Application of estramustine sodium phosphate in preparation of medicine for treating rotavirus

Estrogenus phosphate sodium (EMP) has been prepared in various drug forms. By inhibiting rotavirus transcription and reducing VP6 protein expression, it has solved the global problem of lacking specific anti-rotavirus drugs and achieved effective viral inhibition.

CN121059618APending Publication Date: 2025-12-05NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511418945.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-30
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

There are currently no approved specific anti-rotavirus drugs globally, and existing vaccines have limitations. Developing effective drugs with antiviral mechanisms is an urgent need.

Method used

Using estradiol phosphate sodium (EMP) as the active ingredient, the drug is prepared in the form of tablets, sprays, granules, capsules, oral liquids, injections, and suspensions to inhibit rotavirus transcription and reduce VP6 protein expression.

Benefits of technology

Estrustin sodium phosphate almost completely inhibits rotavirus replication within safe concentrations, significantly suppresses viral transcription and reduces VP6 protein expression, providing effective anti-rotavirus treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121059618A_ABST
    Figure CN121059618A_ABST
Patent Text Reader

Abstract

The invention discloses an application of estramustine sodium phosphate (EMP) in preparation of a drug for treating rotavirus, and discovers that the estramustine sodium phosphate (EMP) can significantly inhibit replication of rotavirus and can play an excellent anti-rotavirus effect at a lower IC50; as the biological safety of the EMP is excellent, it is found that the EMP can almost completely inhibit rotavirus replication within the safe concentration, and it is found that the EMP not only significantly inhibits transcription of rotavirus, but also can reduce expression of VP6 protein. Thus, EMP can be used to treat rotavirus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to the application of estramustine phosphate sodium in the preparation of a drug for treating rotavirus. BACKGROUND

[0002] Rotavirus (RV) is a pathogenic microorganism that can be transmitted through water sources and is recognized by the World Health Organization (WHO) as a global cause of diarrhea in children under the age of five. It is a major medical pressure, economic loss and human impact. Vaccination is crucial for infants and young children, as it not only effectively prevents viral infection, but also significantly reduces the disease burden caused by it. Rotavirus vaccine has shown significant public health value in global child immunization programs, and vaccination can effectively prevent severe rotavirus diarrhea, with a protection rate of 70-90%, and significantly reduce the risk of infant hospitalization and death due to diarrhea. However, there are certain limitations to the vaccine, and oral attenuated live vaccines can cause a series of adverse reactions. Therefore, the development of specific drugs with antiviral mechanisms is still an urgent need.

[0003] Estramustine phosphate sodium (EMP) is an orally active anti-microtubule chemotherapy agent, and its main application field is the treatment of advanced and hormone-resistant prostate cancer. It binds to microtubule-associated protein (MAP) or tubulin, causing microtubule depolymerization, thereby disrupting the integrity of the cytoskeleton, affecting cell morphology, material transport and signal transduction.

[0004] There is no specific anti-rotavirus drug approved globally, and broad-spectrum anti-rotavirus drugs can deal with variant recombinant strains, providing a "second line of defense" for prevention and control. SUMMARY

[0005] To solve the above technical problems, the present application provides the application of estramustine phosphate sodium in the preparation of a drug for treating rotavirus.

[0006] The estramustine phosphate sodium also includes a pharmaceutically acceptable salt of estramustine phosphate sodium.

[0007] The estramustine phosphate sodium also includes a pharmaceutically acceptable carrier and / or excipient of estramustine phosphate sodium.

[0008] The drug includes one or more of tablets, sprays, granules, capsules, oral liquids, injections, suspensions containing the estramustine phosphate sodium.

[0009] The estramustine phosphate sodium can inhibit the transcription of rotavirus.

[0010] The estramustine sodium phosphate can reduce the expression level of rotavirus VP6 protein.

[0011] Compared with the prior art, the present application finds that estramustine phosphate sodium (EMP) can significantly inhibit rotavirus replication and can play an excellent anti-rotavirus effect at a lower concentration; since EMP has excellent biological safety, the present application finds that EMP can almost completely inhibit rotavirus replication within its safe concentration, and finds that EMP not only significantly inhibits the transcription of rotavirus, but also can reduce the expression of VP6 protein. Therefore, EMP can be used for treating rotavirus. BRIEF DESCRIPTION OF DRAWINGS

[0012] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced as follows: Figure 1 The figure is a comparison chart of the toxic effects of different concentrations of compound EMP on MA104 cells. In the figure, 1 μM, 5 μM, 10 μM, 20 μM, 30 μM and 50 μM represent that the MA104 cells are treated with 1 μM, 5 μM, 10 μM, 20 μM, 30 μM and 50 μM of EMP respectively.

[0013] Figure 2 The figure is a comparison chart of the inhibition of different concentrations of compound EMP on the expression level of RV RNA.

[0014] Figure 3 The figure is a comparison chart of the inhibition of different concentrations of compound EMP on the expression level of RV VP6 protein.

[0015] Figure 4 The figure is a fluorescence chart of the inhibition of different concentrations of compound EMP on rotavirus. DETAILED DESCRIPTION

[0016] In order to make the purpose, technical solutions and advantages of the present application more clear and obvious, the present application will be further described in detail below in combination with embodiments. The specific embodiments described herein are only used to explain the present application and do not limit the present application.

[0017] The present application uses MA104 cells (monkey fetal kidney cells) and is cultured in a 37 ℃, 5% CO2 incubator. The compound used is purchased from MedChemExpress (USA) Biotechnology Company and has a molecular structure as shown in the following formula:

[0018] The different concentrations of EMP used in the present application were first diluted to 10 mM in DMSO for storage, and then diluted to 1 μM, 5 μM, 10 μM, 20 μM and 50 μM in DMEM medium, respectively. Other related reagents used, if not specified, were commercially available drugs, and the methods involved, if not specified, were known methods.

[0019] The rotavirus strain used was porcine rotavirus XXW2023 (G9P[7]) (NCBI sequence number: PQ384402-PQ384412), isolated and preserved by the laboratory, and subcultured on MA104 cells.

[0020] Example 1 Toxicity of EMP in MA104 cells MA104 cells were inoculated in 96-well plates at 100 μL of cell suspension per well, using DMEM medium containing 10% FBS, 1% amphotericin and 1% gentamicin, with a total volume of 0.1 mL of medium per well, and cultured until the cell density was about 90%. EMP was diluted with medium to solutions of different concentrations of 1 μM, 5 μM, 10 μM, 20 μM, 30 μM and 50 μM as experimental drug, and a blank control group was set. 10 μL of EMP solution of the corresponding concentration was added to each well, and incubated at 37 ℃, 5% CO2 for 24 h. 10 μL of CCK-8 solution was added to each well under light-proof conditions, and incubated in a 37 ℃ incubator for 4 h. The absorbance at 450 nm was measured using a microplate reader. The cell survival rate was calculated according to the following formula: cell survival rate = [(As-Ab] / (Ac-Ab)] ×100%, to determine the optimal drug concentration.

[0021] The results are shown in Figure 1 As shown in the table, EMP had no significant toxicity to MA104 cells at a concentration of 50 μM.

[0022] Example 2 Effect of compound EMP on RNA level during rotavirus (RV) infection and replication MA104 cells were cultured in 12-well plates with DMEM + 10% FBS medium (2×10 6The experimental group was inoculated with rotavirus (MOI = 0.01), and then treated with different concentrations (10, 20, 50 μM) of EMP after adsorption for 2 h at 37℃ and 5% CO2; the infection control group was treated with rotavirus (MOI = 0.01) mixed with DMSO; and the blank control group was not treated. All the cell culture plates were incubated at 37℃ and 5% CO2 for 24 h. After incubation, total RNA was extracted from the cells using the Trizol method and reverse-transcribed into cDNA. The relative expression of the RV NSP3 gene was detected by RT-qPCR using the RV NSP3 gene as the detection target. The total volume of the RT-qPCR reaction system was 20 μL, including 10 μL of Premix Ex Taq (SYBR qPCR), 0.4 μL of upstream primer, 0.4 μL of downstream primer, and 2 μL of template cDNA, and the rest was supplemented with sterile deionized water. The reaction program was set as follows: 95℃ for 30 s; followed by 95℃ for 5 s, 60℃ for 30 s, for a total of 40 cycles.

[0023] The primer sequences used were as follows: RV-NSP3 upstream primer: ACCATCTACACATGACCCTCTATGAG, RV-NSP3 downstream primer: ACATAACGCCCCTATAGCCATTTA; β-actin upstream primer: GTGATCTCCTTCTGCATCCTGTC, β-actin downstream primer: CTCCATCATGAAGTGCGACGT.

[0024] After MA104 cells were treated with different concentrations of EMP after rotavirus infection, the mRNA transcription level of the virus was as shown in Figure 2 Compared with the control group, the expression level of rotavirus mRNA in MA104 cells decreased significantly with the increase of the concentration of EMP, indicating that EMP can effectively inhibit the replication of rotavirus in a dose-dependent manner; when the concentration of EMP was 50 μM, the replication of rotavirus was almost completely inhibited.

[0025] Example 3: Effect of compound EMP on the expression of VP6 protein of rotavirus (RV) in cells: MA104 cells were inoculated at 2×10 6The cells were inoculated in 12-well plates and cultured using DMEM + 10% FBS medium. The experimental group was infected with rotavirus (MOI = 0.01), and after adsorption for 2 h in a 5% CO2condition, different concentrations (10, 20, 50 μM) of EMP were added for treatment; the infection control group was treated with a rotavirus (MOI = 0.01) mixed with DMSO; and the blank control group was not treated. The cell plates were placed in a 37 ℃, 5% CO2condition for further culture for 24 h. After the culture was completed, the supernatant was discarded, the cells were rinsed with PBS three times, 100 μL of RIPA lysis solution was added to each well, and lysis was performed at 4 ℃ for 15 min. Subsequently, 5x SDS-PAGE loading buffer was added, and the protein was denatured at 100 ℃ for 10 min, and then centrifuged at 12,000 r / min for 5 min. After the protein samples were homogenized in concentration, they were loaded into the gel loading well, and electrophoresis was performed at 120 V for about 60 min, and terminated when the bromophenol blue indicator migrated to the edge of the gel. The protein was transferred to a 0.2 μm nitrocellulose membrane (NC membrane) using an electrotransfer apparatus at a constant current of 330 mA for 1 h. Then, 5% skim milk was used for room temperature blocking for 1 h, the blocking solution was discarded, and 1x PBST was used to clean the NC membrane. Mouse anti-rotavirus VP6 monoclonal antibody (1:2000 dilution) was added as a primary antibody, and incubated at 4 ℃ overnight. Then, the membrane was washed with 1x PBST for 3 times, 10 min each time, and then the corresponding secondary antibody was added, and incubated at room temperature for 1 h, and the membrane was further washed with 1x PBST for 3 times, 10 min each time. Finally, ECL chemiluminescence substrate was used for development, and the expression level of VP6 protein was quantitatively analyzed by an imaging system.

[0026] The results are shown in Table 1. Figure 3 As shown in Table 1, in MA104 cells, compared with the control group, the expression of rotavirus VP6 protein decreased with the increase of the concentration of EMP, further proving that EMP can inhibit the replication of rotavirus in a dose-dependent manner.

[0027] Example 4: Effect of EMP on the results of immunofluorescence detection of rotavirus in cells: MA104 cells were cultured in 12-well plates using DMEM + 10% FBS medium (2x10 6The experimental group was inoculated with rotavirus (MOI = 0.01), adsorbed for 2 h under the condition of 5% CO2, and then treated with different concentrations (10, 20, 50 μM) of EMP; the infection control group was treated with rotavirus (MOI = 0.01) mixed with DMSO, as the DMSO group; the blank control group was not treated, as the Mock group. All cell culture plates were placed in a 37 ℃, 5% CO2 incubator for 24 h. After the culture ended, the supernatant was discarded, the cells were washed with PBS 3 times, and then pre-cooled methanol was added for 10 min of fixation at 4 ℃. Discard the methanol, block with 5% skim milk at room temperature for 1 h. Discard the blocking solution, add the primary antibody working solution prepared with 2% BSA (mouse anti-rotavirus VP6 monoclonal antibody, 1:2000 dilution), and incubate overnight at 4 ℃. Discard the primary antibody, wash with PBS 3 times, then add the FITC-labeled secondary antibody, and incubate at 37 ℃ for 1 h in the dark. Discard the secondary antibody, wash with PBS 3 times, and finally observe the fluorescence signal under a fluorescence microscope.

[0028] The results are shown in Table 1. Figure 4 As shown in Table 1, in MA104 cells, the fluorescence of rotavirus decreased significantly with the increase of the concentration of EMP, indicating that EMP can inhibit the replication of rotavirus in a dose-dependent manner.

[0029] In summary, EMP can be used as the only active ingredient to prepare a drug for preventing and treating rotavirus. Of course, the prepared drug not only contains EMP, but also includes a pharmaceutically acceptable carrier and / or adjuvant of EMP; the dosage form of the drug is one or several of tablets, sprays, granules, capsules, oral liquids, injections, suspensions.

[0030] It should be noted that the above examples are only used to illustrate the technical solutions of the present application and are not limiting. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced by equivalents without departing from the spirit and scope of the technical solutions of the present application, which should be covered in the scope of the claims of the present application.

Claims

1. Use of estramustine sodium phosphate in the preparation of a drug for treating rotavirus.

2. Use according to claim 1, characterized in that: The estramustine sodium phosphate also includes a pharmaceutically acceptable salt of estramustine sodium phosphate.

3. Use according to claim 1, characterized in that: The estramustine sodium phosphate also includes a pharmaceutically acceptable carrier and / or adjuvant of estramustine sodium phosphate.

4. Use according to claim 3, characterized in that: The drug includes one or several of tablets, sprays, granules, capsules, oral liquids, injections, suspensions containing the estramustine sodium phosphate.

5. Use according to claim 1 or 2, characterized in that: The estramustine sodium phosphate can inhibit the transcription of rotavirus.

6. Use according to claim 1 or 2, characterized in that: The estramustine sodium phosphate can reduce the expression level of rotavirus VP6 protein.