Highly active multicopper oxidase mutant v286n and its use in mycotoxin degradation

Abstract

The present application relates to the field of agricultural biotechnology, and in particular to a high-activity multicopper oxidase mutant V286N and its application in mycotoxin degradation. The amino acid sequence of the multicopper oxidase mutant is shown as SEQ ID NO: 2. The multicopper oxidase mutant provided by the present application has higher specific activity. Compared with the wild-type multicopper oxidase, the specific activity of the multicopper oxidase mutant MCO-V286N provided by the present application is increased by 0.8 times, the degradation efficiency of mycotoxin zearalenone is increased by 0.4 times, the production and application cost is effectively reduced, and the multicopper oxidase has important application value and technical significance for the wide application of the multicopper oxidase in the field of mycotoxin detoxification of food and feed.

Description

Technical Field

[0001] This invention relates to the field of agricultural biotechnology, specifically to the highly active multi-copper oxidase mutant V286N and its application in the degradation of mycotoxins. Background Technology

[0002] Mycotoxins are secondary metabolites produced by fungi such as Aspergillus, Penicillium, and Fusarium. They not only destroy the nutritional value of feed but also lead to decreased livestock and poultry production performance, organ damage, and potential food safety risks. Developing efficient and environmentally friendly mycotoxin detoxification technologies has become an urgent need for the livestock industry.

[0003] Biological detoxification technology boasts high safety, significant efficacy, and strong environmental compatibility. Mycotoxin-degrading enzymes are gaining increasing attention due to their mild reaction conditions and lack of harmful byproducts. Polycopper oxidases, as a novel class of mycotoxin-degrading enzymes, have been applied to the detoxification of aflatoxin and zearalenone. However, natural polycopper oxidases suffer from low specific activity and insufficient catalytic efficiency, necessitating the addition of large amounts of enzyme preparations to maintain effective detoxification concentrations, significantly increasing production costs. Therefore, targeted modification of natural polycopper oxidases using protein engineering technology has become a key research direction for reducing production and application costs. Summary of the Invention

[0004] The purpose of this invention is to provide a highly active multi-copper oxidase mutant.

[0005] Another object of the present invention is to provide the application of the above-mentioned highly active multi-copper oxidase mutant in the degradation of mycotoxins.

[0006] This invention utilizes protein engineering to modify the multi-copper oxidase MCO, resulting in a mutant protein. Compared to the wild type, the mutant MCO-V286N exhibits significantly increased specific activity, thereby significantly improving the degradation efficiency of the mycotoxin zearalenone and effectively reducing production and application costs.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0008] According to the technical solution of this application, a mutant of the multi-copper oxidase MCO with an amino acid sequence as shown in SEQ ID NO:1 is provided, wherein the amino acid at position 286 is mutated to V286N, and its amino acid sequence is shown in SEQ ID NO:2.

[0009] SEQ ID NO:1

[0010] MDRRGFNRRVILGGAAVATTSLSTASEAASASTTARTAPAGGEVRRIKMYAERLSGGRMGYGFERGKASVPGPLIELNEGDTLHIEFENTMDVPVSLHVHGVDYEISSDGTRQNKSAVEPGGTRVYTWRTHKPGRREDGTWRAGSAGYWHYHDHVVGTVHGTGGI RNGLYGPVVVRRKGDILPDATHTIVFNDMTINNKPPHSGPDFEATMGDRVEIVMITHGEYYHTFHMHGHRWADNRTGILTGPDDPTRVVDTKICGPAESFGFQVIAGEGVGAGAWMYHCHVQSHSDMGMAGLFLVKKPDGTIPGYDPHEHARTASSGEKSGHAH.

[0011] SEQ ID NO:2

[0012] MDRRGFNRRVILGGAAVATTSLSTASEAASASTTARTAPAGGEVRRIKMYAERLSGGRMGYGFERGKASVPGPLIELNEGDTLHIEFENTMDVPVSLHVHGVDYEISSDGTRQNKSAVEPGGTRVYTWRTHKPGRREDGTWRAGSAGYWHYHDHVVGTVHGTGGI RNGLYGPVVVRRKGDILPDATHTIVFNDMTINNKPPHSGPDFEATMGDRVEIVMITHGEYYHTFHMHGHRWADNRTGILTGPDDPTRVVDTKICGPAESFGFQVIAGEGVGAGAWMYHCHNQSHSDMGMAGLLFLVKKPDGTIPGYDPHEHARTASSGEKSGHAH.

[0013] The present invention also relates to DNA molecules encoding the aforementioned multicopper oxidase mutant.

[0014] The present invention also relates to recombinant expression vectors comprising the above-described DNA molecules.

[0015] The present invention also relates to recombinant cells comprising the above-described DNA molecules.

[0016] The multi-copper oxidase mutant provided by this invention exhibits higher specific activity. Compared with wild-type multi-copper oxidase, the multi-copper oxidase mutant MCO-V286N provided by this invention has a 0.8-fold increased specific activity and a 0.4-fold increased degradation efficiency for the mycotoxin zearalenone, effectively reducing production and application costs. This invention has significant application value and technical importance for the widespread application of multi-copper oxidase in the field of mycotoxin detoxification in food and feed. Attached Figure Description

[0017] Figure 1 SDS-PAGE spectra of purified wild-type multi-copper oxidase MCO and multi-copper oxidase mutant MCO-V286N are shown.

[0018] Figure 2 Showing the optimal pH for wild-type multi-copper oxidase MCO and multi-copper oxidase mutant MCO-V286N;

[0019] Figure 3 This study demonstrates the effectiveness of wild-type multi-copper oxidase MCO and the multi-copper oxidase mutant MCO-V286N in degrading the mycotoxin zearalenone. Detailed Implementation

[0020] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0021] 1. Strains: Streptomyces Streptomyces thermocarboxydus 41291 was purchased from the China Agricultural Microbial Culture Collection Center;

[0022] 2. Culture medium and other reagents: Escherichia coli LB medium: 1% peptone, 0.5% yeast extract, 1% NaCl, pH 7.0.

[0023] Example 1: Construction of expression vector for polycopper oxidase and its mutant MCO-V286N

[0024] Streptomyces Streptomyces thermocarboxydusUsing the genomic DNA of 41291 as a template, the multicopper oxidase gene fragment was obtained by PCR amplification using specific primers MCO-F and MCO-R. Using the E. coli expression vector pCold I as a template, the backbone gene fragment of the expression vector was obtained by PCR amplification using specific primers pCold IF and pCold IR. After the two fragments were recovered, they were ligated by homologous recombination to obtain the recombinant expression vector pCold I-MCO. Using the recombinant expression vector pCold I-MCO as a template, two fragments (MCO-F / MCO-V286N-R, MCO-V286N-F / MCO-R) were amplified at the mutation site via PCR. The fragments were then electrophoresed on a 1% agarose gel, and the gel was cleaned to obtain the target fragment. Subsequently, using both fragments as templates, PCR amplification was performed again using primers MCO-F and MCO-R. The gel was then electrophoresed on a 1% agarose gel, and the target fragment was excised. This fragment was then recovered and ligated to the expression vector backbone via homologous recombination to obtain the mutant recombinant expression vector pCold I-MCO-V286N. The primers and sequences used for PCR amplification of the multi-copper oxidase and its mutant are shown below (italicized parts are homologous arms).

[0025] MCO-F (SEQ ID NO:3): TCCACCACGGCGAGAACCGCG;

[0026] MCO-R (SEQ ID NO:4): GTGCGCGTGCCCGGACTTCTC;

[0027] pCold IF (SEQ ID NO:5): GAGAAGTCCGGGCACGCGCAC TCTAGATAGGTAATCTCTGC;

[0028] pCold IR (SEQ ID NO:6): CGCGGTTCTCGCCGTGGTGGA CATATGCCTACCTTCGATATG;

[0029] MCO-V286N-F (SEQ ID NO:7): TACCACTGCCACAACCAGAGCCACTCC;

[0030] MCO-V286N-R (SEQ ID NO:8): GGAGTGGCTCTGGTTGTGGCAGTGGTA.

[0031] Example 2: Preparation and specific activity assay of recombinant multi-copper oxidase and its mutant MCO-V286N

[0032] The recombinant E. coli expression plasmids pCold I-MCO and pCold I-MCO-V286N, containing the obtained copper oxidase and its mutant MCO-V286N, were transformed into E. coli BL21 to obtain recombinant E. coli BL21-MCO and BL21-MCO-V286N. E. coli BL21-MCO and BL21-MCO-V286N were inoculated into 50 mL of LB medium and cultured at 37 ℃ with shaking at 200 rpm for 12 hours. Then, at a 2% ratio, they were transferred to 300 mL of LB medium and cultured at 37 ℃ with shaking at 200 rpm for approximately 4 hours (OD200). 600 ≈0.6), then add 1 mM of IPTG as an inducer, and induce culture at 16 ℃ and 200 rpm for 12 hours. Afterward, collect the bacterial cells by centrifugation. Resuspend the bacterial cells in equilibration buffer (20 mM pH 7.4 Na2HPO4-NaH2PO4, 500 mM NaCl), and lyse the cells using sonication. Remove the lysed bacterial fragments by centrifugation, purify using Ni affinity chromatography, collect the electrophoretically pure eluent, and dialyze it into protein storage medium (20 mM pH 7.0 Tris-HCl, 1 mM CuSO4). SDS-PAGE results are shown below. Figure 1 As shown.

[0033] The specific activity of purified polycopper oxidase MCO and its mutant MCO-V286N was determined. The measurement system was as follows: a total reaction volume of 200 μL, including 20 μL of 10 mM 2,2'-azido-bis-(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), 20 μL of purified polycopper oxidase MCO or its mutant MCO-V286N, and 160 μL of 0.2 M acetate-sodium acetate buffer (pH 3.0, 4.0, 5.0, 6.0, 7.0). Kinetic measurements were performed at 25℃ using a wavelength of 420 nm. Enzyme activity was defined as the amount of enzyme consumed per minute to oxidize 1 μmol of ABTS, defined as 1 U. The results are as follows. Figure 2 As shown, the optimal pH for both purified polycopper oxidase MCO and the polycopper oxidase mutant MCO-V286N is 4.0, and their specific activities under optimal pH conditions are 0.19 U / mg and 0.35 U / mg, respectively. Compared to wild-type polycopper oxidase, the specific activity of the polycopper oxidase mutant MCO-V286N provided by this invention is increased by 0.8 times.

[0034] Example 3: Recombinant multi-copper oxidase and its mutant MCO-V286N degrade the mycotoxin zearalenone

[0035] Zearalenone was dissolved in dimethyl sulfoxide to prepare a 5 mg / mL stock solution. The mycotoxin was degraded using the following reaction system: A total reaction volume of 1 mL included 2 μL of zearalenone solution (5 mg / mL), 100 μL of 10 mMABTS, 200 μL of 0.2 M pH 4.0 acetate-sodium acetate buffer, and a final concentration of 0.1 mg / mL purified multi-copper oxidase MCO or the multi-copper oxidase mutant MCO-V286N. Water was added to a final volume of 1 mL. A system without multi-copper oxidase was used as a control. The reaction was carried out at 25 °C, and the reaction was terminated by adding an equal volume of methanol after 10 minutes. The degradation rate of zearalenone was analyzed by high-performance liquid chromatography (HPLC). The liquid chromatography was performed using a Shimadzu LC-20A high-performance liquid chromatography system. The chromatographic column was a WatersXBridge C18 column (4.6×150 mm, 5 μm). The mobile phase was acetonitrile:water:methanol (46:46:8). Elution was performed under isogradient elution conditions for 15 minutes. Detection was performed using a fluorescence detector with an excitation wavelength of 274 nm and an emission wavelength of 440 nm.

[0036] The results are as follows Figure 3 As shown, the degradation rates of the mycotoxin zearalenone by the wild-type multi-copper oxidase MCO and the multi-copper oxidase mutant MCO-V286N were 66% and 95%, respectively. Compared with the wild-type multi-copper oxidase, the multi-copper oxidase mutant MCO-V286N provided by this invention has a 0.4-fold higher degradation efficiency for the mycotoxin zearalenone.

[0037] The above embodiments are only used to understand the technical solutions of this application and do not limit the scope of protection of this application.

Claims

1. Mutant multicopper oxidase characterized in that, The amino acid sequence of the multicopper oxidase mutant is shown as SEQ ID NO:

2.

2. A multicopper oxidase gene characterized in that, The multicopper oxidase gene encodes the multicopper oxidase mutant of claim 1.

3. A recombinant expression vector, characterized in that, The recombinant expression vector comprises the multicopper oxidase gene of claim 2.

4. A recombinant expression strain, characterized in that, The recombinant expression strain comprises the multicopper oxidase gene of claim 2.

5. A method for improving the specific activity and mycotoxin degrading efficiency of a multi-copper oxidase, characterized in that, The method comprises the step of mutating the amino acid at position 286 of the multicopper oxidase with the amino acid sequence shown as SEQ ID NO: 1 from V to N, wherein the mycotoxin is zearalenone.

6. Use of the multicopper oxidase mutant of claim 1 for degrading a mycotoxin, wherein the mycotoxin is zearalenone.

Images