CRISPR / Cas12a-based'signal-on 'type electrochemical biosensor and application thereof
By combining DNA tetrahedral nanostructure-modified electrodes with the CRISPR/Cas12a system, a "signal-on" type electrochemical biosensor was constructed, which solved the problems of signal interference, insufficient sensitivity, and disordered probe arrangement of existing CRISPR/Cas12a sensors. It achieved high sensitivity and high specificity detection of AFP and miRNA-122, simplified the detection process, and reduced costs.
Patent Information
- Application Number
- CN202511191911.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-25
- Publication Date
- 2025-11-28
AI Technical Summary
Existing CRISPR/Cas12a electrochemical sensors suffer from problems such as signal shutdown mode being susceptible to interference from complex samples, insufficient detection sensitivity, disordered probe arrangement, and non-specific adsorption. Furthermore, they lack versatility, leading to false positives and high development costs.
By modifying electrodes with DNA tetrahedral nanostructures and combining them with the CRISPR/Cas12a system and DNAzyme self-feedback amplification technology, a "signal-on" type electrochemical biosensing platform is constructed. Through ordered probe arrangement, DNAzyme self-feedback cycling, and the synergistic effect of CRISPR/Cas12a, high sensitivity and specificity detection are achieved.
It achieves high sensitivity and high specificity detection of liver cancer biomarkers AFP and miRNA-122, reduces false positives, simplifies the detection process, reduces operation steps and costs, and improves the versatility of the detection platform.
Smart Images

Figure CN121027256A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biosensing and molecular diagnostics, and particularly relates to a "signal-on" electrochemical biosensor based on CRISPR / Cas12a and a preparation method and application thereof. BACKGROUND
[0002] Liver cancer is a malignant tumor with extremely high morbidity and mortality worldwide, and early diagnosis is crucial for improving patient survival. The current clinical detection methods for liver cancer markers mainly face two major challenges: on the one hand, single biomarker detection cannot meet the specificity requirements of clinical diagnosis; on the other hand, existing detection technologies still have obvious shortcomings in sensitivity, anti-interference ability and operation convenience.
[0003] In recent years, the CRISPR / Cas12a system has been widely used in molecular diagnostics due to its high specificity. However, traditional CRISPR / Cas12a electrochemical sensors mostly use "signal-off" detection mode, which is easily disturbed by complex sample matrix and produces false positive signals. At the same time, due to the lack of effective signal amplification mechanism, the detection sensitivity for trace biomarkers is often insufficient. In addition, the traditional method of directly modifying the electrode with single-stranded DNA has problems such as disordered arrangement of probes, large steric hindrance, etc., which not only affects the cutting efficiency of the CRISPR system, but also increases non-specific adsorption, usually requiring additional use of blocking agents for treatment.
[0004] In terms of signal amplification, existing technologies mostly use complex DNA cascade systems, which require the design of multiple DNA functional elements, not only increasing the development cost, but also affecting the reaction efficiency. More importantly, existing detection platforms lack universality, and often need to redesign the entire detection system for different targets, including large-scale modification of electrode modification and signal conversion modules, which seriously limits their application in multi-marker joint detection. SUMMARY
[0005] In order to solve the above problems existing in the prior art, the present application provides a "signal-on" electrochemical biosensor based on CRISPR / Cas12a and a preparation method and application thereof. The present application ingeniously integrates DNA tetrahedron nanostructure modified electrode (DTN modified electrode), CRISPR / Cas12a system and DNAzyme self-feedback amplification technology to construct a high-performance "signal-on" electrochemical biosensor platform. This platform not only solves many defects of traditional detection methods, but also realizes high sensitivity and high specificity detection of important markers (AFP and miRNA-122) of liver cancer, providing a new technical means for early diagnosis of liver cancer.
[0006] The technical scheme adopted by the present application is:
[0007] A preparation method of a DNA tetrahedron nanostructure modified electrode, comprising the following steps:
[0008] (1) Preparation of DTN:
[0009] Four single-stranded DNA sequences T1, T2, T3 and T4 are respectively diluted with TM buffer, and T2, T3 and T4 are dispersed in a solution containing a thiol reducing agent and incubated for a period of time; then the four treated solutions are thoroughly mixed, heated and immediately cooled to form a DNA tetrahedron nanostructure, i.e. DTN structure;
[0010] (2) Electrode pretreatment
[0011] Take a glassy carbon electrode, polish it first, then clean it; then immerse the treated electrode in a gold precursor solution and perform electrodeposition to obtain a gold nanoparticle modified electrode (DepAu / GCE);
[0012] (3) DTN modification:
[0013] The electrode of step (2) is reacted with the DTN structure of step (1) to obtain a DNA tetrahedron nanostructure modified electrode.
[0014] Four single-stranded DNAs (T1-T4) self-assemble into a DTN structure through a thermal annealing process. Three of the vertices contain mercapto groups, which are firmly anchored to the gold-plated electrode surface through Au-S bonds, and the fourth vertex extends a single-stranded DNA (C1), forming a pyramid-shaped structure. This design allows the probes to be arranged in order, effectively reducing steric hindrance.
[0015] In step (1), the buffer is TM buffer; the composition of the TM buffer includes 50mM Tris-HCl and 15mM MgCl2, and the pH is 7.4;
[0016] The four single-stranded DNA sequences T1, T2, T3 and T4 are respectively diluted to a final concentration of 20μM with TM buffer; the DNA sequences of T1, T2, T3 and T4 are shown in SEQ ID NO: 1-4;
[0017] The solution containing a thiol reducing agent is a tris(2-carboxyethyl) phosphine hydrochloride (TCEP) solution, and the concentration of the tris(2-carboxyethyl) phosphine hydrochloride solution is 10mM, incubated at 25℃ for 30 minutes;
[0018] After heating at 95℃ for 5 minutes, immediately cool to 4℃;
[0019] The final concentration of the DTN structure is 1μM.
[0020] In step (2), the electrode is a glassy carbon electrode; the glassy carbon electrode is polished with 0.3 μm and 0.05 μm alumina powder in sequence;
[0021] The ultrasonic cleaning treatment is performed in ethanol and ultrapure water, respectively;
[0022] The gold-containing precursor solution is a chloroauric acid (HAuCl4) solution, and the concentration of the chloroauric acid (HAuCl4) solution is 1%;
[0023] The electrodeposition condition is: electrodeposition for 30 seconds under a constant potential of -0.2 V;
[0024] The reaction is an overnight reaction, which is performed at 4℃.
[0025] The DNA tetrahedral nanostructure modified electrode prepared by the method.
[0026] The DNA tetrahedral nanostructure modified electrode in the preparation of a "signal-on" type electrochemical biosensor.
[0027] The "signal-on" type electrochemical biosensor is used for detecting AFP or miRNA-122.
[0028] A method for detecting AFP electrochemically based on the DNA tetrahedral nanostructure modified electrode, comprising the following steps:
[0029] (A1) Construction of a Cas12a / crRNA complex:
[0030] The Cas12a and crRNA are mixed and reacted to obtain a Cas12a / crRNA complex;
[0031] The crRNA sequence is shown as SEQ ID NO: 6;
[0032] (B1) Construction of a DNAzyme self-feedback amplification system:
[0033] S1 and the aptamer sequence Apt of AFP are mixed and annealed to prepare an S1 / Apt complex; the DNA sequence of S1 is shown as SEQ ID NO: 7, and the DNA sequence of Apt is shown as SEQ ID NO: 8;
[0034] Different concentrations of AFP are mixed with H1, H2, and the S1 / Apt complex in TM buffer, and after the reaction is completed, a DNAzyme self-feedback amplification system is obtained; the DNA sequence of H1 is shown as SEQ ID NO: 9, and the DNA sequence of H2 is shown as SEQ ID NO: 10;
[0035] (C1) adding a mixed solution of Cas12a / crRNA complex, S3 and DNAzyme self-feedback amplification system to the surface of the tetrahedral nanostructure modified electrode, and incubating for a period of time; the DNA sequence of the S3 strand is shown as SEQ ID NO: 5;
[0036] (D1) adding a hemin solution to the surface of the electrode, and detecting the electrochemical signal after incubation, thereby completing the detection of AFP.
[0037] In step (A1), Cas12a and crRNA are mixed at a concentration ratio of 50 nM: 50 nM, and then reacted at 37°C for 30 min;
[0038] In step (B1), S1 and the aptamer sequence Apt of AFP are mixed at a concentration ratio of 1:1;
[0039] When the DNAzyme self-feedback reaction is performed, the AFP concentrations are 0, 10 fg / mL -1 , 100 fg / mL -1 , 1 pg / mL -1 , 10 pg / mL -1 , 100 pg / mL -1 , 1 ng / mL -1 , and 10 ng / mL -1 , respectively; the concentrations of H1, H2 and S1 / Apt complex are all 1 μM;
[0040] The mixing reaction is performed at 4-37°C for 30-120 min;
[0041] In step (C1), the incubation reaction is performed at 37°C for 40 min;
[0042] In step (D1), the concentration of the hemin solution is 0.5 mg / mL, and the incubation reaction is performed at 37°C for 50 min,
[0043] A method for detecting miRNA-122 by electrochemistry based on the DNA tetrahedral nanostructure modified electrode, comprising the following steps:
[0044] (A2) Construction of Cas12a / crRNA complex:
[0045] Mixing Cas12a and crRNA to obtain a Cas12a / crRNA complex;
[0046] (B2) Construction of DNAzyme self-feedback amplification system:
[0047] S1 and a complementary sequence S2 of miRNA-122 are mixed, annealed to prepare S1 / S2 complex; the DNA sequence of S2 is shown as SEQ ID NO: 11;
[0048] Different concentrations of miRNA-122 are mixed with H1, H2 and S1 / S2 complex in TM buffer, and after the reaction is completed, a DNAzyme self-feedback amplification system is obtained;
[0049] (C2) A mixed solution of Cas12a / crRNA complex, S3 and DNAzyme self-feedback amplification system is added to the surface of the tetrahedral nanostructure modified electrode, and incubated for a period of time;
[0050] (D2) Hemin solution is added dropwise to the electrode surface, and after incubation, the electrochemical signal is detected, and the miRNA-122 detection is completed.
[0051] In step (A2), Cas12a and crRNA are mixed at a concentration ratio of 50nM:50nM, and then reacted at 37℃ for 30min;
[0052] In step (B2), S1 and S2 are mixed at a concentration ratio of 1:1;
[0053] During the DNAzyme self-feedback reaction, the different concentrations of miRNA-122 are 0, 10aM, 100aM, 100aM, 1fM, 10fM, 100fM, 1pM, 10pM, and 100pM; the concentrations of H1, H2 and S1 / S2 complex are all 1μM;
[0054] The mixing reaction is carried out at 4-37℃ for 30-120min;
[0055] In step (C2), the incubation reaction is carried out at 37℃ for 40min;
[0056] In step (D2), the concentration of the hemin solution is 0.5mg / mL, and the incubation reaction is carried out at 37℃ for 50min.
[0057] It should be noted that, in their long-term research, the inventors of this application have found that the current technology has the following problems: (1) Regarding the detection mode: Existing CRISPR / Cas12a sensors mainly adopt the "signal off" detection principle, and their signal output depends on the signal attenuation caused by substrate cleavage. This design is easily affected by non-specific adsorption in complex samples (such as serum), which may produce false positive outputs. Especially when detecting low concentrations of target substances, the signal change amplitude is limited, affecting the detection sensitivity. (2) Regarding probe immobilization: The traditional method of directly modifying electrodes with single-stranded DNA has two main problems: First, the probes are randomly distributed on the electrode surface, making it difficult for the CRISPR / Cas12a system to effectively approach and cleave the signal probes; second, the exposed gold electrode surface is prone to non-specific adsorption, and usually requires the addition of blocking agents to suppress background interference, which increases the operation steps and reagent costs. (3) Regarding platform versatility: When conventional sensor designs are designed for different targets, it is often necessary to re-optimize the entire detection system, including electrode modification methods, signal conversion modules, etc. This "one target, one design" model significantly increases development costs and time investment. (4) Regarding signal amplification systems: Existing DNA cascade amplification systems typically require the design of multiple functional DNA elements (such as primers, template strands, etc.), which not only increases the complexity of the system but also raises the detection cost. At the same time, the introduction of multiple components may lead to reaction kinetic matching problems, affecting the overall efficiency.
[0058] Furthermore, the inventors of this application discovered through research that in the above-mentioned electrochemical detection method based on the DNA tetrahedral nanostructure modified electrode, when the target analyte (miRNA-122 or AFP) is absent, the pre-designed S3 chain binds to the Cas12a / crRNA complex, activating the Cas12a / crRNA complex and exhibiting non-specific ssDNA cleavage activity, thus cleaving the C1 sequence at the vertex of the DNA tetrahedral nanostructure. The cleaved C1 cannot form a G-quadruplex structure (G4), and the signal molecule hemin cannot bind to the electrode surface. The system is in a "signal off" state, and only a weak background signal is detected.
[0059] When miRNA-122 is present, it specifically recognizes the pre-assembled S1 / S2 complex. The S2 strand is designed as a DNA sequence perfectly complementary to miRNA-122, and the two bind according to a strict Watson-Crick base pairing rule. The binding free energy of miRNA-122 to S2 is significantly lower than that of S1 to S2; this thermodynamic advantage drives the dissociation and release of the S1 strand from the S1 / S2 complex. The released S1 strand serves as the trigger molecule for subsequent DNAzyme cascade reactions. For the detection of AFP, a specific aptamer (Apt) is used as the recognition element. When AFP is present, its binding to the aptamer causes a conformational change in the aptamer; this allosteric effect leads to the release of the S1 strand that was originally bound to the aptamer.
[0060] The released S1 chain initiates a highly efficient signal amplification cycle. First, it hybridizes with the hairpin structure H1, opening the stem-loop structure of H1 through a chain substitution reaction, exposing the hidden Mg. 2+ DNAzyme-dependent active core. In Mg 2+ Under the given conditions, the activated DNAzyme specifically cleaves the substrate H2, producing two key products: the repressor strand H2-1 and the feedback strand S1-A. Notably, S1-A contains the exact same functional sequence as S1 and can trigger a new round of H1 activation and H2 cleavage, just like S1, thus forming a self-feedback exponential amplification cycle.
[0061] The abundant H2-1 generated by the DNAzyme feedback loop plays a core regulatory role: they have a higher binding affinity to the activating strand S3, competitively blocking the formation of the Cas12a / crRNA / S3 ternary complex. This inhibition keeps the CRISPR / Cas12a system inactive, unable to cleave the C1 sequence at the DTN vertex. The uncleaved C1 sequence, in the presence of potassium ions, spontaneously folds into a stable G4 structure, binds to hemin, forming a G4 / hemin complex, generating a strong electrochemical signal.
[0062] The beneficial effects of this invention are as follows:
[0063] (1) This invention relates to a DNA tetrahedral nanostructure modified electrode. The method involves first preparing a DTN structure through a thermal annealing process based on four single-stranded DNA molecules (T1-T4), then preparing a gold nanoparticle modified electrode (DepAu / GCE), and finally reacting the DepAu / GCE electrode with the DTN structure to obtain the DNA tetrahedral nanostructure modified electrode. Three vertices of the DNA tetrahedral nanostructure contain thiol groups, which are firmly anchored to the gold-plated electrode surface via Au-S bonds. A single-stranded DNA segment (C1) extends from the fourth vertex, forming a pyramidal structure. This design allows for the orderly arrangement of probes, effectively reducing steric hindrance.
[0064] (2) Based on the DNA tetrahedral nanostructure modified electrode and CRISPR / Cas12a, the present invention constructs a "signal-on" type electrochemical biosensor for electrochemical detection of AFP and miRNA-122. The DNA tetrahedral nanostructure, DNAzyme self-feedback cascade amplification and CRISPR / Cas12a work synergistically to significantly improve the detection sensitivity of the sensor, with detection limits reaching the aM level (miRNA-122) and the fg / mL level (AFP). False positives are avoided through the signal enhancement mechanism triggered by the target (AFP and / or miRNA-122). The DNA tetrahedral nanostructure eliminates non-specific adsorption, reduces background interference, and improves detection reliability. It employs dual specificity protection: firstly, the AFP aptamer and miRNA-122 complementary strand are strictly matched; secondly, crRNA accurately recognizes the activation sequence, resulting in stronger anti-interference capabilities. A DNA tetrahedral nanostructure is used as the probe immobilization platform to improve probe ordering and enhance the cleavage efficiency of the CRISPR / Cas12a system, while avoiding the use of blocking agents. A universal detection platform is designed so that when detecting different targets (such as AFP and miRNA-122), only the corresponding recognition element (aptamer or complementary DNA) needs to be replaced, without redesigning the entire detection system. A simplified DNAzyme self-feedback amplification system is designed to reduce the types and number of DNA components required while ensuring signal amplification efficiency. Attached Figure Description
[0065] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0066] Figure 1 This diagram illustrates the detection principle of the "signal activation" type electrochemical biosensing platform described in this invention.
[0067] Figure 2 The image shows a characterization diagram of the DNA tetrahedral nanostructure described in this invention; wherein, (A) PAGE characterization of the DNA tetrahedral nanostructure, (B) TEM characterization of the DNA tetrahedral nanostructure, (C) AFM image of the DNA tetrahedral nanostructure, and (D) height distribution of the DNA tetrahedral nanostructure.
[0068] Figure 3 The results show the results of polyacrylamide gel electrophoresis (PAGE) experiments. Among them, (A) the target miRNA-122 successfully triggered the DNAzyme self-feedback cascade reaction; (B) and (C) the miRNA-122 and AFP-induced DNAzyme self-feedback amplification systems effectively inhibited the nucleic acid cleavage activity of CRISPR / Cas12a, respectively; (D) the changes in SWV signal corresponding to different concentrations of target miRNA-122.
[0069] Figure 4 The diagram shows a comparison of electrochemical biosensing platforms constructed based on DNA tetrahedral nanostructures and single-stranded DNA (ssDNA), respectively. Among them, (A) comparison of the initial electrochemical signals of the two electrochemical biosensing platforms; (B) ΔI changes of the two sensing platforms after the addition of the target; (C) the effect of masking agent HT on the electrochemical signal of the biosensor.
[0070] Figure 5 The electrochemical characterization of the biosensor assembly process using miRNA-122 as the analytical model is shown. (A) CV curves; (B) EIS test results. In the figure, (a) represents DepAu / GCE, (b) represents DTN / DepAu / GCE, (c) represents hemin / (S1 / S2, H1, H2, S3, Cas12a / crRNA) / DTN / DepAu / GCE, and (d) represents hemin / (S1 / S2, H1, H2, S3, miRNA-122, Cas12a / crRNA) / DTN / DepAu / GCE. The concentration of miRNA-122 is 10 pM. DTN is a DNA tetrahedral nanostructure.
[0071] Figure 6 The biosensor analysis performance of the present invention is shown; wherein, (A) SWV response curves of different concentrations of miRNA-122; (B) ΔI miRNA-122 Logarithm of miRNA-122 concentration (lgC) miRNA (C) Fitted curve of AFP at -122); (D) SWV response curve of AFP at different concentrations; AFP Logarithm of AFP concentration (lgC) AFP The fitted curve of );
[0072] Figure 7 The selective test results of the electrochemical biosensor described in this invention are shown; wherein, (A) miRNA-122 detection specificity; (B) AFP detection specificity; (C) reproducibility test of 8 independent electrodes in the same batch; (D) repeatability verification of 7 different batches of sensors; (E) long-term stability test of the sensor stored at 4°C for 13 days. The miRNA-122 concentration was 1 pM, and the AFP concentration was 10 pg / mL.
[0073] Figure 8 This invention demonstrates the practical application performance of the electrochemical biosensor for detecting miRNA-122 and AFP; wherein, (A) the normalized current response of miRNA-122 in the healthy group (H1-H3) and the liver cancer patient group (P1-P7); and (B) a comparison of the normalized current response of AFP in the healthy group and the liver cancer group. Detailed Implementation
[0074] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below. Obviously, the described embodiments are merely some embodiments of this invention, and not all embodiments. Based on the embodiments of this invention, all other implementation methods obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0075] Example 1: Preparation of DNA Tetrahedral Nanostructures
[0076] This embodiment provides a method for preparing a DNA tetrahedral nanostructure modified electrode, comprising the following steps:
[0077] (1) Preparation of DTN:
[0078] Four single-stranded DNA sequences (T1, T2, T3, T4) were diluted to a final concentration of 20 μM with TM buffer (50 mM Tris-HCl, 15 mM MgCl2, pH 7.4). T2, T3, and T4 were then dispersed in 10 mM tris(2-carboxyethyl)phosphonic acid hydrochloride (TCEP) solution and incubated at 25 °C for 30 minutes to prevent disulfide bond formation between the single-stranded DNAs. The four treated solutions were then transferred to 200 μL centrifuge tubes, thoroughly mixed, heated at 95 °C for 5 minutes, and immediately rapidly cooled to 4 °C to form a stable DTN structure with a final concentration of 1 μM.
[0079] The DNA sequences of T1, T2, T3, and T4 are as follows (as shown in SEQ ID NO:1-4):
[0080] T1:TGGGTAGGGCGGGTTGGGTTTTACATTCCTAAGTCTGAAACATTACAGCTTGCTACACGAGAAGAGCCGCCATAGTA;
[0081] T2:SH-TATCACCAGGCAGTTGACAGTGTAGCAAGCTGTAATAGATGC GAGGGTCCAATAC;
[0082] T3:SH-TCAACTGCCTGGTGATAAAACGACACTACGTGGGAATCTACTATGGCGGCTCTTC;
[0083] T4:SH-TTCAGACTTAGGAATGTGCTTCCCACGTAGTGTCGTTTGTATTGGACCCTCGCAT;
[0084] (2) Electrode pretreatment
[0085] A glassy carbon electrode (GCE, 3 mm in diameter) was polished sequentially with 0.3 μm and 0.05 μm alumina powders, then ultrasonically cleaned with ethanol and ultrapure water, and then cleaned again. The treated electrode was then immersed in a 1% chloroauric acid (HAuCl4) solution and electrodeposited at a constant potential of -0.2 V for 30 seconds to obtain a gold nanoparticle modified electrode (DepAu / GCE).
[0086] (3) DTN modification:
[0087] The electrode described in step (2) and the DTN structure described in step (1) are reacted at 4°C overnight to obtain an electrode modified with a DNA tetrahedral nanostructure.
[0088] As an alternative implementation, the glassy carbon electrode can be replaced with a screen-printed electrode, a glass electrode, or a paper-based electrode. The gold nanoparticles can also be precious metal nanoparticles such as silver or platinum.
[0089] Example 2: Electrochemical detection of AFP based on the aforementioned DNA tetrahedral nanostructure
[0090] This embodiment provides a method for the electrochemical detection of AFP. This method is based on a DNA tetrahedral nanostructure (DTN) modified electrode and a CRISPR / Cas12a system. It achieves high-sensitivity AFP detection through a target-triggered DNAzyme self-feedback cycle, and specifically includes the following steps:
[0091] (A) Construction of the Cas12a / crRNA complex:
[0092] After mixing Cas12a and crRNA at a concentration ratio of 50 nM: 50 nM, the mixture was reacted at 37 °C for 30 min to obtain the Cas12a / crRNA complex (50 nM / 50 nM).
[0093] The crRNA sequence is (as shown in SEQ ID NO:6): UAAUUUCUACUAAGUGUAGAUGACAGGACCAGGACAUCAAG;
[0094] (B) Construction of DNAzyme self-feedback amplification system:
[0095] First, S1 and the aptamer sequence Apt of AFP were mixed at a concentration ratio of 1:1 and then annealed to prepare the S1 / Apt complex.
[0096] The DNA sequence of S1 is (as shown in SEQ ID NO:7): ACATCAAGACCGAGACGAGGTGTTTGGAGAACTGCACCTG;
[0097] The DNA sequence of the Apt is (as shown in SEQ ID NO:8): GTGACGCTCCTAACGCTGACTCAGGTGCAGTTCTCGACTCGGTCTTGATG TGGGTCCTGTCCGTCCGAACCAATC;
[0098] Different concentrations of AFP were mixed with H1 (1 μM), H2 (1 μM), and S1 / Apt complex (1 μM) in TM buffer and reacted at 4°C for 1 hour to obtain the DNAzyme self-feedback amplification system.
[0099] The different concentrations of AFP were: 0, 10 fg / mL, etc. -1 100 fg mL -1 1 pg mL -1 10 pg mL -1 100 pg mL -1 1ng mL -1 10 ng mL -1 ;
[0100] The DNA sequence of H1 is (as shown in SEQ ID NO:9): AGTACTAGCGATTAACCAGGTTACACCCATGTTATCCTACGAAAACAGTT CTCCAAA CACC TCGTAGGATA;
[0101] The DNA sequence of H2 is (as shown in SEQ ID NO:10): CAAACACCGCGACAGGACCAGGACATCAAGCATGACCTTGATGTCCTGG TCCTGTCCGAGTAGGATAT / rA / GGAGTACTACGAGGTGTTTGGAGAACTG ( / rA / is the DNA zyme cleavage site);
[0102] (C) Add a mixture of Cas12a / crRNA complex (50 nM / 50 nM), S3 and DNAzyme self-feedback amplification system to the surface of the tetrahedral nanostructure modified electrode, and incubate at 37°C for 40 minutes; after the incubation step, thoroughly wash the electrode surface five times with 0.1 M PBS buffer (pH 7.4);
[0103] The DNA sequence of the S3 strand is (as shown in SEQ ID NO:5): CTTGATGTCCTGGTCCTGTCGCGGTGTT;
[0104] (D) Add 8 μL of 0.5 mg / mL hemin solution to the electrode surface and incubate at 37°C for 50 minutes. After the incubation step, thoroughly clean the electrode surface five times with 0.1M PBS buffer (pH 7.4), then immerse the electrode in the PBS buffer and test the current signal using the square wave voltammetry method. The test conditions are: potential range 0 to -0.5V, frequency 15Hz, amplitude 25mV, which completes the AFP detection.
[0105] Example 3: Electrochemical detection of miRNA-122 based on the DNA tetrahedral nanostructure modified electrode
[0106] This embodiment provides a method for the electrochemical detection of miRNA-122. This method is based on a DNA tetrahedral nanostructure (DTN) modified electrode and a CRISPR / Cas12a system. It achieves high-sensitivity detection of miRNA-122 through a target-triggered DNAzyme self-feedback cycle, and specifically includes the following steps:
[0107] (A) Construction of the Cas12a / crRNA complex:
[0108] After mixing Cas12a and crRNA at a concentration ratio of 50 nM: 50 nM, the mixture was reacted at 37 °C for 30 min to obtain the Cas12a / crRNA complex (50 nM / 50 nM).
[0109] The crRNA sequence is (as shown in SEQ ID NO:6): UAAUUUCUACUAAGUGUAGAUGACAGGACCAGGACAUCAAG;
[0110] (B) Construction of DNAzyme self-feedback amplification system:
[0111] First, S1 and the complementary sequence S2 of miRNA-122 were mixed at a concentration ratio of 1:1 and then annealed to prepare the S1 / S2 complex.
[0112] The DNA sequence of S1 is (as shown in SEQ ID NO:7): ACATCAAGACCGAGACGAGGTGTTTGGAGAACTGCACCTG;
[0113] The DNA sequence of S2 is (as shown in SEQ ID NO:11): CAGTTCTCCAAACACCATTGTCACACTCCA;
[0114] Different concentrations of miRNA-122 were mixed with H1 (1 μM), H2 (1 μM), and S1 / S2 complex (1 μM) in TM buffer and reacted at 4°C for 1 hour to obtain the DNAzyme self-feedback amplification system.
[0115] The DNA sequence of H1 is (as shown in SEQ ID NO:9): AGTACTAGCGATTAACCAGGTTACACCCATGTTATCCTACGAAAACAGTT CTCCAAA CACC TCGTAGGATA;
[0116] The DNA sequence of H2 is (as shown in SEQ ID NO:10): CAAACACCGCGACAGGACCAGGACATCAAGCATGACCTTGATGTCCTGG TCCTGTCCGAGTAGGATAT / rA / GGAGTACTACGAGGTGTTTGGAGAACTG ( / rA / is the DNA zyme cleavage site);
[0117] (C) A mixture of Cas12a / crRNA complex (50 nM / 50 nM), S3 and DNAzyme self-feedback amplification system was added to the surface of the tetrahedral nanostructure modified electrode and incubated at 37°C for 40 minutes. After the incubation step, the electrode surface was thoroughly washed five times with 0.1 M PBS buffer (pH 7.4). The DNA sequence of the S3 strand is (as shown in SEQ ID NO:5): CTTGATGTCCTGGTCCTGTCGCGGTGTT.
[0118] (D) Add 8 μL of 0.5 mg / mL hemin solution to the electrode surface and incubate at 37°C for 50 minutes. After the incubation step, thoroughly clean the electrode surface five times with 0.1M PBS buffer (pH 7.4), and then immerse the electrode in the PBS buffer. Use square wave voltammetry to test the current signal. The test conditions are: potential range 0 to -0.5V, frequency 15Hz, amplitude 25mV, which completes the detection of miRNA-122.
[0119] It should be noted that, as an optional implementation scheme, the G4 / hemin system can be replaced with electroactive molecules such as methylene blue; the square wave voltammetry can be replaced with differential pulse voltammetry or AC voltammetry.
[0120] Experimental Example
[0121] (1) Characterization of DNA tetrahedral nanostructures:
[0122] Four single-stranded DNA strands (T1-T4) were self-assembled using a thermal annealing method to form a DNA tetrahedral nanostructure, which was characterized by non-denaturing polyacrylamide gel electrophoresis (PAGE, 12%), transmission electron microscopy (TEM), and atomic force microscopy (AFM). Figure 2 As shown in Figure A, when the number of assembled chains increases to two (lane 5) or three (lane 6), the electrophoretic mobility gradually decreases, consistent with theoretical expectations. When all four chains are present (lane 7), a clear band with a significantly slower migration rate appears, confirming successful DTN assembly. The weak band below the DTN band may correspond to the triple-chain intermediate formed during the reaction. TEM images show ( Figure 2 B), the DTN exhibits a well-dispersed nanostructure with a size of approximately 4.25 nm. AFM further confirmed the uniform distribution of the DTN. Figure 2 C), its height distribution ranges from 3.82 to 6.22 nm. Figure 2 (D) Based on base pair length calculations, the theoretical height and side length of DTN should be 5.02 nm and 6.12 nm, respectively. However, some DTNs have a height lower than the theoretical value, which may be due to the collapse of the three-dimensional structure into a two-dimensional triangular structure caused by strong electrostatic interaction and dehydration. All the above results indicate the successful synthesis of DTN.
[0123] (2) Feasibility analysis:
[0124] First, 12% non-denaturing polyacrylamide gel electrophoresis (PAGE) was used to verify the DNAzyme self-feedback amplification process triggered by the target analyte (miRNA-122 as an example). Figure 3As shown in lane A, the mixture of S1 and S2 shows a high-position band in lane 4, indicating successful formation of the S1 / S2 complex. After the addition of miRNA-122, the S1 / S2 band narrows, and a new band appears at the corresponding position of S1 (lane 5), confirming that miRNA-122 successfully triggers the release of the S1 chain. Further addition of H1 results in a higher molecular weight band in lane 7, corresponding to the complex formed by H1 and S1. Additionally, the blurred band appearing between the S1 / S2 band and the S1 band represents the S2 / miRNA-122 complex. Finally, after the addition of hairpin substrate H2 (lane 9), two low molecular weight bands appear at positions different from H1 and H2, representing the cleavage product H2-1 of H2 and the complex formed by S1-A and H1, respectively. These results clearly demonstrate that the target compound can effectively trigger the DNAzyme self-feedback amplification process.
[0125] Subsequently, FAM-labeled ssDNA C1 (FAM-C1) was used as a signal probe. The sequence of FAM-C1 is as shown in SEQ ID NO: 12: FAM-TGGGTAGGGCGGGTTGGGTT. The inhibitory effect of the DNAzyme amplification product on CRISPR / Cas12a cleavage activity was verified by UV imaging. After co-incubation of S3 with the Cas12a / crRNA complex, the original FAM-C1 band was replaced by a low molecular weight band. Figure 3 Lanes B and 3C (second lanes) indicate that S3 can activate CRISPR / Cas12a cleavage activity. Even with the addition of all DNAzyme feedback amplification components (without a target), FAM-C1 still maintains its cleavage state. Figure 3 Lane B, Lane 3 and Figure 3 Lane C (5th lane) shows that the system has almost no background interference. However, after adding the target miRNA-122 or AFP, the band position is consistent with the intact FAM-C1 (…). Figure 3 Lane B, fourth swimming lane and Figure 3 The study (lane 6) demonstrated that the target-induced DNAzyme self-feedback amplification system can effectively inhibit CRISPR / Cas12a cleavage activity.
[0126] The detection performance of the biosensor was further verified using square wave voltammetry (SWV). Figure 3D). Without miRNA-122, the activated CRISPR / Cas12a system cleaves the ssDNA C1 at the DTN apex on the electrode surface, causing hemin to detach from the electrode, resulting in only a weak SWV signal. With the addition of miRNA-122, the target-activated DNAzyme undergoes self-feedback amplification, generating a large amount of H2-1, which competitively binds to S3 to inhibit CRISPR system activity, causing C1 to fold into a G4 / hemin complex, producing a significantly enhanced SWV signal. When the target concentration increases from 5 fM to 50 pM, the electrochemical signal shows a concentration-dependent enhancement, confirming the feasibility of the constructed "signal-on" type electrochemical biosensor for target detection.
[0127] (3) Characterization of biosensors based on DNA tetrahedral nanostructure support interfaces
[0128] Sensing platforms were constructed using DNA tetrahedral nanostructures (DTN) and thiol-modified single-stranded DNA (SH-C1) as support vectors, respectively. Using miRNA-122 as the analysis model, the two assembly strategies were compared. The sequence of SH-C1 is (as shown in SEQ ID NO:13): SH-TGGGTAGGGCGGGTTGGGTT;
[0129] like Figure 4 As shown in Figure A, the electrochemical signal intensity of hemin using a DNA tetrahedral nanostructure as a carrier is significantly higher than that of the SH-C1 directly modified system. More importantly, when miRNA-122 is introduced, the ΔI (ΔI = I - I0, where I and I0 represent the current signal with and without the target) generated by the DNA tetrahedral nanostructure-based sensing platform is significantly stronger than that of the SH-C1-based platform, and this performance difference gradually increases with increasing target concentration. Figure 4 B). These results indicate that the well-rigid DNA tetrahedral nanostructures are ordered and well-oriented on the electrode surface, which can promote the efficient binding of the electroactive molecule hemin and reduce the steric hindrance of the CRISPR / Cas12a signal probes approaching the electrode surface, thereby significantly improving their nucleic acid cleavage efficiency and ultimately generating a sensitive electrochemical signal response.
[0130] Taking the commonly used masking agent 1-hexathiol (HT) as an example, the anti-nonspecific adsorption ability of the DNA tetrahedral nanostructure platform was further investigated. Figure 4C). At different target concentrations, the ΔI difference before and after adding HT to the DNA tetrahedral nanostructure-based platform was less than 3%. This is due to the inherent structural rigidity of the DNA tetrahedral nanostructure, which ensures that the ssDNA probe maintains an ordered vertical alignment of the vertices of the DNA tetrahedral nanostructure on the electrode surface. The spatial isolation between adjacent recognition units effectively prevents intermolecular interactions, thereby eliminating non-specific adsorption of nucleic acids on the electrode surface. Therefore, subsequent experiments do not require the addition of a masking agent, reducing costs and simplifying the operation process. These results fully demonstrate that the DNA tetrahedral nanostructure, as a support platform, can not only improve detection sensitivity but also optimize the biosensor assembly process and save costs.
[0131] (4) Characterization of the electrochemical biosensor assembly process
[0132] Using miRNA-122 as the analytical model, the assembly process of the biosensor was characterized by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The results are as follows: Figure 5 As shown in the figure, when gold nanoparticles are electrodeposited on the surface of a glassy carbon electrode (GCE) (curve a), a significant redox peak appears due to the high conductivity of gold, exhibiting a low impedance spectrum that is approximately linear. After introducing a DNA tetrahedral nanostructure (DTN) (curve b), the peak current decreases significantly, and the impedance value increases. This is attributed to the negatively charged phosphate backbone of DTN and [Fe(CN)6]. 3- / 4- The repulsive effect between them is evident. In the absence of a target, the addition of the DNAzyme self-feedback amplification system, S3, the CRISPR / Cas12a system, and hemin to the electrode surface (curve c) results in an enhanced current signal and a decreased impedance. This is because the activated CRISPR / Cas12a system non-specifically cleaves ssDNAC1 at the vertices of the DNA tetrahedral nanostructure (DTN), hindering the formation of the G4 / hemin complex, while simultaneously reducing the amount of negative charge on the electrode surface. However, the addition of miRNA-122 (curve d) weakens the current signal and increases the impedance. This is because the target-triggered DNAzyme self-feedback amplification reaction generates a large amount of H2-1, inhibiting CRISPR / Cas12a activity and causing the G4 / hemin supramolecular complex to form on the electrode surface, increasing the steric hindrance of mass transfer and electron transfer. These results fully demonstrate the successful assembly of an electrochemical biosensing platform based on the DNA tetrahedral nanostructure (DTN)-supported CRISPR / Cas12a system and the target-triggered DNAzyme self-feedback amplification system.
[0133] (5) Analytical performance
[0134] like Figure 6As shown in Figure A, the biosensor exhibits a concentration-dependent increase in the square wave voltammetry (SWV) response signal to different concentrations of miRNA-122 (10 aM to 100 pM). Figure 6 B shows that ΔI miRNA-122 (ΔI miRNA-122 =I-I0, where I and I0 represent the current signals in the presence and absence of target miRNA-122, respectively, and the logarithm of miRNA-122 concentration (lgC). miRNA-122 The relationship between the two is good, and the linear regression equation is ΔI. miRNA-122 =2.17 + 0.88 * lgC miRNA-122 (R 2 =0.9995), with a detection limit (LOD) as low as 7.58 aM (signal-to-noise ratio S / N = 3). It also exhibits excellent performance in AFP detection. Figure 6 C) When the AFP concentration increases from 10 fg / mL to 10 ng / mL, the SWV signal increases accordingly. Figure 6 D shows that ΔI AFP Logarithm of AFP concentration (lgC) AFP The linear regression equation for ) is ΔI AFP =2.85 + 1.23 * lgCAFP(R) 2 =0.9977), with a detection limit of 5.36 fg / mL (S / N = 3).
[0135] (6) Evaluation of the stability, reproducibility and selectivity of the sensing platform
[0136] The selectivity test results of the prepared electrochemical biosensor are as follows: Figure 7 As shown in A and 7B, the sensor was tested using different interfering miRNAs (including miRNA-21, miRNA-155, miRNA-199a, miRNA-223, single-base mismatch miRNA-122 (miRNA-122-M1), double-base mismatch miRNA-122 (miRNA-122-M2), and a mixture of all interferants and miRNA-122) at a concentration of 10 pM. Figure 7 As shown in Figure A, compared to other interfering miRNAs, this sensor exhibited a significantly stronger current response to 1 pM miRNA-122, with signal intensity comparable to that of mixed samples. This result indicates that the biosensor possesses excellent specificity for miRNA-122, effectively distinguishing even single- or double-base mismatched sequences. For the selective assessment of AFP, four interfering proteins at concentrations 10 times higher than AFP were used: carcinoembryonic antigen (CEA), human serum albumin (HSA), prostate-specific antigen (PSA), and immunoglobulin G (IgG). Figure 7As shown in Figure B, the test group containing the target AFP showed a significantly higher SWV signal compared to the SWV signal generated by the interfering protein, indicating that the prepared biosensor has good selectivity for AFP.
[0137] The miRNA sequences involved are as follows:
[0138] miRNA-21 (as shown in SEQ ID NO:14: UAGCUUAUCAGACUGAUGUUGA);
[0139] miRNA-155 (as shown in SEQ ID NO:15): UUAAUGCUAAUCGUGAUAGGGGU
[0140] miRNA-199a (as shown in SEQ ID NO:16): CCCAGUGUUCAGACUACCUGUUC;
[0141] miRNA-223 (as shown in SEQ ID NO:17): UGUCAGUUUGUCAAAUACCCCA;
[0142] miRNA-122-M1 (as shown in SEQ ID NO:18): UGGAGUGUGACAAUGGUCUUUG;
[0143] miRNA-122-M2 (as shown in SEQ ID NO:19): UGGACUGUGACAAUGGUCUUUG;
[0144] Using miRNA-122 as the analytical target, the reproducibility and stability of the biosensor were investigated. In-batch testing of eight groups of sensors prepared in the same batch showed a relative standard deviation (RSD) of 4.49% for the ΔI value. Figure 7 C); Inter-batch testing of seven groups of sensors prepared in different batches showed an RSD of 2.21% ( Figure 7 D), indicating that the sensor has excellent reproducibility. Furthermore, the assembled sensor was stored at 4°C for 13 days to verify its long-term stability, and the results showed ( Figure 7 E) The ΔI value on the final detection day remained above 91% of the initial value, demonstrating that the constructed electrochemical biosensor has excellent long-term stability.
[0145] (7) Practicality assessment
[0146] To verify the practical application performance of the electrochemical biosensor in detecting miRNA-122 and AFP, a standard addition method was used. Different concentrations of AFP and miRNA-122 were added to 10-fold diluted healthy human serum samples for spiked recovery experiments. As shown in Table 1, the recovery rate of miRNA-122 was 96.00%–105.00%, with relative standard deviations (RSDs) all less than 3%; the recovery rate of AFP detection was 95.13%–107.10%, with RSDs consistently below 6%, confirming that this method can be used for detection in real samples.
[0147] Table 1 - Detection results of miRNA-122 and AFP spiked recovery assay using the constructed biosensor
[0148]
[0149]
[0150] The sensor was further used to directly analyze 10-fold diluted serum samples from three healthy individuals (H1-H3) and seven liver cancer patients (P1-P7). The results showed ( Figure 8 A) The normalized current signal corresponding to miRNA-122 in the serum of liver cancer patients was significantly lower than that in the healthy group, indicating that the expression level of miRNA-122 was significantly downregulated; while the normalized current signal response of AFP ( Figure 8 B) showed significantly higher levels than the healthy group, consistent with the high AFP expression characteristic of liver cancer patients. This result is highly consistent with existing theories and clinical findings; the detection results of the two biomarkers corroborate each other, effectively distinguishing liver cancer patients from healthy individuals. These studies demonstrate that the constructed biosensor exhibits excellent practical application potential in clinical sample analysis, providing a reliable technical means for the early and accurate diagnosis of liver cancer.
[0151] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.
Claims
1. A method for preparing a DNA tetrahedral nanostructure modified electrode, characterized in that, Includes the following steps: (1) Preparation of DTN: Four single-stranded DNA sequences T1, T2, T3, and T4 were diluted with buffer, and then dispersed in a solution containing thiol reducing agent and incubated for a period of time. The four treated solutions were then thoroughly mixed, heated, and immediately cooled to form a DNA tetrahedral nanostructure, which is the DTN structure. (2) Electrode pretreatment The electrode is first polished and then cleaned. The treated electrode is then immersed in a gold precursor solution for electrodeposition to obtain a gold nanoparticle modified electrode (DepAu / GCE). (3) DTN modification: The electrode described in step (2) is reacted with the DTN structure described in step (1) to obtain an electrode modified with a DNA tetrahedral nanostructure.
2. The method for preparing the DNA tetrahedral nanostructure modified electrode according to claim 1, characterized in that, In step (1), the buffer solution is a TM buffer solution; the TM buffer solution consists of 50 mM Tris-HCl and 15 mM MgCl2, and has a pH of 7.
4. The four single-stranded DNA sequences T1, T2, T3 and T4 were diluted with TM buffer to a final concentration of 20 μM; the DNA sequences of T1, T2, T3 and T4 are shown in SEQ ID NO:1-4; The solution containing the thiol reducing agent is a tris(2-carboxyethyl)phosphine hydrochloride solution with a concentration of 10 mM, and incubated at 25°C for 30 minutes. Heat at 95℃ for 5 minutes, then immediately cool to 4℃; The final concentration of the DTN structure is 1 μM.
3. The method for preparing the DNA tetrahedral nanostructure modified electrode according to claim 1, characterized in that, In step (2), the electrode is a glassy carbon electrode; the glassy carbon electrode is polished sequentially using 0.3 μm and 0.05 μm alumina powders; The samples were ultrasonically cleaned using ethanol and ultrapure water, respectively. The gold-containing precursor solution is a chloroauric acid (HAuCl4) solution with a concentration of 1%. The electrodeposition conditions are: electrodeposition at a constant potential of -0.2V for 30 seconds; The reaction was carried out overnight at 4°C.
4. A DNA tetrahedral nanostructure modified electrode prepared by the method of any one of claims 1-3.
5. The application of the DNA tetrahedral nanostructure modified electrode prepared by the method according to any one of claims 1-3 or the DNA tetrahedral nanostructure modified electrode according to claim 4 in the preparation of a "signal-on" type electrochemical biosensor.
6. The application according to claim 5, characterized in that, The "signal-on" type electrochemical biosensor is used to detect AFP or miRNA-122.
7. A method for electrochemical detection of AFP using a DNA tetrahedral nanostructure modified electrode prepared by any one of claims 1-3 or the DNA tetrahedral nanostructure modified electrode of claim 4, characterized in that, Includes the following steps: (A1) Construction of the Cas12a / crRNA complex: The Cas12a and crRNA were mixed to obtain the Cas12a / crRNA complex. The crRNA sequence is shown in SEQ ID NO:6; (B1) Construction of DNAzyme self-feedback amplification system: The S1 / Apt complex was prepared by mixing and annealing S1 with the aptamer sequence Apt of AFP; the DNA sequence of S1 is shown in SEQ ID NO:7 and the DNA sequence of Apt is shown in SEQ ID NO:
8. Different concentrations of AFP were mixed with H1, H2, and S1 / Apt complexes in TM buffer. After the reaction was completed, a DNAzyme self-feedback amplification system was obtained. The DNA sequence of H1 is shown in SEQ ID NO:9, and the DNA sequence of H2 is shown in SEQ ID NO:
10. (C1) A mixed solution of Cas12a / crRNA complex, S3 and DNAzyme self-feedback amplification system was added to the surface of the tetrahedral nanostructure modified electrode, and the reaction was incubated for a period of time; the DNA sequence of the S3 strand is shown in SEQ ID NO:5; (D1) Add hemin solution to the electrode surface, incubate the reaction, and then detect the electrochemical signal to complete the AFP detection.
8. The method for AFP detection based on a DNA tetrahedral nanostructure modified electrode according to claim 7, characterized in that, In step (A1), Cas12a and crRNA were mixed at a concentration ratio of 50 nM: 50 nM and then reacted at 37°C for 30 min. In step (B1), S1 is mixed with the aptamer sequence Apt of AFP at a concentration ratio of 1:1; During the DNAzyme self-feedback reaction, the different concentrations of AFP were 0, 10 fg / mL, and so on. -1 100 fg mL -1 1 pg mL -1 10 pg mL -1 100 pg mL -1 1ng mL -1 10 ng mL -1 The concentrations of H1, H2, and the S1 / Apt complex are all 1 μM. The mixing reaction is carried out at 4-37℃ for 30-120 minutes. In step (C1), the incubation reaction conditions are: incubation at 37°C for 40 minutes; In step (D1), the concentration of the hemin solution is 0.5 mg / mL, and the incubation conditions are: reaction at 37°C for 50 minutes.
9. A method for electrochemical detection of miRNA-122 using a DNA tetrahedral nanostructure modified electrode prepared by any one of claims 1-3 or the DNA tetrahedral nanostructure modified electrode of claim 4, characterized in that, Includes the following steps: (A2) Construction of the Cas12a / crRNA complex: The Cas12a and crRNA were mixed to obtain the Cas12a / crRNA complex. (B2) Construction of DNAzyme self-feedback amplification system: First, S1 and the complementary sequence S2 of miRNA-122 were mixed and annealed to prepare the S1 / S2 complex; the DNA sequence of S2 is shown in SEQ ID NO:
11. Different concentrations of miRNA-122 were mixed with H1, H2, and S1 / S2 complexes in TM buffer. After the reaction was completed, the DNAzyme self-feedback amplification system was obtained. (C2) A mixed solution of Cas12a / crRNA complex, S3 and DNAzyme self-feedback amplification system was added to the surface of the tetrahedral nanostructure modified electrode and incubated for a period of time. (D2) Add hemin solution to the electrode surface, incubate the reaction, and then detect the electrochemical signal to complete the detection of miRNA-122.
10. The method for detecting miRNA-122 based on a DNA tetrahedral nanostructure modified electrode according to claim 9, characterized in that, In step (A2), Cas12a and crRNA were mixed at a concentration ratio of 50 nM: 50 nM and then reacted at 37°C for 30 min. In step (B2), S1 and S2 are mixed at a concentration ratio of 1:1; When performing the DNAzyme self-feedback reaction, the different concentrations of miRNA-122 are as follows: 0, 10aM, 100aM, 100aM, 1fM, 10fM, 100fM, 1pM, 10pM, 100pM; the concentrations of H1, H2, and S1 / S2 complex are all 1μM. The mixing reaction is carried out at 4-37℃ for 30-120 minutes. In step (C2), the incubation reaction conditions are: incubation at 37°C for 40 minutes; In step (D2), the concentration of the hemin solution is 0.5 mg / mL, and the incubation conditions are: reaction at 37°C for 50 minutes.