAGGGAAAGAG (SEQ ID NO.6).

[0035] est-SSR25 (primer_F: 5'-CTCGGCCTCCGTGATTAT-3', primer_R: 5'-CTCTTTCCCTCCAACCTTC-3') was further validated using 109 Camellia oleifera varieties (Table 1). Complete, uncontaminated genomic DNA was extracted from the 109 Camellia oleifera varieties using a kit (TIANG EN, catalog number: DP360), and the genomic DNA was diluted to 20 ng / μL. The target region was amplified by multiplex PCR. The total reaction system for the sample multiplex PCR was as follows: 10×buffer (TaKaRa, catalog number: R007WZ) 1 μL, dNTP (2.5 mM) 1.2 μL, MgCl2 (25 mM) 0.6 μL, primer (1 μM) 1 μL, HotTaq 5 U / μL (Takara, catalog number: R007WZ) 0.07 μL, sample DNA 1 μL, ddH2O 5.13 μL, total volume 10 μL. The PCR program was as follows: 95℃ for 2 min; denaturation at 95℃ for 20 s, annealing at 63℃~57.5℃ (temperature decreased by 0.5℃ per cycle) for 40 s, extension at 72℃ for 1 min, 11 cycles; denaturation at 95℃ for 20 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min, 24 cycles; hold at 72℃ for 2 min; the reaction products were stored at 4℃. After equal mixing of the PCR products, tag sequences were added, and after quantitative mixing of the sample library, next-generation sequencing was performed. The motif (SSR core unit) of each read was identified based on the sequencing data, and the number of reads corresponding to different repeat numbers of the motif was counted. Based on the read count information, the geom_density tool of ggplot was used to plot the density distribution. The results are shown in Table 1 and... Figure 1-4 As shown, 'Ganxing 48' (S56) amplified four specific bands with sizes of 161bp, 167bp, 179bp and 185bp, respectively, while other varieties did not show this result.

[0036] Table 1

[0037]

[0038]

[0039]

[0040]

[0041]

[0042] This invention identifies 'Ganxing 48' by directly measuring the est-SSR25 marker, overcoming the uncertainty of identification based on external morphological characteristics. It is simple to operate, highly efficient, and provides reliable and intuitive results, offering scientific and technical support for the identification of the superior camellia oleifera variety 'Ganxing 48'. This invention is beneficial for the promotion and protection of this superior variety.

[0043] References introducing SSR-Seq technology and its applications:

[0044] 1.Sarhanova P, Pfanzelt S, Brandt R, et al., SSR-seq: Genotyping of microsatellites usi ng next-generation sequencing reveals higher level of polymorphism as compared to traditio nal fragment sizescoring.Ecol.Evol.2018,8,10817–10833.

[0045] 2. Yang J, Zhang J, Han R, et al., Target SSR-Seq: A Novel SSR GenotypingTechnolgy Associate with Perfect SSRs in Genetic Analysis of CucumberVarieties. Front.Plant.Sci.2019,10,531.

[0046] 3.Cui l.Resources.2021,22,199-211.DOI:10.1111 / 1755-0998.13469.

[0047] 4.Li X,Wang J,Qiu Y,et al.SSR-Sequencing Reveals the Inter-andIntraspecific Genet ic Variation and Phylogenetic Relationships among anExtensive Collection of Radish(Raph anus)Germplasm Resources,Biology 2021,10,1250.https: / / doi.org / 10.3390 / biology10121250.SEQ ID NO.1

[0048] CTCGGCCTCCGTGATTATSEQ ID NO.2

[0049] CTCTTTCCCTCCAACCTTCSEQ ID NO.3

[0050] CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCAGCTCTTCGGTCTGGAGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATCAATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGAAGGTTGGAGGGAAAGAGSEQ ID NO.4

[0051] CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCAGCTCTTCGGTCTGGAGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATCAATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGCGGAGGAAGGTTGGAGGGAAAGAGSEQ ID NO.5

[0052] CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCAGCTCTTCGGTCTGGAGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATCAATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGCGGAGGCGGAGGCGGAGGAAGGTTGGAGGGAAAGAGSEQ ID NO.6

[0053] CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCAGCTCTTCGGTCTGGAGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATCAATTGAGGCGGAGGAGCGGAGGTGGAGGCGGAGGCGGAGGCGGAGGCGGAGGCGGAGGAAGGTTGGAGGGAAAGAGSEQ ID NO.7

[0054] CTCGGCCTCCGTGATTATGCGATCGCGACATTCGCGCTCGAATTTCTCCAGCTCTTCGGTCTGGAGAGAAGAAAAGTTGAAGACTTTGTCTTCGTCGTCGTTAGTGATCAATTGAGGCGGAGGAGCGGAGGTGGAGSEQ IDNO.8

[0055] GAAGGTTGGAGGGAAAGAG

Claims

1. An SSR molecular marker for identifying the superior Camellia oleifera variety 'Ganxing 48', characterized in that, The repeating motif of the SSR molecular marker is (GCGGAG)n, where n≥1, and its right-hand sequence is shown in SEQ ID NO.7, and its left-hand sequence is shown in SEQ ID NO.

8.

2. An SSR primer set for identifying the superior Camellia oleifera variety 'Ganxing 48', characterized in that, The SSR primer set includes: primer_F: 5'-CTCGGCTCCGTGATTAT-3'; primer_R: 5'-CTCTTTCCCTCCAACCTTC-3'.

3. A rapid detection kit for identifying the superior Camellia oleifera variety 'Ganxing 48', characterized in that, Includes the SSR primer set as described in claim 1.

4. The application of the SSR primer set according to claim 2 or the rapid detection kit according to claim 3 in the identification of the superior Camellia oleifera variety 'Ganxing 48'.

5. A method for identifying a superior Camellia oleifera variety 'Ganxing 48', characterized in that, Includes the following steps: (1) Extract genomic DNA from the camellia oil sample to be tested; (2) Using the genomic DNA extracted in step (1) as a template, perform PCR amplification using the SSR primer set described in claim 2; (3) The PCR amplification products in step (2) are genotyped and the genotype results are banded. If the PCR amplification products have four specific bands of 161bp, 167bp, 179bp and 185bp, it indicates that the camellia oil sample to be tested is 'Ganxing 48'. Otherwise, it indicates that the camellia oil sample to be tested is not 'Ganxing 48'.

6. The method according to claim 5, characterized in that, The 161bp sequence is shown in SEQ ID NO.3, the 167bp sequence is shown in SEQ ID NO.4, the 179bp sequence is shown in SEQ ID NO.5, and the 185bp sequence is shown in SEQ ID NO.

6.

7. The method according to claim 5, characterized in that, The PCR reaction system consisted of: 10×buffer 1 μL, dNTP (2.5 mM) 1.2 μL, MgCl2 (25 mM) 0.6 μL, primer (1 μM) 1 μL, HotTaq 5 U / μL 0.07 μL, sample DNA 1 μL, ddH2O 5.13 μL, and a total volume of 10 μL.

8. The method according to claim 5, characterized in that, The PCR reaction program was as follows: 95℃ for 2 min; denaturation at 95℃ for 20 s; annealing at 63℃~57.5℃ for 40 s; extension at 72℃ for 1 min; 11 cycles, with the temperature decreasing by 0.5℃ for each cycle. Denaturation at 95℃ for 20 s, annealing at 65℃ for 30 s, extension at 72℃ for 1 min, 24 cycles; hold at 72℃ for 2 min; store reaction product at 4℃.

9. The application of the method described in claim 5 in the rapid identification of the superior Camellia oleifera variety 'Ganxing 48'.

Images