Rapeseed gene bnabzip1 and application thereof in prevention and control of rapeseed sclerotinia rot

Abstract

The application belongs to the field of plant biotechnology and plant molecular breeding, and particularly relates to Brassica napus BnabZIP1 Gene and application thereof in prevention and control of oilseed rape sclerotinia stem rot BnabZIP1 The sgRNA of the gene is used to construct a gene editing vector, and the agrobacterium is transformed, then the Brassica napus is transfected, and it is found that BnabZIP1 The homozygous mutant plant after the gene knockout has stronger resistance to the sclerotinia stem rot. BnabZIP1 The gene can be used as a molecular marker or a genetic engineering improvement target for the resistance to the sclerotinia stem rot, is used for screening and creating the disease-resistant oilseed rape varieties, and has a good molecular breeding application prospect.

Description

Technical Field

[0001] This invention belongs to the fields of plant biotechnology and plant molecular breeding, specifically relating to Brassica napus. BnabZIP1 Genes and their application in the control of sclerotinia stem rot in rapeseed. Background Technology

[0002] Brassica napus ( Brassica napus Rapeseed is one of the world's most important oilseed crops, and its yield and quality have long been severely threatened by Sclerotinia stem rot (SSR). SSR is caused by Sclerotinia stem rot (SSR). Sclerotinia sclerotiorum Sclerotinia stem rot is a disease that frequently occurs in major rapeseed producing areas such as China, Canada, and Europe. Infection with Sclerotinia stem rot impairs rapeseed growth and is accompanied by a significant decrease in grain quality and oil content. In recent years, with changes in ecological conditions and the widespread adoption of low-erucic acid and low-erucic acid rapeseed, the incidence of Sclerotinia stem rot in rapeseed has shown an increasing trend. Current control methods mainly rely on chemical fungicides, but their long-term effectiveness is limited by factors such as the timing of application, environmental policies, and the pathogen's resistance to fungicides. Therefore, developing rapeseed varieties resistant to Sclerotinia stem rot is an important approach to sustainable control.

[0003] Rapeseed is an allotetraploid (AACC, 2n=38) crop with a complex and redundant genome, increasing the difficulty of accurately identifying functional genes. Although genome-wide association analysis has located disease resistance-related loci on chromosomes such as A05, C04, and C08, few clearly defined functional genes have been identified. Currently, the available germplasm resources resistant to sclerotinia stem rot are extremely limited, posing a challenge to the breeding of resistant varieties.

[0004] With the development of molecular biology and genetic engineering technologies, CRISPR / Cas9 gene editing technology has been widely used in crop trait improvement in recent years due to its advantages such as high efficiency, high specificity, and ease of operation. This technology can generate stable gene deletion and insertion mutations without introducing exogenous DNA, thereby obtaining homozygous mutants of the target gene in a relatively short time. In disease resistance breeding, CRISPR / Cas9 has been successfully used to knock out negative regulatory factors or modify susceptible genes, thereby improving crop resistance to pathogens such as fungi, bacteria, and viruses, providing a new approach and powerful tool for the rapid creation of rapeseed sclerotinia resistant varieties. Summary of the Invention

[0005] To address the problems of insufficient resistance to Sclerotinia stem rot and lack of functional genes in existing technologies, this invention provides a novel Sclerotinia stem rot resistance gene for rapeseed. BnabZIP1 The study clarified its role and application methods in the prevention and control of sclerotinia stem rot in rapeseed.

[0006] Specifically, the technical solution of the present invention is as follows:

[0007] This invention discloses a gene for resistance to sclerotinia stem rot in Brassica napus. BnabZIP1 The open reading frame (ORF) of the gene is 1116 bp in length, encoding a protein composed of 371 amino acids. Its nucleic acid sequence is shown in SEQ ID NO.1, and the amino acid sequence of the protein corresponding to the gene is shown in SEQ ID NO.2.

[0008] In this invention, the BnabZIP1 Genes involved in regulation in Brassica napus Sclerotinia sclerotiorum The resistance to sclerotinia stem rot caused by this disease is negatively regulated by this disease.

[0009] One aspect of the present invention discloses... BnabZIP1 The application of genes in improving the resistance of Brassica napus to Sclerotinia stem rot involves knocking out genes in the rapeseed. BnabZIP1 Genes to enhance rapeseed's resistance to... Sclerotinia sclerotiorum Resistance to sclerotinia stem rot caused by the disease.

[0010] In one aspect, the present invention discloses a method for screening rapeseed resistant to sclerotinia stem rot, comprising the following steps:

[0011] (1) Testing the rapeseed plants to be tested BnabZIP1 Gene expression levels;

[0012] (2) When the test results show that the gene is highly expressed compared to the wild type, the plant is judged to be less resistant to sclerotinia disease.

[0013] In one aspect, the present invention discloses a method for obtaining rapeseed resistant to sclerotinia stem rot, the method comprising using gene editing techniques to knock out the rapeseed's... BnabZIP1 Genes are used to obtain homozygous mutants, thereby increasing their resistance to sclerotinia stem rot.

[0014] In one embodiment, the mutation type of the mutant is a frameshift mutation caused by base deletion or base insertion.

[0015] In one aspect, the present invention discloses a rapeseed BnabZIP1 A method for preparing homozygous mutant transgenic plants, the method comprising the following steps:

[0016] S1, Design Target BnabZIP1 The sgRNA sequence of the gene was obtained and cloned into a CRISPR / Cas9 vector;

[0017] S2. Transform the vector into Agrobacterium GV3101;

[0018] S3. Transgenic plants were obtained by transferring the plant into rapeseed using the Agrobacterium-mediated hypocotyl infection method and then through tissue culture.

[0019] S4. Select plants with homozygous mutant genotypes to obtain the desired result.

[0020] In one embodiment, the sgRNA sequence is shown as SEQ ID NO.3 (TTTGATAGTGACCICGGCGTGG) and SEQ ID NO.4 (CCTCTACTGCTACTTCCTCGGC).

[0021] In this invention, targeted editing is achieved using CRISPR / Cas9 technology. BnabZIP1 The gene was used to obtain homozygous mutant rapeseed plants with stronger resistance to sclerotinia stem rot. The sgRNA sequence is shown in SEQ ID NO.3, and the primer sequence is shown in SEQ ID NO.4.

[0022] The present invention BnabZIP1 The homozygous mutants showed significantly enhanced resistance to sclerotinia stem rot in rapeseed inoculation experiments, with significantly smaller lesion area and significantly reduced fungal biomass. Beneficial effects

[0023] (1) This invention is the first to identify and verify the presence of [a specific substance] in rapeseed. BnabZIP1 The function of genes in sclerotinia disease resistance.

[0024] (2) The present invention utilizes CRISPR / Cas9 gene editing technology to obtain BnabZIP1 The mutant significantly enhanced the rapeseed's resistance to sclerotinia stem rot.

[0025] (3) The invention discovered BnabZIP1 Genes can serve as molecular markers or genetic engineering targets for rapeseed resistance to sclerotinia stem rot, and can be used to screen and create disease-resistant rapeseed varieties, showing promising prospects for molecular breeding applications.

[0026] (4) The technical solution of the present invention is green and environmentally friendly, reduces the use of chemical pesticides, and meets the requirements of sustainable agricultural development. Attached Figure Description

[0027] Figure 1 Targeted in the embodiments of the present invention BnabZIP1 The sgRNA sequence of the gene, the target site, and the types of homozygous mutants obtained. 。

[0028] Figure 2 Wild type (WT) and BnabZIP1 Comparison of results when mutants were inoculated with Sclerotinia sclerotiorum on leaves and stems.

[0029] A: Leaf inoculation phenotypic results; B: Stem inoculation phenotypic results; C: Quantitative analysis of leaf lesion area; D: Quantitative analysis of stem lesion area; E: Fungal biomass analysis results detected by qRT-PCR. Detailed Implementation

[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. Unless otherwise specified, the equipment and reagents used in the embodiments and experimental examples are commercially available. Unless otherwise stated, all reagents used in this invention are analytical grade reagents. The specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0031] Example 1: BnabZIP1 Gene cloning and sequence characteristics

[0032] rapeseed ( B. napus Using cv. Westar's cDNA as a template, specific primer pairs were used... BnabZIP1 The gene was amplified by PCR. The primer sequences used were: forward primer F: 5'-ATGGAAAGAGAGAAATCTCCAGCAC-3' (SEQ ID NO. 5), and reverse primer R: 5'-GCTCTCATTCTGACCGTTAAATGG-3' (SEQ ID NO. 6). The PCR reaction conditions were: 95℃ pre-denaturation for 3 min; followed by 32 cycles (95℃ denaturation for 15 s, 58℃ annealing for 15 s, 72℃ extension for 1 min); and a final extension at 72℃ for 10 min. The amplified product was 1116 bp in size (SEQ ID NO. 1); it encoded 371 amino acids (SEQ ID NO. 2).

[0033] Example 2: BnabZIP1 Targeted gene editing

[0034] 2.1 Construction of CRISPR / Cas9 vectors

[0035] Using the rapeseed BnPIR database and an online CRISPR / P target design website, suitable sgRNAs (TTTGATAGTGACCTCGGCGTGG (SEQ ID NO.3) and CCTCTACTGCTACTTCCTCGGC (SEQ ID NO.4)) were designed. Two pairs of conserved primers were designed based on the target sequence information to amplify product fragments carrying the two target sequences from the intermediate vector pCBC. After fragment recovery, the fragments were ligated into a CRISPR / Cas9 vector using BsaI restriction endonuclease (Thermo Scientific™) and T4 ligase (Thermo Scientific™). PCR verification and sequencing alignment yielded the desired sgRNAs. BnabZIP1 Gene knockout vector CRISPR / Cas9- BnabZIP1 .

[0036] 2.2 Agrobacterium-mediated transformation of CRISPR / Cas9 vector

[0037] The above-mentioned vector was transformed into Agrobacterium, which has a strong infectivity against rapeseed, by electroporation. Agrobacterium tumefaciens Strain GV3101 was selected. Colonies were screened on LB medium containing kanamycin under culture conditions of 28°C. Single colonies were identified by PCR and sequencing and used for subsequent rapeseed genetic transformation.

[0038] 2.3 Brassica napus BnabZIP1 Obtaining homozygous mutants

[0039] (1) Seed sterilization and sowing

[0040] Select plump Westar rapeseed seeds. In a laminar flow hood, wash the seeds with 75% ethanol for 2 minutes, then disinfect them with diluted 84 disinfectant for 15 minutes. Finally, rinse with sterile water 5-6 times, 5 minutes each time. Place the disinfected seeds into a sterile container containing MS medium and incubate at 25°C for 5-6 days.

[0041] (2) Agrobacterium infection and co-culture

[0042] The preserved Agrobacterium was activated and cultured in LB medium containing kanamycin at 28°C with shaking at 180 r / min for approximately 12-14 h until the Agrobacterium culture reached the OD value. 600 The value was 0.6. The hypocotyl was cut into segments with a length of 0.8 to 1.0 cm; the cut explants were placed in a culture dish containing bacterial solution and incubated at 25°C for 48 hours.

[0043] (3) Selection, culture and induction of callus

[0044] The cultured hypocotyl explants were transferred to M2 (MS 2.2 g / L, Sucrose 30 g / L, Agarose 6 g / L) medium for callus induction and cultured at 25°C for 2-3 weeks.

[0045] (4) Induction of differentiation and bud regeneration

[0046] Normally growing explants with swollen ends were transferred to differentiation M3 medium (MS 2.2 g / L, glucose 30 g / L, xylose 0.25 g / L, MES 0.6 g / L, agarose 6 g / L) and cultured under light. They were subcultured every 2-3 weeks until green shoots appeared.

[0047] (5) Bud elongation before rooting

[0048] Once buds differentiate from the callus tissue of the hypocotyl segment and a clear growth point is visible, the young buds are carefully cut from the callus tissue using sterile forceps and a scalpel, and transferred to M4 medium (MS 4.4 g / L, Sucrose 30 g / L, Agarose 6 g / L) for rooting culture. After rooting, the seedlings can be hardened off in a light incubator before being transplanted to the transgenic experimental field.

[0049] (6) Brassica napus BnabZIP1 Screening and identification of homozygous mutants

[0050] Genomic DNA was extracted from leaves during the seedling stage, and positive plants were detected by PCR amplification. Primers for detecting editing were designed, and DNA from positive plants was used as a template for amplification. Editing was then analyzed after sequencing. BnabZIP1 Homozygous mutant plants.

[0051] See Figure 1 The T1 generation of transformed plants in this embodiment of the invention BnabZIP1 Editing of gene mutant plants. Results showed that in mutant #1, one DNA strand had a 107 bp deletion between sgRNA1 and sgRNA2. The other DNA strand had an A base insertion at sgRNA1 and a 5 bp deletion at sgRNA2. Mutant #2 had a 2 bp deletion at sgRNA2. sgRNA targeting... BnabZIP1 Genes that undergo the aforementioned base insertions and deletions result in frameshift mutations encoding amino acids, causing... BnabZIP1 Changes in the function of genes.

[0052] 2.4. BnabZIP1 Disease resistance detection of homozygous mutants

[0053] The information obtained above BnabZIP1Using homozygous mutants as materials, their resistance to Sclerotinia stem rot in rapeseed was detected and analyzed by inoculation with Sclerotinia sclerotiorum, thereby clarifying... BnabZIP1 The regulatory role of genes in rapeseed resistance to sclerotinia stem rot; whether gene editing technology can be used to knock out rapeseed sclerotinia stem rot. BnabZIP1 Genes were used to obtain new transgenic rapeseed materials with homozygous mutants that showed enhanced resistance to sclerotinia stem rot.

[0054] (1) Activation of Sclerotinia sclerotiorum

[0055] The preserved Sclerotium sclerotiorum strain was inoculated onto PDA medium and cultured at 25°C until the mycelium covered the culture dish.

[0056] (2) Inoculation with Sclerotinia sclerotiorum

[0057] Mycelial blocks were collected using a 5 mm diameter punch and selected from uniformly growing rapeseed plants for inoculation. The mycelial blocks were inoculated onto healthy, fully expanded leaves and stems at the same location, kept moist, and incubated at 25°C. After an appropriate time (approximately 36 hours), photographs were taken and the lesion area was analyzed using ImageJ software. The inoculation experiment was repeated three times. The lesion area data were analyzed and expressed as mean ± SE. The results showed that... BnabZIP1 Mutant plants had a smaller diseased area and reduced Sclerotinia sclerotiorum biomass compared to wild-type plants. Figure 2 ).illustrate BnabZIP1 The mutant plants showed significantly higher resistance to sclerotinia stem rot than the wild-type plants. BnabZIP1 Gene deletion mutations significantly enhance rapeseed's resistance to sclerotinia stem rot; therefore, BnabZIP1 Genes play a negative regulatory role in the resistance of rapeseed to sclerotinia stem rot.

[0058] In summary, this invention utilizes CRISPR / Cas9 technology for targeted... BnabZIP1 And obtained through genetic transformation. BnabZIP1 Homozygous mutants were identified, and their resistance phenotype to sclerotinia stem rot was characterized and analyzed. This clarified... BnabZIP1 Genes play a negative regulatory role in resistance to sclerotinia stem rot in rapeseed, and gene editing technology can be used to knock out these genes in rapeseed. BnabZIP1 Genes were used to obtain new homozygous mutant rapeseed materials with enhanced resistance to sclerotinia stem rot, laying the foundation for breeding new rapeseed varieties resistant to sclerotinia stem rot.

[0059] The above description, in conjunction with specific embodiments, provides a further detailed explanation of the present invention. It should not be construed that the specific implementation of the present invention is limited to these descriptions. For those skilled in the art, several simple deductions or substitutions can be made without departing from the concept of the present invention, and all such deductions or substitutions should be considered to fall within the scope of protection defined by the claims submitted herein.

Claims

1. BnabZIP1 The application of genes in improving the resistance of Brassica napus to Sclerotinia stem rot is characterized by, By knocking out the rapeseed BnabZIP1 Genes to enhance rapeseed's resistance to... Sclerotinia sclerotiorum Resistance to sclerotinia stem rot caused by the disease; the aforementioned BnabZIP1 The gene has an open reading frame (ORF) length of 1116 bp and its nucleic acid sequence is shown in SEQ ID NO.1; the gene encodes a protein composed of 371 amino acids, the amino acid sequence of which is shown in SEQ ID NO.

2.

2. A method for screening rapeseed varieties resistant to Sclerotinia stem rot, characterized in that, Includes the following steps: (1) Testing the rapeseed plants to be tested BnabZIP1 Gene expression levels; (2) When the test results show that the gene is highly expressed compared to the wild type, the plant is considered to have weak resistance to sclerotinia stem rot; wherein, the aforementioned BnabZIP1 The gene has an open reading frame (ORF) length of 1116 bp and its nucleic acid sequence is shown in SEQ ID NO.1; the gene encodes a protein composed of 371 amino acids, the amino acid sequence of which is shown in SEQ ID NO.

2.

3. A method for obtaining resistant Brassica napus (Brassica napus type) to Sclerotinia sclerotinia, the method comprising using gene editing techniques to knock out the sclerotinia sclerotinia... BnabZIP1 Genes were used to obtain homozygous mutants, thereby increasing their resistance to sclerotinia stem rot; among them, The BnabZIP1 The gene has an open reading frame (ORF) length of 1116 bp and its nucleic acid sequence is shown in SEQ ID NO.1; the gene encodes a protein composed of 371 amino acids, the amino acid sequence of which is shown in SEQ ID NO.

2.

4. The method according to claim 3, characterized in that, The mutation type of the mutant is a frameshift mutation caused by base deletion or base insertion.

5. The method according to claim 3, characterized in that, The gene editing method described is CRISPR gene editing.

6. A type of rapeseed resistant to sclerotinia stem rot. BnabZIP1 A method for preparing homozygous mutant transgenic plants, characterized in that, The method includes the following steps: S1, Design Target BnabZIP1 The sgRNA sequence of the gene was cloned into a CRISPR / Cas9 vector, wherein... BnabZIP1 The gene has an open reading frame (ORF) length of 1116 bp, and its nucleic acid sequence is shown in SEQ ID NO.1; the gene encodes a protein composed of 371 amino acids, and its amino acid sequence is shown in SEQ ID NO.2; the sgRNA sequence is shown in SEQ ID NO.3 and SEQ ID NO.

4. S2. Transform the vector into Agrobacterium GV3101; S3. Transgenic plants were obtained by transferring the plant into rapeseed using the Agrobacterium-mediated hypocotyl infection method and then through tissue culture. S4. Select plants with homozygous mutant genotypes to obtain the desired result.

Images