Application of helicase RECG in improvement of agronomic traits of corn

Abstract

The invention discloses application of ATP-dependent DNA helicase RECG in improvement of agronomic traits of gramineous crops, corn overexpression helicase RECG or enhancement of enzyme activity can improve grain yield and plant biomass, and the application is of great significance to cultivation of new high-yield corn varieties.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of agricultural biotechnology, and relates to the use of ATP-dependent DNA helicase RECG in improving the agronomic traits of Poaceae crops, especially corn. BACKGROUND

[0002] Hybridization disadvantage is the basis for the formation of the concept of species, but its specific formation mechanism is still a classic proposition in evolutionary biology. The occurrence of plant hybridization disadvantage hinders the effective use of plant hybridization advantage, which also prompts plant breeders to explore the molecular genetic mechanism of hybridization disadvantage. A series of genes controlling plant hybridization disadvantage have been cloned. The genes related to hybrid disadvantage control, Cf-2 and Rcr3, were first identified in tomato. Cf-2 encodes a leucine-rich receptor-like protein gene that can resist the invasion of the pathogenic fungus C. fulvum, and Rcr3 encodes a cysteine endonuclease gene. Cf-2 and Rcr-3 two genes will interact to cause the formation of hybrid disadvantage (Dixon et al., 1996); In petunia, two lines P. axillaris and P. exserta were found to have necrotic symptoms when crossed, and HNe2 and HNe7 located on chromosomes 2 and 7 interacted to show severe growth and flower yield necrosis (Li et al., 2023). In the study of rice hybridization disadvantage, Lin Hongxuan's team found that two incompatible dominant loci (Hwi1 and Hwi2) determine the occurrence of rice interspecific hybrid disadvantage, and the two loci contain 3 genes, of which Hwi1 contains two leucine-rich receptor kinases (LRR-RLK), named 25L1 and 25L2, respectively, and Hwi2 encodes a predicted subtilisin-like protein, which is a secreted protein. When Hwi1 and Hwi2 are aggregated together, they will significantly affect rice growth, causing hybrid offspring plants to exhibit typical hybrid disadvantage phenotypes such as plant dwarfism and reduced tillering (Chen et al., 2014). In wheat, hybrid necrosis is found to be controlled by a pair of complementary genes Ne1 and Ne2, which can cause premature leaf senescence and even premature death of the whole plant (Hewitt et al., 2021).

[0003] Hybrid vigor and hybrid inferiority exist in maize, and the application of hybrid vigor and the exploration of molecular genetic mechanism of hybrid inferiority are very important for maize breeding. However, there is no report on the molecular mechanism of hybrid inferiority in maize. Maize is the highest yield of food and forage crops in the world, and is also a classic model plant for plant genetics research. Hybrid inferiority has been a barrier to the utilization of interspecific or intraspecific hybrid vigor in maize. Many strong hybrid combinations show great advantages in yield, but the existence of hybrid inferiority limits the direct utilization of hybrid vigor. Therefore, it is very important to study the molecular genetic mechanism of hybrid inferiority in maize for understanding the origin and evolution of maize, the formation of genetic diversity and species adaptability, and providing important theoretical basis for the utilization of maize hybrid vigor in production. SUMMARY

[0004] In order to study the maize hybrid vigor gene, we made different maize inbred line combinations, and accidentally found the hybrid inferiority phenomenon between two inbred lines. When B73 was used as the female parent and IHP was used as the male parent, the offspring plants showed hybrid vigor beyond the parents. However, when IHP was used as the female parent, the offspring plants were dwarf, slow development, plant height was only 20-40 cm, and later necrosis, unable to complete its own growth and development. We further studied and found that more than 200 inbred lines hybridized with IHP showed hybrid inferiority, and hybridization recovery could occur between W64A and IHP.

[0005] In the screening of maize hybrid vigor key genes, we identified a gene controlling hybrid inferiority on chromosome 5 by map-based cloning, which is an ATP-dependent DNA helicase (ATP-dependent DNA helicase) RECG. RECG mainly participates in organelle DNA damage repair through recombination. There is a functional mutation of stop codon TAG in RECG gene in IHP, which leads to protein truncation. RECG-IHP interacts with RECG-B73 and RECG-W64A proteins, and RECG-IHP binds more tightly with RECG-B73 protein, and the function of the gene itself is more weakened, leading to more obvious hybrid inferiority phenotype. Because the enzyme activity of RECG-B73 of B73 is higher than that of RECG-IHP of IHP, and the enzyme activity of RECG-W64A of W64A is higher than that of RECG-B73, combined with the growth phenotype and yield of hybrid varieties among the three maize varieties, it is suggested that the helicase RECG positively regulates the grain yield and plant biomass of maize, and therefore the RECG gene can be used as a gene resource for improving the agronomic traits of maize. Based on the finding, the present application includes the following technical solutions.

[0006] The first aspect of the present application provides use of ATP-dependent DNA helicase RECG or its expression gene in improving agronomic traits of Poaceae crops.

[0007] The Poaceae crops are selected from corn, wheat, rice, soybean, barley, oat, millet, rye and sorghum, etc.

[0008] Preferably, the Poaceae crops are corn, including but not limited to existing wild species, inbred lines, landraces and hybrids, and the corn varieties can be selected from B73, KN5585, Zhengdan 958, Denghai 605, Xianyu 335, Jingke 968, Qiangyu 998, Longping 638, Desan 179, Denghai Pioneer D20, Meiyu 27, Nongkeynu 336, Yutian 28, Shenko Sweet 811, Heitiannu 33, Chuandan 99, Hengyu 828, Guidan 162, Chang 72, Mo17, Liangyu 99, W22, B104, W64A, IHP, etc.

[0009] Optionally, the agronomic traits include grain yield and aboveground biomass, i.e. plant size, i.e. the use is the use of helicase RECG for increasing grain yield and / or plant height or biomass of Poaceae crops.

[0010] In one embodiment, the use is a method for increasing grain yield and / or plant height or biomass of Poaceae crops by using helicase RECG, comprising the following steps:

[0011] A. enhancing the expression level of endogenous helicase RECG in Poaceae crops;

[0012] B. making Poaceae crops overexpress exogenous helicase RECG with improved enzyme activity; or

[0013] C. crossing Poaceae crops as the male parent with another variety of Poaceae crops with higher helicase RECG enzyme activity as the female parent to breed hybrid varieties with improved agronomic traits.

[0014] Taking corn varieties B73, W64A and IHP as examples, the enzyme activity of helicase RECG-B73 of B73 is higher than that of helicase RECG-IHP of IHP, and the enzyme activity of helicase RECG-W64A of W64A is higher than that of helicase RECG-B73, so B73 can be selected as the female parent to cross with IHP as the male parent to breed hybrid variety B73 x IHP, and W64A can be selected as the female parent to cross with B73 as the male parent to breed hybrid variety W64 x AB73.

[0015] The amino acid sequence of the helicase RECG-B73 of the above-mentioned corn B73 is shown as SEQ ID NO: 1, the nucleotide sequence of the coding region B73-RecgCDS of the expression gene thereof is shown as SEQ ID NO: 2; the amino acid sequence of the helicase RECG-IHP of the above-mentioned corn IHP is shown as SEQ ID NO: 3, the nucleotide sequence of the coding region IHP-RecgCDS of the expression gene thereof is shown as SEQ ID NO: 4; the amino acid sequence of the helicase RECG-W64A of the above-mentioned corn W64A is shown as SEQ ID NO: 5, the nucleotide sequence of the coding region W64A-RecgCDS of the expression gene thereof is shown as SEQ ID NO: 6.

[0016] In an embodiment, the above-mentioned embodiment of step A can be:

[0017] A-1. Cloning the endogenous helicase RECG encoding gene Recg of the crop into a plasmid vector, preferably into a plasmid vector suitable for expression in Agrobacterium, to form a recombinant plasmid, i.e. a Recg overexpression vector, and then transforming plant cells or tissues by using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation or Agrobacterium-mediated method, and cultivating the transformed plant tissues into plants, preferably transforming the plants by Agrobacterium-mediated method, to obtain a transgenic plant overexpressing the helicase RECG; and / or

[0018] A-2. Placing the existing helicase RECG encoding gene Recg in the genome of the crop under the control of a functionally enhanced promoter, such as the Cauliflower Mosaic Virus (CAMV) 35S promoter, the Ubi promoter such as the Ubiquitin gene promoter ZmUBIpro derived from corn or other series of promoters.

[0019] The above-mentioned embodiment of step B can be:

[0020] B-1. Cloning the helicase RECG encoding gene Recg with higher enzyme activity derived from different varieties into a plasmid vector, preferably into a plasmid vector suitable for expression in Agrobacterium, to form a recombinant plasmid, i.e. a Recg overexpression vector, and then transforming plant cells or tissues of the crop by using conventional biological methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation or Agrobacterium-mediated method, and cultivating the transformed plant tissues into plants, preferably transforming the plants by Agrobacterium-mediated method, to obtain a transgenic plant overexpressing the exogenous helicase RECG;

[0021] B-2. Replacing the existing Recg gene in the genome of the crop plant with a Recg gene from a different variety that has higher enzymatic activity by gene editing technology; or

[0022] B-3. Cloning a Recg gene from a different variety that has higher enzymatic activity in the genome of the crop plant by gene editing technology to obtain a transgenic plant overexpressing the foreign Recg.

[0023] Alternatively, the plasmid vector in the above steps A-1 and / or B-1 is selected from the group consisting of pHB-YFP, pHB-FLAG, pBin19, pUN1301, fluorescent reporter vector pGreenII0800-LUC, pCAMBIA3300, pCAMBIA1300, pCAMBIA1301, pCAMBIA2300, pCAMBIA2301, pBI121, pTF102, and the like plant transgenic vectors or modified vectors.

[0024] In an embodiment, the Agrobacterium in the above steps A-1 and / or B-1 is selected from Agrobacterium tumefaciens, Agrobacterium LBA4404, Agrobacterium EHA105, Agrobacterium GV3101. For example, the recombinant plasmid is transformed into the Agrobacterium strain by freeze-thaw method to form a microbial engineering strain, which is then used to transfect plants to obtain transgenic plants.

[0025] Alternatively, the gene editing technology in the above step B can be selected from the group consisting of homologous double exchange, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0026] Preferably, the smaller the binding force between the Recg proteins of the male and female parents used for hybridization in step C is, i.e., the smaller the interaction between the two Recg proteins is; more preferably, the Recg proteins of the male and female parents do not interact.

[0027] The second aspect of the present application provides a method for identifying the above transgenic maize or hybrid maize containing the maize B73-derived Recg gene B73-Recg or the maize IHP-derived Recg gene IHP-Recg, comprising the following steps:

[0028] Extracting the maize genomic DNA, and performing PCR amplification reaction using the following primer pairs,

[0029] Forward primer Recg-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 7),

[0030] Reverse primer Recg-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 8),

[0031] The presence of the gene B73-Recg in the corn genome is indicated when the PCR product size is 491 bp and the amplified sequence is SEQ ID NO: 9,

[0032] GCCATGGCACTGATAACCCTGACTAATTGCAGCTAATCATGATTAGTTGAACAATTTGATGACCTTACATGTGTCACTTGCAACAACATTGGTTATTATTTCAGTTAGGAAGACTATTTCAAATGCTTGAAGCAGTTGGTACGCGGGTTGAGAAGGAGGAATTGTTATACAAGTGCAAAAGTCATGAGCTGAATACTGTTGGTGTAGATGATTGGTCTCCTCTTACAAAGAAATTGTTGAGGGCTCTTCCTTATTGGCTTACTCCTAGTCAGTTGGATGCTGTTCAAGAGATTATATGGGATCTCAGGAGACCAGTTCCCATGAACAGACTCTTGCAGGTAACTATTATTTGCACCTTTCTTAGTTTGTTAACCAATCAATTTAGTATTTCATTCTTGTTTTTATACTTTGTTCCATAGTTATTAAGGCGATAAGGCGATAAGGCGAGCGACCCCTCCTCCCTACCTTTTAAGTGGAAAGGTGAGGCGATG (SEQ ID NO: 9);

[0033] The presence of the gene IHP-Recg in the corn genome is indicated when the PCR product size is 483 bp and the amplified sequence is SEQ ID NO: 10,

[0034] GCCATGGCACTGATAACCCTGACTAATTGCAGCTAATCATGATTAGTTGAACAATTTGATGACCTTACATGTGTCACTTGCAACAACATTGGTTATTATTTCAGTTAGGAAGACTATTTCAAATGCTTGAAGCAGTTGGTACGCGGGTTGAGAAAGAGGAATTGTTATACAAGTGCAAAAGTCATGAGCTGAATACTGTTGGTGTAGATGATTGGTCTCCTCTTACAAAGAAATTGTTGAGGGCTCTTCCTTATTGGCTTACTCCTAGTCAGTTGGATGCTGTTCAAGAGATTATATGGGATCTCAGGAGACCAGTTCCCATGAACAGACTCTTGTAGGTAACTATTATTTGCACCTTTCTTAGTTTGTTAACCAATCAATTCAGTATTTCATTCTTGTTTTTAGACTTTGTTCCATAATTATTAAGGCGATAAGGCGAGCGACCCCTCCTCCCTACCTTTTAAGTGGAAAGGTGAGGCGATG (SEQ ID NO: 10); and / or

[0035] determining whether the protein expressed by the corn cell contains a polypeptide RECG-B73 having an amino acid sequence as set forth in SEQ ID NO: 1 or a polypeptide RECG-IHP having an amino acid sequence as set forth in SEQ ID NO: 3.

[0036] Optionally, the PCR amplification described above is a PCR MIX method.

[0037] A third aspect of the present application provides a kit for implementing the identification method as described above, which comprises the following PCR primers for amplifying the gene:

[0038] a forward primer Recg-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 7),

[0039] a reverse primer Recg-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 8).

[0040] The kit can further comprise a nucleic acid extraction system for extracting total RNA or DNA from corn plant tissues such as leaves or kernels, and / or a reverse transcription system for reverse transcription into cDNA.

[0041] Further, the above-mentioned kit further comprises a user manual, which records the operation steps of extracting plant RNA or DNA, the steps of detecting the genes B73-Recg and IHP-Recg, and the identification criteria.

[0042] For example, the above-mentioned manual can be written on the bottle, test tube and the like, plate, or on a separate paper, or on the outside or inside of the container, for example, a paper with an operation demonstration video APP download window such as a two-dimensional code, and the manual can also be in the form of multimedia, such as a CD, a U disk, a network disk, etc.

[0043] For example, the above-mentioned manual can be written on the bottle, test tube and the like, plate, or on a separate paper, or on the outside or inside of the container, for example, a paper with an operation demonstration video APP download window such as a two-dimensional code, and the manual can also be in the form of multimedia, such as a CD, a U disk, a network disk, etc.

[0044] The present application clones the key gene Recg for controlling the hybrid inferiority of corn by creating corn genetic material, BSA sequencing, map-based cloning and genetic verification, which is a nuclear-encoded ATP-dependent DNA helicase / helicase located in plastid and mitochondria, and plays an important role in the processes of genome replication, genome damage repair and maintaining the integrity and stability of the genome of plant plastid and mitochondria. Enhancing the expression of helicase RECG or improving the enzyme activity of helicase RECG can improve the grain yield and plant height or biomass of corn, thereby providing important gene resources for molecular breeding of high-yield corn new varieties, and having a wide application prospect. BRIEF DESCRIPTION OF DRAWINGS

[0045] Figure 1 Part of the observation of the phenotype of corn hybrid inferiority is shown. Among them, A: the plant phenotype of B73, IHP and their reciprocal F1; B: the statistical column chart of corn plant height of B73, IHP and their reciprocal F1; C: the statistical column chart of biomass of the offspring of B73, IHP and their reciprocal F1; D: the plant phenotype of W64A, IHP and their reciprocal F1; E: the statistical column chart of corn plant height of W64A, IHP and their reciprocal F1; F: the statistical column chart of biomass of W64A, IHP and their reciprocal F1, B73, IHP and W64A are different corn inbred lines; G: the schematic diagram of the hybridization result of corn inbred lines. The data adopts two-tailed t test, and the p value is calculated, *P<0.05, **P<0.01, ***P<0.001.

[0046] Figure 2Gene cloning, mapping and genetic verification of maize hybrid disadvantage. A: Recg was fine mapped using a BC1F1 population (n = 5000) and located to a candidate gene on chromosome 5 of maize. Blue and yellow bars represent the purebred progeny that inherited the IHP and B73 chromosomes from the parental recombinants, respectively; B: Gene structure of Recg B73 , Recg IHP and Recg W64A and their detailed gene and protein sequence variations. Single nucleotide polymorphisms are indicated by red lines and black arrows. Blue and orange triangles represent insertions of 7142 bp and 5419 bp, respectively. Blue boxes represent exons of Recg; C: Western blot analysis reflecting the size and content of RECG protein in B73, IHP and W64A. Protein was extracted from VT stage maize leaves and three biological replicates were performed. ACTIN was used as an internal control. Western blot analysis experiments were repeated at least twice with similar results; D: Phenotype of Recg W64A overexpression plants and that of their hybrid progeny. Recg W64A overexpression plants were constructed in the B73 background; E: Height of Recg W64A overexpression plants compared to that of their hybrid progeny. Different letters indicate significant differences by ANOVA test; F: Relative expression of Recg W64A overexpression plants and wild type. ACTIN was used as an internal control; G: Western blot analysis of Recg W64A overexpression plants; H: Biomass of wild type and Recg W64A overexpression plants. Two-tailed t-test was used and p value was calculated; I: Maize ear of wild type and Recg W64A overexpression plants. Two-tailed t-test was used and p value was calculated; J: 100-grain weight of wild type and Recg W64A overexpression plants. Two-tailed t-test was used and p value was calculated, *P<0.05, **P<0.01, ***P<0.001.

[0047] Figure 3Figure showing the genetic recurrent material chart of corn hybrid disadvantage. Among them, A: plant morphology of F2 to F5 generation of B73 haplotype Recg of F1 hybrid offspring B73 x IHP; B: plant morphology of F2 to F5 generation of B73 / IHP heterozygous state haplotype Recg of F1 hybrid offspring B73 x IHP; C: plant morphology of F2 to F5 generation of IHP haplotype Recg of F1 hybrid offspring B73 x IHP; D: plant height of F2 to F5 generation of B73 haplotype Recg of F1 hybrid offspring B73 x IHP, variance analysis test, different letters represent significant difference; E: plant height of F2 to F5 generation of B73 / IHP heterozygous state haplotype Recg of F1 hybrid offspring B73 x IHP, variance analysis test, different letters represent significant difference; F: plant height of F2 to F5 generation of IHP haplotype Recg of F1 hybrid offspring B73 x IHP, variance analysis test, different letters represent significant difference.

[0048] Figure 4 Figure showing that the enzyme activity of the helicase RECG-W64A of W64A is higher than that of the helicase RECG-B73 of B73. The substrate for determining the helicase enzyme activity is three DNA chains, and the sequences of the three chains are respectively:

[0049] (1) GTCGGATCCTCTAGACAGCTCCATGATCACTGGCACTGGTAGAATTCGGC;

[0050] (2) CAACGTCATAGACGATTACATTGCTACATGGAGCTGTCTAGAGGATCCGA; and

[0051] (3) TAGCAATGTAATCGTCTATGACGTT.

[0052] Figure 5 Figure showing the interaction verification chart of helicase RECG proteins from different corn varieties. Among them, A: verification of IHP-RECG interaction with B73-RECG and W64A-RECG in tobacco using luciferase complementary imaging; B: verification of IHP-RECG interaction with B73-RECG and W64A-RECG using yeast two-hybrid experiment; C: verification of IHP-RECG interaction with B73-RECG and W64A-RECG in tobacco using immunoprecipitation Co-IP experiment; D: verification of IHP-RECG interaction with B73-RECG and W64A-RECG using microscale thermophoresis (MST) experiment, and the strength statistical curve is shown.

[0053] Figure 6The corn hybrid advantage evaluation chart is shown. Among them, A: W64A x B73 and B73 x W64A plant morphology observation; B: W64A x B73 and B73 x W64A corn plant height statistical chart; C: W64A x B73 and B73 x W64A corn biomass statistical chart; D: W64A x B73 and B73 x W64A corn hundred-grain weight statistical chart; E: W64A x B73 and B73 x W64A corn ear photos; F: W64A x B73 and B73 x W64A corn grain photos. DETAILED DESCRIPTION

[0054] In the study of corn hybrid advantage / disadvantage genes, we found that the hybrid disadvantage phenomenon occurred when the classic corn inbred line B73 was used as the male parent and IHP was used as the female parent, and the phenotype was restored when the inbred line W64A was used as the male parent and IHP was used as the female parent. Here, we identified a gene RECG that controls hybrid disadvantage on chromosome 5 through map-based cloning. RECG is a nucleus-encoded ATP-dependent DNA helicase that is located in plastids and mitochondria, and is essential for genome replication, genome damage repair, and maintaining the integrity and stability of the genome in plant plastids and mitochondria. RECG mainly participates in organelle DNA damage repair through recombination. Studies have found that there is a functional mutation of the stop codon TAG in the RECG gene in IHP, which leads to protein truncation. RECG-IHP interacts with RECG-B73 and RECG-W64A proteins, and the binding of RECG-IHP and RECG-B73 proteins is more tight, which further weakens the function of the gene itself and leads to more obvious hybrid disadvantage phenotype. Therefore, the genetic interaction incompatibility of corn hybrid disadvantage is driven by the formation of harmful complexes through protein interaction, which provides new insights into the molecular mechanisms of reproductive isolation in species differentiation and promotes hybrid corn breeding.

[0055] Since the enzyme activity of helicase RECG-B73 is higher than that of RECG-IHP, and the enzyme activity of helicase RECG-W64A is higher than that of RECG-B73, it indicates that helicase RECG is a key gene for hybrid advantage in crops, and it suggests that this gene can be used as a gene resource to cultivate transgenic plants with improved agronomic traits, including increased grain yield and / or plant height or biomass, and is expected to promote the development of hybrid corn breeding.

[0056] Although the function of helicase RECG in positively regulating grain yield and plant height or biomass was tested in corn varieties IHP, W64A and B73, those skilled in the art can expect that helicase RECG can also be applied to other corn varieties, and even to other crops in the family Poaceae, such as rice, wheat, soybean, millet, barley, oats, rye and sorghum, to cultivate transgenic plants or hybrid new varieties with improved agronomic traits.

[0057] Correspondingly, the terms "transgenic maize" and "transgenic plant / maize" and the like herein mean the same and refer to an agronomically improved maize obtained by genetically engineering a wild type maize to enhance the expression of a helicase RECG or to increase the enzymatic activity of RECG.

[0058] To express the RECG with increased enzymatic activity in a plant such as maize, in addition to hybridization breeding, the RECG-encoding gene can be constructed as an expression cassette or expression construct as a DNA molecule, and operably linked to a plasmid vector by subcloning to obtain a recombinant plasmid, and then the recombinant plasmid is transformed into a host cell to obtain a transformant, i.e., a genetically engineered bacterium or a recombinant bacterium, or transformed into a plant by Agrobacterium-mediated method to obtain a transgenic plant.

[0059] As used herein, the terms "increase", "enhance" or "improve" (grain yield / plant height or biomass) can mean an increase of at least 10% compared to a reference level (such as normal maize), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10-100% compared to a reference level.

[0060] In the description of the technical solutions of the present application, the term "and / or" used in terms such as "A and / or B", "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Likewise, the term "and / or" as used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0061] In this paper, for the sake of convenience in description, a certain protein such as RECG is sometimes used interchangeably with its encoding gene (DNA) name Recg, and those skilled in the art should understand that they represent different types of substances in different description contexts. Those skilled in the art can easily understand their meanings according to the context and the context. For example, for RECG, when describing the function or category of the helicase protein, it refers to the protein; when it is described as a gene, it refers to the encoding gene of the protein.

[0062] As used herein, the term "expression cassette" or "gene expression cassette" refers to a genetic expression system comprising all necessary elements required for expression of a helicase RECG of interest, typically including the following elements: a promoter, a gene sequence encoding a polypeptide, a terminator; and optionally including a signal peptide coding sequence such as mCherry (red fluorescent protein), GFP (green fluorescent protein), or YFP (yellow fluorescent protein), etc.; these elements are operably linked.

[0063] As used herein, the term "expression construct" or "expression construct" refers to a recombinant DNA molecule comprising a nucleic acid coding sequence of interest (e.g., SEQ ID NO: 2, 4, or 6), which can comprise one or more gene expression cassettes. The "construct" is typically contained in an expression vector (plasmid vector).

[0064] As used herein, the term "exogenous" or "heterologous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from a different source and a host cell. For example, a nucleic acid is exogenous to a host cell if the combination of the nucleic acid and the host cell is not naturally occurring. A particular sequence is "exogenous" to the cell or organism into which it is inserted.

[0065] As used herein, the term "operably linked" or "operatively linked" refers to the functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example: a promoter region is placed in a particular position relative to a nucleic acid sequence of interest SEQ ID NO: 2, 4, or 6, such that transcription of the nucleic acid sequence is directed by the promoter region, and thus the promoter region is "operably linked" to the nucleic acid sequence.

[0066] The nucleic acid construct of the present application can be manipulated in various ways to ensure expression of the polypeptide ipa1. The nucleic acid construct can be manipulated before insertion into a vector according to the different or requirements of the expression vector. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

[0067] In certain embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, an expression vector, or a gene knock-in vector. The nucleic acid sequences of the present application, SEQ ID NO: 2, 4 or 6, can be cloned into many types of vectors, for example, plasmids, phagemids, phage derivatives, animal viruses, and cosmids. Cloning vectors can be used to provide the coding sequence of the proteins or polypeptides of the present application. Expression vectors can be provided to cells in the form of bacterial vectors or viral vectors. Expression of the RECG gene is typically achieved by operably linking the nucleic acid sequences of the present application, SEQ ID NO: 2, 4 or 6, to a promoter, and incorporating the construct into an expression vector. The vector can be suitable for replication and integration into eukaryotic cells. Typical expression vectors contain expression control sequences that can be used to regulate expression of the desired nucleic acid sequence.

[0068] Gene knock-in vectors can be used to integrate the polynucleotide sequences of the present application, SEQ ID NO: 2, 4 or 6, into the region of interest in the host genome. Typically, the gene knock-in vector contains, in addition to the polynucleotide sequence, 5' and 3' homology arms required for genomic homologous recombination. In some embodiments, the nucleic acid construct of the present application contains a 5' homology arm, the polynucleotide sequence of the present application, and a 3' homology arm. When using a gene knock-in vector, the polynucleotide sequence can be homologously recombined into the site of interest using CRISPR / Cas9 technology. CRISPR / Cas9 technology increases the efficiency of homologous recombination in the region of the gene modification by designing guide RNA against the gene of interest to direct Cas9 nuclease to modify the genome at the insertion site, resulting in increased homologous recombination of the region of interest. The fragment of interest, SEQ ID NO: 2, 4 or 6, contained in the gene knock-in vector is homologously recombined into the site of interest. The steps of CRISPR / Cas9 technology and the reagents used, such as Cas9 nuclease, are well known in the art.

[0069] Methods well known to those skilled in the art can be used to construct nucleic acid constructs. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombination techniques, and the like. The DNA sequences described can be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are the lac or trp promoter of E. coli, the PL promoter of bacteriophage lambda, eukaryotic promoters including the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the LTRs of retroviruses, and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator. In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase for eukaryotic cell culture, neomycin resistance in eukaryotic cells and green fluorescent protein (GFP), or tetracycline, ampicillin resistance or chloramphenicol in E. coli, Agrobacterium, and the like.

[0070] The polynucleotide of the present application, when expressed in higher eukaryotic cells, will be enhanced if an enhancer sequence is inserted in the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs in length, which act on a promoter to increase the transcription of a gene. Examples include the 100 to 270 base pair SV40 enhancer on the late side of the replication origin, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers, among others.

[0071] Vectors containing the appropriate DNA sequence as well as a suitable promoter or control sequence can be used to transform appropriate host cells to enable them to express the protein.

[0072] When the helicase RECG is applied to crop new varieties for the improvement of agronomic traits of crops in the family Poaceae, it is preferred to be introduced into the plant by traditional Agrobacterium-mediated method, for which a recombinant Agrobacterium engineering strain expressing Recg needs to be constructed.

[0073] The terms "recombinant bacteria (strains)" and "engineered bacteria (strains)" herein mean the same, referring to strains of wild-type Agrobacterium, such as Agrobacterium tumefaciens, which have been genetically modified to contain a RECG overexpression vector.

[0074] In the construction of transgenic plants using traditional Agrobacterium-mediated methods, the construction method of transgenic plants includes:

[0075] 1) providing Agrobacterium carrying an expression vector containing the coding sequence of RECG;

[0076] 2) contacting plant cells or tissues or organs with the Agrobacterium of step 1) to transfer the coding sequence into the plant cells and integrate into the chromosome of the plant cells;

[0077] 3) selecting the plant cells or tissues into which the coding sequence is transferred; and

[0078] 4) regenerating the plant from the plant cells or tissues of step 3).

[0079] Whether the transgenic plant is successfully constructed can be identified by a conventional PCR amplification method. That is, after amplification by a conventional tissue DNA extraction, a conventional PCR mix reagent, a reaction system and a PCR amplification procedure, the PCR product is sequenced by a forward primer Recg-F and a reverse primer Recg-R.

[0080] In the study of maize hybrid inferiority, we cloned the Recg gene that controls maize hybrid inferiority. In the B73 genome, the full length of the Recg gene (Zm00001d017808) is 16052 bp. Compared with the Recg gene of the B73 haplotype, the Recg gene of the IHP haplotype has a functional mutation of a stop codon (TAG) in the 9th exon. We extracted the leaf proteins of B73, IHP and W64A at the VT stage (heading stage) and performed immunoblotting experiments. Anti-RECG was used to detect the RECG protein in the samples, and it was found that the IHP-RECG protein was truncated and the translation was prematurely terminated. The Recg gene of the W64A haplotype has a similar mutation in the coding sequence as Recg-IHP, resulting in multiple SNP sites in the exon, which leads to non-synonymous mutations in the amino acid. This may imply that changes in amino acids can lead to changes in protein function.

[0081] During the study, we constructed genetic material (OE) overexpressing W64A-Recg in the B73 background. Using IHP as the female parent and OE-Recg-W64A as the male parent to produce offspring F1, we found that the offspring plants were as high as 80 cm-130 cm or so, to some extent, restoring normal plant height and completing growth and development.

[0082] When the inbred line IHP was used as the female parent, the offspring exhibited inferiority when crossed with the inbred line B73, and exhibited hybrid recovery phenotype when crossed with the inbred line W64A.

[0083] When the B73-Recg knockout (KO) was crossed with IHP, F1 (IHP x KO) exhibited weak hybrid superiority. The B73-Recg knockout line (KO) was continuously self-crossed, and at F4, the plants were short and the flowers were yellow.

[0084] Wild maize Ames21814 and IHP were crossed, because of the unilateral incompatibility of wild maize, we used IHP as the female parent and wild maize Ames21814 as the male parent. The plant height of IHP x Ames21814 was slightly lower than that of IHP, and the number of tillers was more, showing hybrid recovery phenotype.

[0085] F2 was obtained by selfing F1 (B73 x IHP), and genotypes (Recg B73 , Recg B73 / IHP , Recg IHP ) would appear in F2 plants, and then the offspring plants were continuously selfed according to the genotype, and it was found that the proportion of yellow flower seedlings increased in the homozygous plants of Recg-IHP in F5, and the plant height showed a fluctuation of 30-120 cm, and the yellow flower plants could not complete their own growth and development.

[0086] RECG protein plays a role in the form of a dimer, in which RECG-IHP interacts with RECG-B73 and RECG-W64A protein.

[0087] We also confirmed that RECG-B73 and RECG-W64A proteins can interact with IHP-RECG through yeast two-hybrid, tobacco luciferase complementation imaging, and CO-IP experiments. Microscale thermophoresis (MST) proved that the binding force of RECG-IHP and RECG-B73 was stronger than that of RECG-IHP and RECG-W64A.

[0088] F1 of W64A x B73 hybrid was significantly higher in plant height and biomass than B73 x W64A, and F1 was significantly higher in yield than B73 x W64A, and the use of dominant cytoplasm can be used to guide breeding.

[0089] The positive progress effects of this study include:

[0090] 1) The phenomenon of hybrid inferiority was first found in maize and the gene Recg controlling maize hybrid inferiority was cloned, and the structural variation of the gene in nature was analyzed;

[0091] 2) Hybridization of IHP with Recg-W64A haplotype gene can restore hybrid inferiority to normal phenotype;

[0092] 3) The origin and evolutionary relationship of hybrid inferiority in maize were explored, and hybridization of wild maize and IHP can also restore plant height and other related physiological phenotypes of maize. Hybrid inferiority does not exist in wild maize, but is formed during the breeding of cultivated maize;

[0093] 4) Hybrid vigor is one of the key innovations in modern agriculture, which has a significant impact on global food security. Using cytoplasmic hybrid vigor breeding can significantly improve hybrid vigor maize and other popularization, which will provide theoretical support for accelerating the improvement of hybrid vigor and yield stability, and thus promote more sustainable agricultural development.

[0094] The significance of this study also includes two aspects:

[0095] 1. Enrich Darwin's theory of evolution, revealing the mystery of maize hybrid inferiority

[0096] The molecular mechanism of plant hybrid inferiority is of great significance to understand species formation and reproductive isolation. Hybrid vigor has been considered a universal phenomenon and has been widely used in the yield improvement of many important crops. In contrast, hybrid inferiority, which is opposite to hybrid vigor, occurs less frequently in nature and is less reported. We first discovered hybrid inferiority in maize and found that the protein functions as a dimer, revealing new incentives for the formation of maize hybrid inferiority, expanding the understanding of the concept of reproductive isolation, and enriching Darwin's theory of evolution.

[0097] 2. Guiding hybrid vigor breeding to cultivate high-quality and high-yield maize varieties

[0098] Maize hybrid inferiority has always been an obstacle to the utilization of hybrid vigor between species or subspecies. Many strong hybrid combinations show great advantages in yield, but the existence of hybrid inferiority limits the direct utilization of hybrid vigor. Studying the molecular genetic mechanism of maize hybrid inferiority can deepen our understanding of maize origin and evolution, genetic diversity formation, and species adaptability, and provide a theoretical basis for utilizing maize hybrid vigor in production.

[0099] The present application will be further described in detail in conjunction with specific examples. It should be understood that the following examples are only used to illustrate the present application but not to limit the scope of the present application.

[0100] Examples

[0101] The addition amount, content and concentration of various substances involved in the examples are described herein, and the percentage content refers to the mass percentage content unless otherwise specified.

[0102] In the examples herein, if no specific description is made for the reaction temperature or operating temperature, the temperature generally refers to room temperature (15-30℃).

[0103] Materials and methods:

[0104] Selfing, crossing, and field breeding of maize plants are carried out according to conventional breeding methods.

[0105] The primer synthesis and gene sequencing in the examples were completed by Beijing Genesee Biotechnology Co., Ltd.

[0106] The molecular biology experiments in the examples include plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, medium preparation, etc., which are mainly performed according to the Molecular Cloning Laboratory Guide (Fourth Edition), M. R. Green, J. Sambrook (USA) edited, He Fuchu translated, Science Press, Beijing, 2017. If necessary, the specific experimental conditions can be determined by simple tests.

[0107] The PCR amplification experiments were performed according to the reaction conditions or kit instructions provided by the reagent suppliers. If necessary, they can be adjusted by simple tests.

[0108] The molecular biology methods and transgenic plant construction methods including Recg overexpression recombinant plasmid construction, Agrobacterium engineering bacteria construction, gene editing technology, etc. are operated by using the technical means commonly used in the art.

[0109] Example 1: Genetic population creation and phenotype observation

[0110] B73 is the most commonly used inbred line in corn scientific research. In 1896, Professor Cyril G. Hopkins of the University of Illinois initiated the corn protein content breeding work that has lasted for a hundred years, and bred several corn varieties including Illinois High Protein (IHP). B73 and IHP varieties have large morphological differences. Compared with B73, IHP grows more slowly, and when IHP line develops to VT period (heading stage), B73 has entered R1 period and the female ear is silking. In order to identify the QTL related to high protein trait in IHP, we used IHP as the high protein donor parent and B73 as the recurrent parent to create a series of continuous backcross populations. In the process, we accidentally discovered the hybrid disadvantage phenomenon between the two inbred lines. When B73 is used as the female parent and IHP as the male parent, the progeny plants show hybrid advantage beyond the parents. However, when IHP is used as the female parent, the progeny plants are dwarf, slow development, plant height is only 20-40 cm, and necrosis in later stage, and cannot complete its own growth and development. As shown in Figure 1 .

[0111] Although IHP × B73 shows hybrid disadvantage, when IHP is used as the female parent and crossed with corn inbred line W64A, the hybrid disadvantage effect can be overcome, and the F1 plant height reaches about 180-220 cm, which restores to about 80% of the W64A × IHP plant height. We call this phenomenon hybrid recovery. See Figure 1 .

[0112] Example 2: BSA sequencing and cloning of hybrid disadvantage genes

[0113] To map the gene controlling hybrid maize inferiority, we crossed B73 as the female parent and IHP as the male parent, and the F1 generation showed hybrid superiority. Then we crossed IHP as the female parent and F1 as the male parent. The offspring showed trait segregation, half of which showed normal plant phenotype and the other half showed hybrid inferiority. Based on trait segregation, we collected leaf DNA samples of plants with normal phenotype and hybrid inferiority phenotype (n = 100 for each) for BSA DNA sequencing. See Figure 2 Figure 2A shows that there is a significant peak in the region of 180 Mb to 220 Mb of chromosome 5.

[0114] Based on the gene structure variation of B73 genome and IHP genome, we developed efficient molecular markers for fine mapping, and used 5000 segregating individuals for genotyping and linkage analysis, successfully mapped the candidate gene Recg to 207.37-207.56 Mb on chromosome 5 (B73_V4). Based on the B73 reference genome, we narrowed down the target gene to a 190 kb region containing 7 genes (Zm00001d017806, Zm00001d017807, Zm00001d017808, Zm00001d017809, Zm00001d017810, Zm00001d017811, Zm00001d017812) (Figure 2B). Figure 2 Zm00001d017808 is the only gene among the above seven genes that encodes a cell organelle localization protein, which encodes an ATP-dependent DNA helicase, which we named Recg. The full-length of Recg gene is 16052 bp, compared with the Recg gene of B73 haplotype, the Recg gene of IHP haplotype has a functional mutation of stop codon (TAG) at the 9th exon, we extracted the leaf proteins of B73, IHP and W64A at VT stage for Western blotting experiment, and detected the RECG protein in the samples with Anti-RECG, and found that the IHP-RECG protein was truncated and the translation was prematurely terminated. While the Recg gene of W64A haplotype has similar structural variation with Recg-IHP, multiple SNP variations occur in the exons, resulting in non-synonymous mutations of amino acids, which may imply that changes in amino acids may lead to changes in protein structure (Figure 2C). Figure 2

[0115] Example 3: Genetic verification of gene Recg

[0116] To genetically verify Recg that controls hybrid inferiority, we constructed overexpression of Recg in B73 background using ubiquitin promoter W64A ​The genetic material of the B73 transgenic maize is constructed by using IHP as the female parent and OE-Recg-W64A as the male parent to produce offspring F1. We observed the phenotype of the F1 grown in a representative line in Shanghai and found that the plant height of the offspring was about 111-134 cm and 125-142 cm, respectively, which restored the normal plant height to a certain extent and could complete the growth and development. Figure 2 Through qRT-PCR detection, we found that the Recg-W64A gene in the two overexpression lines was significantly higher than that in the wild type at the mRNA level (Fig. 3 Figure 2 E); and the protein level of RECG was significantly higher than that of the B73 control (Fig. 3 Figure 2 F) through western blot.

[0117] Among them, the overexpression Recg W64A The construction of the B73 transgenic maize roughly includes the following steps.

[0118] First, the overexpression RECG vector is constructed, and the cDNA of W64A is used as the template for amplification. The amplification primer is:

[0119] Forward primer RECG-Flag-F:

[0120] caggtcgactctagaggatccATGTCCTTCACTGGTTCCGCC,

[0121] Reverse primer RECG-Flag-R:

[0122] cgatcggggaaattcgagctctcacttgtcatcgtcatccttgtagtcgatgtcatgatctttataatcaccgtcatggtctttgtagtccatATCTCCAAGAATGCACAATG.

[0123] PCR conditions: Phanta UniFi Super-Fidelity DNA Polymerase enzyme of Nuoyizhan is used for PCR amplification. The system is according to the standard mixed system of Phanta enzyme. 98℃ pre-denaturation for 30s, 98℃ denaturation for 10s, 60℃ annealing for 10s, 72℃ extension for 15s, 35 cycles, 72℃ extension for 55min.

[0124] The PCR amplified fragment was cloned into pCAMBIA3300 vector by homologous recombination method (ClonExpress II One Step Cloning Kit, C112-02, Novagen), placed downstream of the maize Ubiquitin (UBI) promoter, and the overexpression RECG vector was constructed. Refer to Molecular Cloning Experiment Guide (4th edition) to prepare Agrobacterium EHA105 competent cells. The overexpression RECG vector was transformed into maize B73 immature embryos by Agrobacterium-mediated method to obtain overexpression transgenic maize. Genetic transformation was carried out in Jiangsu Maize Biotechnology Co., Ltd.

[0125] Quantitative PCR analysis and Western blotting of transgenic maize, the primer pairs used include:

[0126] Forward primer OE-RECG-F: ttggatgatggcatatgcagcag,

[0127] Reverse primer OE-RECG-R: ATCCTCTAGCTGGCGATATTGC.

[0128] Example 4: Creation of genetic replication materials

[0129] In order to explore whether the genetic phenomenon of maize hybrid disadvantage can be replicated, we constructed genetic replication (flow chart) materials. F1 (B73 x IHP) was selfed to obtain F2, and genotypes (Recg B73 , Recg B73 / IHP , Recg IHP ) were separated in F2 plants, and then the offspring plants were continuously selfed according to the genotype. We randomly selected 200 seeds, planted according to the same genotype, and found that the genotypes Recg B73 and Recg B73 / IHP did not have abnormal phenotypes on the plants, and homozygous plants of the genotype Recg IHP had yellow and small corn plants. Transmission electron microscopy of corn plant leaves found that homozygous plants of the genotype Recg IHP had significantly reduced chloroplast numbers and abnormal chloroplast thylakoid and matrix structures. At the same time, we continued to self according to the genotype, and found that the proportion of yellow flower seedlings in homozygous plants of the genotype Recg IHP increased in F5, and the plant height showed a 30-120 cm fluctuation. The yellow flower plants could not complete their own growth and development. See Figure 3 .

[0130] Example 5: Interaction analysis of RECG protein

[0131] RECG is an ATP-dependent DNA helicase, which is conserved in sequence and structure function in monocotyledon, and the function in Arabidopsis has been very clear.

[0132] We verified the interaction between RECG-IHP and RECG-B73, RECG-W64A by yeast two-hybrid, we found that IHP-RECG respectively with B73-RECG, W64A-RECG interaction exists; through tobacco luciferase complementation imaging, CO-IP also confirmed that RECG-B73, RECG-W64A two proteins can interact. Further, we proved by micro thermal swing (MST) that the binding force of RECG-IHP and RECG-B73 is stronger than that of RECG-IHP and RECG-W64A. The results are shown in Figure 5

[0133] Example 6: Evaluation and utilization of hybrid advantage

[0134] In order to evaluate whether cytoplasm has an impact on hybrid advantage, we made F1 of W64A as female and B73 as male, W64A as male and B73 as female respectively. As shown in Figure 6 , we found that W64A × B73 is about 18 cm higher than B73 × W64A plant height, and the biomass is about 140 g more. At the same time, we evaluated the yield of the two kinds of cross and backcross in the field, and analyzed that the stick of W64A × B73 was significantly larger than that of B73 × W64A, the hundred-grain weight of W64A × B73 was 29.58 g, and the hundred-grain weight of B73 × W64A was 26.7 g. The yield was significantly improved. Utilizing cytoplasm for hybrid advantage breeding significantly improves corn yield, which helps to guide future breeding practice, and also provides valuable genetic resources and strategies for future breeding work.

[0135] The above-described embodiments are only preferred embodiments of the present application, and the protection scope of the present application is not limited thereto. The equivalent substitutions or transformations made by the skilled in the art on the basis of the present application are within the protection scope of the present application.

[0136] It should be noted that the enumeration and discussion of the previously disclosed documents in the specification should not be regarded as admitting that the document is prior art or common general knowledge.

[0137] Main references

[0138] ​Bomblies, K., and Weigel, D. (2007). Hybrid necrosis: autoimmunity as a potential gene-flow barrier in plant species. Nat Rev Genet 8, 382-393.

[0139] Chen, C., Chen, H., Lin, Y.S., Shen, J.B., Shan, J.X., Qi, P., Shi, M., Zhu, M.Z., Huang, X.H., Feng, Q., et al. (2014). A two-locus interaction causes interspecific hybrid weakness in rice. Nat Commun 5, 3357.

[0140] Dixon, M.S., Jones, D.A., Keddie, J.S., Thomas, C.M., Harrison, K., and Jones, J.D. (1996). The tomato Cf-2 disease resistance locus comprises two functional genes encoding leucine-rich repeat proteins. Cell 84, 451-459.

[0141] Dodds, P.N., and Rathjen, J.P. (2010). Plant immunity: towards an integrated view of plant-pathogen interactions. Nat Rev Genet 11, 539-548.

[0142] Hewitt, T., Zhang, J.P., Huang, L., Upadhyaya, N., Li, J.B., Park, R., Hoxha, S., McIntosh, R., Lagudah, E., and Zhang, P. (2021). Wheat leaf rust resistance gene is a specific allele for hybrid necrosis. Molecular Plant 14, 1025-1028.

[0143] Li, C.B., Binaghi, M., Pichon, V., Cannarozzi, G., de Freitas, L.B., Hanemian, M., and Kuhlemeier, C. (2023). Tight genetic linkage of genes causing hybrid necrosis and pollinator isolation between young species. Nature Plants 9, 420.

Claims

1. Use of ATP-dependent DNA helicase RECG or its expression gene in improving agronomic traits of a Poaceae crop.

2. Use according to claim 1, characterized in that, The Poaceae crop is selected from the group consisting of maize, wheat, rice, soybean, barley, oat, millet, rye and sorghum.

3. Use according to claim 1, characterized in that, The Poaceae crop is maize, including wild species, inbred lines, landraces and hybrids, and the maize variety is selected from the group consisting of B73, KN5585, Zhengdan 958, Denghai 605, Xianyu 335, Jingke 968, Qiangyu 998, Longping 638, Desan 179, Denghai Pioneer D20, Meiyu 27, Nongke Nu 336, Yutian 28, Shenko Sweet 811, Heitian Nu 33, Chuandan 99, Hengyu 828, Guidan 162, Chang 72, Mo 17, Liangyu 99, W22, B104, W64A, IHP.

4. The use according to claim 1, characterized in that, The agronomic traits include grain yield and shoot biomass, i.e. plant size, i.e. the use is the use of helicase RECG for increasing grain yield and / or plant biomass of a Poaceae crop.

5. Use according to claim 4, characterized in that, The use is a method for increasing grain yield and / or plant biomass of a Poaceae crop by using helicase RECG, comprising the following steps: A. enhancing the expression level of endogenous helicase RECG in the Poaceae crop; B. causing the Poaceae crop to overexpress exogenous helicase RECG with increased enzyme activity; or C. crossing the Poaceae crop as the male parent with another Poaceae crop variety with higher helicase RECG enzyme activity as the female parent to breed a hybrid variety with improved agronomic traits.

6. The use according to claim 3, characterized in that, The amino acid sequence of helicase RECG-B73 of maize B73 is shown as SEQ ID NO: 1, and the nucleotide sequence of the coding region B73-RecgCDS of the expression gene thereof is shown as SEQ ID NO: 2; the amino acid sequence of helicase RECG-IHP of maize IHP is shown as SEQ ID NO: 3, and the nucleotide sequence of the coding region IHP-RecgCDS of the expression gene thereof is shown as SEQ ID NO: 4; the amino acid sequence of helicase RECG-W64A of maize W64A is shown as SEQ ID NO: 5, and the nucleotide sequence of the coding region W64A-RecgCDS of the expression gene thereof is shown as SEQ ID NO:

6.

7. Use according to claim 5, characterized in that, The implementation of step A is: A-1. cloning the endogenous helicase RECG-encoding gene Recg of the crop in a plasmid vector, preferably in a plasmid vector suitable for expression in Agrobacterium to form a recombinant plasmid, i.e. a Recg overexpression vector, then transforming plant cells or tissues by using Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, electroporation or Agrobacterium-mediated method, and cultivating the transformed plant tissues into plants to obtain transgenic plants overexpressing helicase RECG; and / or A-2. placing the existing helicase RECG-encoding gene Recg in the genome of the crop under the control of a functionally enhanced promoter.

8. The use according to claim 5, characterized in that, The implementation of step B is: B-1. Cloning the Recg gene encoding the higher-activity helicase RECG from different varieties on a plasmid vector to form a recombinant plasmid, i.e., a Recg overexpression vector, and then transforming plant cells or tissues of crops by using a Ti plasmid, a Ri plasmid, a plant virus vector, direct DNA transformation, microinjection, electroporation, or an Agrobacterium-mediated method, and cultivating the transformed plant tissues into plants to obtain a transgenic plant overexpressing the foreign helicase RECG; B-2. Replacing the existing Recg gene encoding the helicase RECG in the genome of a crop with a Recg gene encoding a higher-activity helicase RECG from different varieties by gene editing technology; or B-3. Cloning a Recg gene encoding a higher-activity helicase RECG from different varieties in the genome of a crop by gene editing technology to obtain a transgenic plant overexpressing the foreign helicase RECG.

9. A method of identifying a transgenic maize or a hybrid maize comprising the maize B73-derived helicase RECG gene B73-Recg or the maize IHP-derived helicase RECG gene IHP-Recg as obtained in claim 8, characterized in that, comprising the following steps: extracting corn genomic DNA and performing a PCR amplification reaction using the following primer pairs, forward primer Recg-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 7), reverse primer Recg-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 8), when the PCR product size is 491 bp and the amplified sequence is SEQ ID NO: 9, it indicates that the corn genome contains the gene B73-Recg, when the PCR product size is 483 bp and the amplified sequence is SEQ ID NO: 10, it indicates that the corn genome contains the gene IHP-Recg; and / or determining whether the protein expressed by the corn cell contains the polypeptide RECG-B73 having the amino acid sequence shown in SEQ ID NO: 1 or the polypeptide RECG-IHP having the amino acid sequence shown in SEQ ID NO:

3.

10. A kit for carrying out the method of identification according to claim 9, characterized in that, comprising the following PCR primers for amplifying the gene: forward primer Recg-F: ATTCCAGCCCAATAAAATAGCC (SEQ ID NO: 7), reverse primer Recg-R: GACGACGAGACACGAGAGGC (SEQ ID NO: 8).

Images