Use of ddx39b protein inhibitors for the preparation of a medicament for the treatment of acute leukemia

Abstract

The present application relates to the use of DDX39B protein inhibitor for preparing a therapeutic drug for acute leukemia, and belongs to the technical field of biological medicine. In order to solve the problem that the current treatment scheme for acute leukemia is single and new drugs are scarce, the present application provides the use of DDX39B protein inhibitor for preparing a therapeutic drug for acute leukemia. The present application discloses that targeted inhibition of DDX39B can significantly hinder the proliferation of leukemia cells, promote cell apoptosis and differentiation, block cell cycle progression, and delay disease progression and prolong the survival of model animals in vivo. Based on the RNA binding pocket structure of DDX39B, through high-throughput drug screening, the present application first identifies a small molecule compound HMU-4051C as a DDX39B targeted inhibitor that effectively kills leukemia cells, and develops a new use of DDX39B protein inhibitor in preparing a therapeutic drug for acute leukemia.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the use of DDX39B protein inhibitors in the preparation of drugs for the treatment of acute leukemia. Background Technology

[0002] Acute leukemia is a group of malignant clonal diseases originating from hematopoietic stem cells. It is characterized by the massive proliferation and accumulation of immature hematopoietic cells in the bone marrow and peripheral blood, leading to suppression of normal hematopoietic function and infiltration into multiple tissues and organs such as the liver, spleen, and lymph nodes. Based on the origin of the leukemia cells, it is mainly divided into two categories: acute lymphoblastic leukemia (ALL) and acute myeloid leukemia (AML). ALL is more common in children, while AML is more prevalent in adults. Currently, the main treatments for acute leukemia are high-intensity chemotherapy and allogeneic hematopoietic stem cell transplantation, supplemented by general treatment measures such as nutritional support and infection prevention. Because existing treatments have limited efficacy in adult patients, and relapse rates and multidrug resistance are prominent issues, in-depth research into the molecular mechanisms of leukemia cells and the exploration of novel targeted therapy strategies are of significant clinical importance for breaking through existing treatment bottlenecks and improving the overall prognosis of patients.

[0003] DDX39B (DExD-Box Helicase 39B) encodes a highly conserved RNA helicase that employs the classic helicase folding pattern. Both its N-terminal domain 1 and C-terminal domain 2 exhibit RecA-like folds, i.e., an α / β topology, and possess ATP-binding pockets and RNA-binding grooves. The gene encoding DDX39B is located in region 31530219-31542448 of the human chromosome 6 GRCh38 genome version. DDX39B is involved in multiple steps of RNA metabolism, encompassing pre-mRNA transcription, splicing, mRNA export, ribosome biogenesis, translation initiation, and mRNA degradation. Current reports focus on the driving role of DDX39B in the occurrence and progression of solid tumors, particularly its mechanisms in colorectal and pancreatic cancer. However, the mechanisms of action of DDX39B in other tumors have not yet been reported. Summary of the Invention

[0004] To address the current limitations of single treatment options and a lack of novel drugs for acute leukemia, this invention provides the use of DDX39B protein inhibitors in the preparation of drugs for the treatment of acute leukemia.

[0005] The technical solution of this invention:

[0006] Application of DDX39B protein inhibitor in the preparation of drugs for the treatment of acute leukemia.

[0007] Furthermore, the DDX39B protein inhibitor is an artificially designed small nucleic acid gene silencing agent, sgRNA or shRNA.

[0008] Furthermore, the sequence of the sgRNA is shown in SEQ ID No:1, SEQ ID No:2 or SEQ ID No:3, and the sequence of the shRNA is shown in SEQ ID No:4.

[0009] Furthermore, the DDX39B protein inhibitor is a small molecule compound HMU-4051C, with the chemical formula C0. 42 H 48 N8O6, structural formula is

[0010] .

[0011] Furthermore, the acute leukemia is acute lymphoblastic leukemia or acute myeloid leukemia.

[0012] Furthermore, the acute lymphoblastic leukemia is either acute B-cell leukemia or acute T-cell leukemia.

[0013] The beneficial effects of this invention are:

[0014] This invention knocks out DDX39B in acute leukemia cells, significantly inhibiting tumor cell proliferation, promoting apoptosis and differentiation, and arresting cell cycle progression. Furthermore, this invention further inhibits DDX39B in vivo, delaying the development of acute leukemia and prolonging the survival time of mice. Both cell and animal experiments demonstrate that DDX39B can promote the malignant development of acute leukemia.

[0015] This invention is the first to use the RNA binding pocket of the DDX39B protein as a high-throughput drug screening site, and the first to verify that the small molecule compound HMU-4051C, as a DDX39B targeting inhibitor, can kill leukemia cells, thus developing a new use for DDX39B protein inhibitors in the preparation of drugs for the treatment of acute leukemia. Attached Figure Description

[0016] Figure 1 The image shows the Western blot results of DDX39B protein expression in bone marrow cells from healthy donors, T-ALL PDX cells, and bone marrow cells from T-ALL patients in Example 1. A, B, C, and D are all bone marrow cells from healthy donors, E is T-ALL PDX cells, and F, G, and H are all bone marrow cells from T-ALL patients.

[0017] Figure 2The image shows the WB detection results of DDX39B protein expression in healthy donor bone marrow cells and acute leukemia cell lines in Example 1. A represents bone marrow cells from healthy donors (BM-1, BM-2, and BM-3), and B represents JURKAT cells and CCRF-CEM cells from the T-ALL cell line.

[0018] Figure 3 The image shows the Western blot (WB) results of DDX39B protein expression in cells of the control group and DDX39B knockout group in Example 2.

[0019] Figure 4 This is a comparison of cell proliferation count results between the control group and the DDX39B knockout group in Example 2;

[0020] Figure 5 This is a comparison of the apoptosis rates between the control group and the DDX39B knockout group in Example 2.

[0021] Figure 6 This is a comparison diagram of cell cycle progression between the control group and the DDX39B knockout group in Example 2;

[0022] Figure 7 The image shows a comparison of Giemsa staining between the control group and the DDX39B knockout group in Example 2. A is sgScr, B is sg39B-1, C is sg39B-2, and D is sg39B-3.

[0023] Figure 8 These are in vivo fluorescence images of the dorsal and ventral sides of mice in the control group and DDX39B knockout group of Example 3. A is the dorsal side and B is the ventral side.

[0024] Figure 9 This is a comparison of ventral fluorescence intensity at 3, 4, and 5 weeks in the control group and DDX39B knockout group of Example 3.

[0025] Figure 10 This is a comparison of dorsal fluorescence intensity at 3, 4, and 5 weeks in the control group and DDX39B knockout group of Example 3.

[0026] Figure 11 The graph shows a statistical comparison of the survival time of mice in the control group (n=5) and the DDX39B knockout group (n=5) in Example 3, p=0.0039;

[0027] Figure 12 This is the protein structure model of DDX39B in Example 4. In the figure, A is the ADP binding pocket and B is the druggable RNA binding pocket.

[0028] Figure 13 This is the binding conformation of the small molecule compound HMU-4051C to the DDX39B protein in the virtual screening of Example 4;

[0029] Figure 14 This is a 2D chemical formula view of the structure of the small molecule compound HMU-4051C in Example 4;

[0030] Figure 15 This is a surface plasmon resonance sensing image of HMU-4051C and DDX39B proteins in Example 5;

[0031] Figure 16 The images shown are WB detection results and melting curves for cell thermal drift assay in Example 6. A is the WB detection result image, and B is the melting curve.

[0032] Figure 17 This is a comparison of cell viability of leukemia cells in different groups after treatment with different concentrations of HMU-4051C in Example 7.

[0033] Figure 18 This is a comparison of cell viability of healthy donor bone marrow cells, T-ALL PDX cells, and T-ALL patient bone marrow cells after treatment with different concentrations of HMU-4051C in Example 7.

[0034] Figure 19 This is a comparison of cell proliferation counts of Jurkat cells after treatment with different concentrations of HMU-4051C in Example 8;

[0035] Figure 20 This is a comparison of the apoptosis rate of Jurkat cells after treatment with different concentrations of HMU-4051C in Example 8. Detailed Implementation

[0036] The technical solution of the present invention will be further described below with reference to embodiments, but it is not limited thereto. Any modifications or equivalent substitutions to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention should be covered within the protection scope of the present invention. In the following embodiments, the process equipment or apparatus not specifically specified are all conventional equipment or apparatus in the art. Unless otherwise specified, the raw materials used in the embodiments of the present invention are all commercially available; unless otherwise specified, the technical means used in the embodiments of the present invention are all conventional means well known to those skilled in the art.

[0037] Example 1

[0038] This embodiment collected bone marrow cells from healthy donors, bone marrow cells from T-ALL patients, and T-ALL PDX (human tissue xenograft) cells. Western blot analysis was used to detect the protein expression level of DDX39B in each group of cells. The PDX cells were derived from mouse spleen cells extracted after transplanting patient cells into immunodeficient mice via the tail vein. The specific steps are as follows:

[0039] Wash each collected cell group twice with pre-cooled PBS. After discarding the PBS, add a pre-prepared lysis buffer consisting of RIPA (radioimmunoprecipitation lysis buffer) and PMSF (phenylmethylsulfonyl fluoride) at a volume ratio of 100:1. Lyse on ice for half an hour, then collect the cells and centrifuge at 12000g for 15 min at 4°C. Following the instructions of the Beyotime BCA (diquinoline carboxylic acid) protein quantification kit, measure the absorbance of the samples using a microplate reader to determine the protein concentration.

[0040] Further, 5× Loading Buffer was mixed with the protein sample at a volume ratio of 1:4, and the mixture was boiled at 100℃ for 5 min to denature the protein. Electrophoresis was then performed using a Tianneng electrophoresis apparatus at a constant voltage of 100V for 60 min. Appropriately sized NC (nitrocellulose) membranes were cut, and the clamps were installed sequentially in the transfer buffer. The membranes were then placed in the transfer tank and rotated at constant flow for 90 min in pre-cooled transfer buffer. A 5% concentration of milk was prepared using TBST, and the transferred membranes were placed in the milk and placed on a shaker at room temperature for 2 h. The protein bands were then placed in the corresponding primary antibody and incubated overnight at 4℃. The next day, the secondary antibody was incubated on a shaker at room temperature for 1 h. Subsequently, the bands were developed and analyzed using chemiluminescent developing solution to obtain the protein expression trend.

[0041] The results are as follows Figure 1 and Figure 2 As shown, compared with healthy donor cells in the control group, the expression of DDX39B protein was increased in the T-ALL group.

[0042] Example 2

[0043] This embodiment constructed a stable T-ALL cell model with DDX39B knockout and examined DDX39B expression, cell proliferation, apoptosis, cell cycle, and cell differentiation in the cell model.

[0044] In this embodiment, three sgRNA sequences were designed based on the DNA sequence of the DDX39B gene in the NCBI database, namely...

[0045] As shown in SEQ ID No:1, sg39B-1: CTCAAAGCCACAGTCGACAA;

[0046] As shown in SEQ ID No:2, sg39B-2:TGTCTTTCCCATGCCCGACT;

[0047] As shown in SEQ ID No:3, sg39B-3:TGGCTCCAGCTGTTGCAGTG.

[0048] The steps for constructing the DDX39B knockout Jurkat cell model are as follows:

[0049] (1) 293T (human embryonic kidney cell line) were seeded into cell culture dishes using DMEM medium containing 10% fetal bovine serum. After 24 hours of culture, the cell confluence was 70-80%. Using opti-MEM medium and PEI reagent, three different target plasmids (lentiCRISPRv2-hygro-DDX39B, lentiCRISPRv2, lentiCRISPRv2, lentiCRISPRv2, lentiCRISPRv2, and lentiCRISPRv2) containing sg39B-1, sg39B-2, or sg39B-3, packaging plasmid psPAX2, and VSV-G were transfected into 293T cells with a confluence of 50%-60% at a mass ratio of 20:13.3:6.7. The medium was replaced with fresh medium after 12 hours. The lentivirus supernatant in the medium was collected at 48 hours and 72 hours after the addition of fresh medium.

[0050] (2) Jurkat cells, a human acute T-lymphoblastic leukemia cell line in the logarithmic growth phase, were cultured in 1640 medium containing 10% fetal bovine serum. The medium was replaced with fresh medium the day before infection. 1 ml of lentiviral medium containing 2 μg of polybrene was added and gently mixed. After culturing at 37°C in a 5% CO2 incubator for 48 hours, the medium was changed and an appropriate concentration of puromycin was added for cell resistance selection (the puromycin concentration was set at the lowest concentration that could kill all uninfected viruses within 48 hours). After growth selection, stable DDX39B knockout Jurkat cell lines sg39B-1, sg39B-2, and sg39B-3 were obtained.

[0051] Jurkat cells were infected with an empty vector lentivirus without an sgRNA sequence using the same method to obtain control group Jurkat cells sgScr.

[0052] I. DDX39B Expression in a DDX39B Knockout Jurkat Cell Model

[0053] Jurkat cells sg39B-1, sg39B-2, and sg39B-3 after DDX39B knockout and Jurkat cells sgScr from the control group were collected, and the protein expression level of DDX39B was detected by Western blot experiment, with the specific method being the same as in Example 1.

[0054] The results are as follows Figure 3 As shown, compared with the control group sgScr, with the knockout of DDX39B, the expression of DDX39B protein in the knockout groups sg39B-1, sg39B-2 and sg39B-3 almost disappeared.

[0055] II. Cell proliferation experiment:

[0056] Jurkat cells sg39B-1, sg39B-2, and sg39B-3 after DDX39B knockout, and Jurkat cells sgScr from the control group were collected and adjusted to 1×10⁻⁶. 5 Seeds were seeded per well into 6-well plates, with 3 replicates per group. The plates were then incubated in a cell culture incubator. Every 2 days, cells were stained with trypan blue and counted, for a total of 10 days.

[0057] The results are as follows Figure 4 As shown, compared with the control group sgScr, the cell proliferation of sg39B-1, sg39B-2 and sg39B-3 in the knockout group was inhibited.

[0058] III. Apoptosis Experiment:

[0059] Jurkat cells (sg39B-1, sg39B-2, sg39B-3) after DDX39B knockout and control Jurkat cells (sgScr) were collected. After washing with pre-cooled PBS, apoptosis detection was performed using an apoptosis detection kit. The fluorescence signals of Annexin V-FITC and PI-FE were measured by flow cytometry, and the data were analyzed using FlowJo software.

[0060] The results are as follows Figure 5 As shown, compared with the control group sgScr, the knockout groups sg39B-1, sg39B-2 and sg39B-3 showed increased apoptosis.

[0061] IV. Cell cycle progression analysis:

[0062] The PI staining method was used to detect DNA content in order to analyze cell cycle progression. The simplified procedure is as follows:

[0063] DDX39B knockout Jurkat cells (sg39B-1, sg39B-2, sg39B-3) and control Jurkat cells (sgScr) were collected, fixed with 80% ice-cold methanol, and incubated overnight at -20°C. The methanol was discarded, and the cells were resuspended in 2-3 ml of PBS containing 0.5% BSA (bovine serum albumin) and incubated for 5 minutes. After centrifugation, the cell pellet was resuspended in 0.4-0.5 ml of freshly prepared staining solution (PBS containing 0.1% Triton X-100, 200 μg / mL RNase A, and 20 μg / mL PI). The samples were wrapped in aluminum foil to protect them from light and incubated at room temperature (RT) for 30 minutes, followed by flow cytometry analysis. DNA content was detected using flow cytometry, and data were acquired and analyzed using ModFit software.

[0064] The results are as follows Figure 6As shown, compared with the control group sgScr, the cell cycle arrest of the knockout groups sg39B-1, sg39B-2 and sg39B-3 was in the G0 / G1 phase.

[0065] V. Giemsa staining:

[0066] Smears of DDX39B knockout Jurkat cell suspensions (sg39B-1, sg39B-2, sg39B-3) and control group Jurkat cell suspensions (sgScr) were prepared onto glass slides, fixed with anhydrous methanol, dried, stained with working solution, gently rinsed with pH 7.0 buffer, and then air-dried for microscopic observation.

[0067] The results are as follows Figure 7 As shown, compared with the control group sgScr, the knockout groups sg39B-1, sg39B-2 and sg39B-3 showed significant cell differentiation.

[0068] Example 3

[0069] This embodiment constructs a cell line-derived allogeneic tumor model (CDX), and the specific method is as follows:

[0070] Jurkat cells, a human acute T-lymphoblastic leukemia cell line carrying luciferase-Neo, were selected using G418 sulfate. Following the cell model construction method in Example 2, Jurkat cells (sh39B-2) with DDX39B knockdown were constructed using the shRNA (sh39B-2) plasmid. Similarly, empty control Jurkat cells (shEV) without the shRNA sequence were constructed using an empty plasmid. Subsequently, 3 million cells of each type were injected into immunodeficient mice (NCG) via the tail vein, and the results were analyzed after three weeks.

[0071] The shRNA sequence is shown in SEQ ID No:4 sh39B-2:CCGCAAGTTCATGCAAGAT.

[0072] I. The bioluminescence imaging operation procedure is as follows:

[0073] Anesthesia was induced by tribromoethanol. After mice were fully anesthetized, D-fluorescein diluted with PBS (150 mg / kg) was injected intraperitoneally. Images were acquired using a small animal in vivo imaging system and the data were analyzed using imaging software.

[0074] The results are as follows Figure 8 , Figure 9 and Figure 10 As shown, compared with the control group shEV, the fluorescence signal in the DDX39B knockdown group mice was significantly reduced.

[0075] 2. Record the survival period of mice in each group.

[0076] The results are as follows Figure 11 As shown, compared with the control group shEV, the lifespan of mice in the DDX39B knockdown group was significantly prolonged.

[0077] Example 4

[0078] In this embodiment, DDX39B protein was used as the drug target, and a targeted inhibitor of DDX39B protein was obtained through high-throughput virtual screening.

[0079] Figure 12 For the protein structure model of DDX39B, such as Figure 12 As shown in Figure B, the orange structure represents the RNA-binding pocket of the druggable DDX39B protein. Drug screening using DDX39B protein as a target includes the following steps:

[0080] (1) Construct a library of drug compounds to be screened using already marketed drug compounds;

[0081] (2) Using a high-throughput virtual screening system for receptors, with DDX39B as the target receptor, molecules in the drug compound library were respectively coupled to RNA binding sites;

[0082] (3) The drug compounds are ranked according to the strength of their interaction with the target receptor; the top-ranked drug compounds are used as the subjects of further research for subsequent drug development studies.

[0083] Figure 13 The diagram shows the binding conformation of small molecule compounds obtained through virtual screening with DDX39B protein; the green conformation in the figure represents the DDX39B protein. Figure 13 As shown, this small molecule compound forms a hydrogen bond with each of R123, R175, and N345, and forms a π-hydrogen atom stacking effect with G174.

[0084] Figure 14 This is a 2D chemical formula view of the small molecule compounds obtained by virtual screening. The arrows represent hydrogen bonds, and the dashed lines represent the π-hydrogen atom stacking effect.

[0085] The small molecule compound screened in this embodiment was obtained from ChemDiv, with molecular ID H027-4051C and chemical formula C. 42 H 48 N8O6, molar mass 833.82, structural formula is

[0086] .

[0087] In this embodiment, a small molecule compound that can bind to the DDX39B protein was obtained through high-throughput virtual screening, named HMU-4051C, and used as the research object for subsequent drug development research.

[0088] Example 5

[0089] In this embodiment, the interaction between HMU-4051C and DDX39B proteins was investigated using surface plasmon resonance (SPR) detection.

[0090] The surface plasmon resonance detection method includes the following steps:

[0091] (1) Hold the CM5 chip and gently push it into the slot according to the arrow on the chip, and finally close the chip;

[0092] (2) Activate chip channel 2 with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide and N-hydroxysuccinimide at a flow rate of 10 μL / min;

[0093] (3) Dilute the ligand protein with sodium acetate to 50 μg / mL and fix the protein in channel 2 of the chip at a flow rate of 10 μL / min;

[0094] (4) Seal the channel with ethanolamine at a flow rate of 10 μL / min;

[0095] (5) Repeat steps (2)-(4) for channel 1 as a reference, except that protein-free acetate buffer is used in step (3);

[0096] (6) Prepare a 5% DMSO concentration correction solution by mixing 4.5% and 5.8% mother liquor;

[0097] (7) HMU-4051C was diluted to several concentrations in a 96-well plate and coupled to the target protein from low to high concentrations via a chip. The flow rate was 30 μL / min and the duration was 150 s.

[0098] (8) After each concentration point is passed, the chip is regenerated for 5 min with 10 mM glycine hydrochloride (pH 2.0) solution. This process is repeated until all the corresponding concentrations of the analytes have been run.

[0099] (9) The data were globally fitted to the 1:1 Langmuir binding model by using Biacore Insight evaluation software (Cytiva, Marlborough, MA, USA) to obtain the binding and dissociation constants.

[0100] The results are as follows Figure 15As shown, HMU-4051C interacts with DDX39B protein and has a dissociation constant (KD) of 4.17e-06M.

[0101] Example 6

[0102] In this embodiment, the interaction between HMU-4051C and DDX39B proteins was investigated using a cell thermal shift assay (CETSA).

[0103] In this embodiment, Jurkat cell lines were treated with low concentrations of HMU-4051C, and the levels of soluble proteins were detected at different temperature gradients (37–62°C). Cells were treated with DMSO, the solvent of HMU-4051C, as a negative control. The specific experimental steps are as follows:

[0104] (1) Jurkat cells were treated with 10 μM HMU-4051C for 6 h;

[0105] (2) Collect cells and resuspend the cell pellet in 0.8 mL of ice-cold PBS containing protease inhibitors;

[0106] (3) Take 100 µL of each and dispense it into seven 0.2 mL PCR tubes (approximately 3 × 10⁻⁶). 6 ~4×10 6 (cells / tube), 7 temperatures each for HMU-4051C and DMSO (37℃–65℃);

[0107] (4) Use the PCR instrument to set different temperature points (37℃, 40℃, 47℃, 52℃, 56℃, 60℃, 65℃), put the PCR tube into the PCR instrument and heat for 3 min, take it out immediately and let it stand at room temperature for 3 min, and freeze the sample with liquid nitrogen (the temperature and reaction time must be kept constant during the process).

[0108] (5) Cell lysis: The cells were repeatedly frozen and thawed twice between liquid nitrogen and a heating module set to 25°C. After each thawing, the cells were shaken and mixed, and the cell lysate was transferred to a 1.5 mL centrifuge tube. The cells were centrifuged at 4°C and 20,000 × g for 20 min. After centrifugation, the sample was placed on ice.

[0109] (6) The protein expression level of DDX39B in each group of cells was detected by Western blot experiment;

[0110] (7) Use ImageJ software to quantify the specific protein bands obtained by different antibody color development for data processing and analysis.

[0111] The results are as follows Figure 16As shown, compared with the DMSO control group, the intensity of the specific band of DDX39B gradually decreased with increasing temperature. Due to the stabilizing effect of HMU-4051C on the target protein, the melting curve shifted significantly to the right after drug treatment, proving that the small molecule compound HMU-4051C can bind to the DDX39B protein.

[0112] Example 7

[0113] In this embodiment, the small molecule compound HMU-4051C was used as a targeted inhibitor of DDX39B protein. The cell viability of different leukemia cell lines, healthy donor bone marrow cells, T-ALL patient bone marrow cells, and T-ALL PDX cells under different concentrations of HMU-4051C treatment was detected.

[0114] The specific testing methods are as follows:

[0115] Human acute T-lymphoblastic leukemia cell lines Jurkat, CCRF-CEM, Jurkat-r, human acute B-lymphoblastic leukemia cell lines RS4;11, human acute myeloid leukemia cell lines Kasumi-1, human acute myeloid leukemia cell lines MOLM-13, healthy donor bone marrow cells, T-ALL patient bone marrow cells, and T-ALL PDX cells were treated with HMU-4051C at concentrations of 0 μM, 2.5 μM, 5 μM, 7.5 μM, and 10 μM, respectively. All cells were cultured in 96-well plates with 5000 cells per well. Cell viability was assessed using CellTiter-Glo (CTG) reagent after 48 h, and data were obtained and analyzed using a microplate reader. The T-ALL PDX cells in this example were the same as in Example 1.

[0116] The results are as follows Figure 17 As shown, the half-maximal inhibitory concentrations (IC50) of HMU-4051C for Jurkat cells and CCRF-CEM cells were 9.21 μM and 9.45 μM, respectively; Figure 18 The HMU-4051C shown has minimal killing effect on bone marrow cells from healthy donors, and its IC50 for bone marrow cells from T-ALL patients is 4.8 μM.

[0117] Example 8

[0118] In this embodiment, the small molecule compound HMU-4051C was used as a targeted inhibitor of DDX39B protein to detect the cell proliferation and apoptosis of Jurkat cells, a human acute T-lymphoblastic leukemia cell line, under different concentrations of HMU-4051C treatment.

[0119] I. Cell proliferation experiment:

[0120] Adjust Jurkat cells to 1×105 Jurkat cells were seeded into 6-well plates at concentrations of 2.5 μM, 5 μM, and 7.5 μM HMU-4051C and DMSO solvent during the subsequent culture process. Each group was set up with 3 replicates and placed in a cell culture incubator. Every 2 days, cells were stained with trypan blue and counted for a total of 10 days.

[0121] The results are as follows Figure 19 As shown, compared with DMSO, the inhibition of cell proliferation in the treatment group gradually worsened with the increase of HMU-4051C concentration.

[0122] II. Apoptosis Experiment:

[0123] Adjust Jurkat cells to 1×10 5 Jurkat cells were seeded per well in 6-well plates and subsequently treated with 2.5 μM, 5 μM, and 7.5 μM HMU-4051C and DMSO solvents during culture. After 48 h, cells were harvested, washed once with pre-cooled PBS, and analyzed using an apoptosis detection kit. The fluorescence signals of Annexin V-FITC and PI-FE were measured by flow cytometry, and the data were analyzed using FlowJo software.

[0124] The results are as follows Figure 20 As shown, compared with DMSO, the number of apoptotic cells in the HMU-4051C group gradually increased with the increase of HMU-4051C concentration.

Claims

1. The application of DDX39B protein inhibitor in the preparation of drugs for the treatment of acute leukemia, characterized in that, The DDX39B protein inhibitor is a small nucleic acid gene silencing agent, sgRNA or shRNA, with the sequence of sgRNA as shown in SEQ ID No:1, SEQ ID No:2 or SEQ ID No:3, and the sequence of shRNA as shown in SEQ ID No:

4. The acute leukemia mentioned is acute T-lymphoblastic leukemia.

2. The application of DDX39B protein inhibitor in the preparation of drugs for the treatment of acute leukemia, characterized in that, The DDX39B protein inhibitor is a small molecule compound, HMU-4051C, with the chemical formula C. 42 H 48 N8O6, structural formula is ； The acute leukemia is acute lymphoblastic leukemia or acute myeloid leukemia, specifically acute B-cell leukemia or acute T-cell leukemia.

Images