Molecular marker related to content of glyceryl phosphorylethanolamine in pig muscle and application of molecular marker

By detecting the genotype of specific SNP sites in the pig genome, molecular markers related to the content of glycerophosphorylethanolamine in pig muscle are provided, solving the problems of improving pork quality and saving breeding costs, enabling early selection and genetic improvement, and enhancing meat quality and flavor.

CN121065366AActive Publication Date: 2025-12-05INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202511621082.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-07
Publication Date
2025-12-05
Estimated Expiration
2045-11-07

AI Technical Summary

Technical Problem

Currently, there is a lack of molecular markers related to the content of glycerol phosphoryl ethanolamine in pork, making it difficult to improve the intrinsic biological essence of pork quality and consumer demand through breeding techniques.

Method used

By detecting or assisting in the detection of glycerol phosphoryl ethanolamine content in pigs, selecting pigs with high glycerol phosphoryl ethanolamine content, preparing pig breeding products, and using this method to detect or assist in the detection of glycerol phosphoryl ethanolamine content in pigs.

Benefits of technology

This method enables early selection of pigs with high glycerophosphorylethanolamine content, saving breeding costs, improving meat quality and flavor, and accelerating genetic progress, thus possessing economic and scientific research value.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses a molecular marker related to the content of glyceryl phosphorylethanolamine in pig muscle and application of the molecular marker. The invention provides an application of a substance for detecting the genotype of an SNP site in a pig genome in at least one of the following applications: A1) detecting or assisting in detecting the content state of glyceryl phosphorylethanolamine of a to-be-detected pig; a2) breeding pigs with high content of glyceryl phosphorylethanolamine; a3) pig breeding; and A4) preparing a product for detection or auxiliary detection of the content state of the glyceryl phosphorylethanolamine of the to-be-detected pig. According to the invention, by detecting the genotype of the pig to be detected at the SNP site, early selection of the content of glyceryl phosphoryl ethanolamine in pig muscle can be realized, the production cost can be saved, the genetic progress can be accelerated, and the SNP site has great economic application value and scientific research value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and relates to a molecular marker related to the content of glycerophosphoryl ethanolamine in pig muscle and application thereof. BACKGROUND

[0002] Pork is the largest meat product in China, and its production efficiency and meat quality are directly related to the breeding benefit and consumer demand. With the increasing demand of consumers for meat quality, traditional methods of sensory evaluation and physicochemical index detection are difficult to fully reflect the inherent biological nature. During the muscle development and postmortem maturation of pigs, a series of small molecule metabolites have an important influence on the quality characteristics such as flavor, color and water retention.

[0003] Glycerophosphoryl ethanolamine, as a phospholipid compound, has certain antioxidant properties and is widely present in animal muscle tissue, especially in cell membrane phospholipids. It can help to reduce rancid taste and other undesirable flavors generated during storage by regulating fatty acid metabolism, reducing the generation of free radicals and delaying the oxidation process of fat, thereby maintaining the original flavor of meat. By regulating lipoxygenase activity, competitively inhibiting the degradation of sulfur-containing amino acids, increasing the content of aldehydes and ketones, enhancing fat aroma and grilled meat aroma, and reducing the fishy smell of meat. During the heat processing, it reacts with reducing sugars to generate pyrazine substances, contributing to the nutty aroma. Glycerophosphoryl ethanolamine affects the fatty acid composition, fat oxidation process, tenderness, flavor and nutritional value of meat through multiple pathways.

[0004] At present, molecular marker-assisted breeding technology has been widely used in the cultivation of new varieties in the field of livestock and poultry, and through whole genome association analysis, molecular markers closely related to the target traits can be obtained. Early selection of target traits using molecular markers can greatly save breeding costs and accelerate genetic progress. However, there is no molecular marker related to the content of glycerophosphoryl ethanolamine in pork. SUMMARY

[0005] The technical problem to be solved by the present application is to provide a molecular marker related to the content of glycerophosphoryl ethanolamine in pig muscle. The technical problem to be solved is not limited to the technical subject described, and other technical subjects not mentioned herein can be clearly understood by those skilled in the art through the following description.

[0006] To solve the above technical problem, the present application provides, in a first aspect, the use of a substance for detecting the genotype of a SNP site in the genome of a pig, A1) detecting or assisting in detecting the glycerophosphoryl ethanolamine content state of the pig to be tested; A2) breeding pigs with high glycerophosphoryl ethanolamine content; A3) pig breeding; A4) preparing a product for detecting or assisting in detecting the content state of glycerylphosphorylethanolamine of a pig to be tested; A5) preparing a product for selecting a pig with high glycerylphosphorylethanolamine content; A6) preparing a product for pig breeding; the SNP site is the 193rd nucleotide of SEQ ID NO: 1; the genotype of the SNP site is GG or CC or GC.

[0007] In the above, the index for breeding is the content of glycerylphosphorylethanolamine.

[0008] Specifically, the pig breeding is detecting or assisting in detecting the content state of glycerylphosphorylethanolamine of a pig to be tested, or selecting a pig with high glycerylphosphorylethanolamine content.

[0009] In the above, the pig to be tested can be an individual, a group or a breed.

[0010] The purpose of the breeding is to select an individual with high glycerylphosphorylethanolamine content in longissimus dorsi.

[0011] The purpose of the breeding is to select a group with high glycerylphosphorylethanolamine content in longissimus dorsi.

[0012] The purpose of the breeding is to select a breed with high glycerylphosphorylethanolamine content in longissimus dorsi.

[0013] In the breeding, individuals with GC genotype or CC genotype are eliminated.

[0014] In the breeding, individuals with GG genotype are retained.

[0015] In the above, the content state of glycerylphosphorylethanolamine is high or low.

[0016] In a second aspect, the present application provides use of a substance for detecting a base of a SNP site in a pig genome in at least one of the following, A1) detecting or assisting in detecting the content state of glycerylphosphorylethanolamine of a pig to be tested; A2) selecting a pig with high glycerylphosphorylethanolamine content; A3) pig breeding; A4) preparing a product for detecting or assisting in detecting the content state of glycerylphosphorylethanolamine of a pig to be tested; A5) preparing a product for selecting a pig with high glycerylphosphorylethanolamine content; A6) preparing a product for pig breeding; the SNP site is the 193rd nucleotide of SEQ ID NO: 1; the base of the SNP site is G or C.

[0017] In the above-mentioned application, the substance is any one of B1-B2): B1) a primer pair; B2) a PCR reagent or kit containing the primer pair of B1); The primer pair consists of a single-stranded DNA molecule shown in SEQ ID NO: 2 and a single-stranded DNA molecule shown in SEQ ID NO: 3.

[0018] The kit can also include conventional reagents for PCR amplification. The kit can also include conventional reagents for sequencing.

[0019] In a third aspect, the present application provides a method for detecting or assisting in detecting the content state of glycerylphosphorylethanolamine in a pig to be tested, comprising the following steps: detecting the genotype of the SNP site in the genome of the pig to be tested in the first aspect, the genotype of the SNP site being GG or CC or GC, and the content of glycerylphosphorylethanolamine in the pig to be tested with the genotype of the SNP site being GG being higher or candidate higher than that of the pig to be tested with the genotype of the SNP site being CC or GC.

[0020] In a fourth aspect, the present application provides a method for detecting or assisting in detecting the content state of glycerylphosphorylethanolamine in a pig to be tested, comprising the following steps: detecting the base of the SNP site in the genome of the pig to be tested in the first aspect, the base of the SNP site being G or C, the content of glycerylphosphorylethanolamine in the pig to be tested with the base of the SNP site in the genome on both homologous chromosomes being G being higher or candidate higher than that of the pig to be tested with the base of the SNP site in the genome on both homologous chromosomes being C; or the content of glycerylphosphorylethanolamine in the pig to be tested with the base of the SNP site in the genome on both homologous chromosomes being G being higher or candidate higher than that of the pig to be tested with the base of the SNP site in the genome on only one homologous chromosome being C.

[0021] In the above-mentioned method, the method for detecting the genotype of the SNP site in the genome of the pig to be tested in the first aspect comprises the following steps: using the genomic DNA of the pig to be tested as a template, performing PCR amplification with the primer pair in the second aspect to obtain a PCR product, and sequencing the PCR product, if the PCR product only contains a DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being G, and does not contain a DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being C, then the specific SNP genotype of the pig to be tested is GG; if the PCR product contains neither the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being G nor the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being C, then the specific SNP genotype of the pig to be tested is CC; if the PCR product contains both the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being G and the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being C, then the specific SNP genotype of the pig to be tested is GC.

[0022] In the above method, the method for detecting the base of the SNP site in the genome of the pig to be tested in the first aspect comprises the following steps: taking the genomic DNA of the pig to be tested as a template, performing PCR amplification with the primers in the second aspect to obtain a PCR product, and sequencing the PCR product, if the PCR product contains only the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being G and contains neither the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being G nor the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being C, then the base of the SNP site in the genome on both homologous chromosomes of the pig to be tested is G; if the PCR product contains neither the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being G nor the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being C, then the base of the SNP site in the genome on both homologous chromosomes of the pig to be tested is C; if the PCR product contains both the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being G and the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 being C, then the base of the SNP site in the genome on only one homologous chromosome of the pig to be tested is C, and the base of the SNP site in the genome on the other homologous chromosome is G.

[0023] In a fifth aspect, the present application provides a method for breeding a pig with high glycerophosphoryl ethanolamine content, comprising the following steps: Selecting the test pig with genotype GG of the SNP site in the method of the third aspect, breeding, and realizing breeding of the pig with high glycerylphosphorylethanolamine content; or selecting the test pig with both bases of the SNP site in the genome on the two homologous chromosomes being G in the method of the fourth aspect, breeding, and realizing breeding of the pig with high glycerylphosphorylethanolamine content.

[0024] In the sixth aspect, the present application provides a product comprising any one of B1-B2): B1) a primer pair; B2) a PCR reagent or kit containing the primer pair of B1); The primer pair consists of the single-stranded DNA molecule shown in SEQ ID NO: 2 and the single-stranded DNA molecule shown in SEQ ID NO: 3.

[0025] The product described above has at least one of the following applications: A1) detecting or assisting in detecting the glycerylphosphorylethanolamine content status of the test pig; A2) breeding the pig with high glycerylphosphorylethanolamine content; A3) pig breeding.

[0026] In the above, the glycerylphosphorylethanolamine content is the glycerylphosphorylethanolamine content of the longissimus dorsi muscle.

[0027] The skilled in the art knows that SEQ ID NO: 1 is composed of the SNP site (the 193rd nucleotide of SEQ ID NO: 1) and the nucleotide sequence near it, and the number of nucleotide sequences near the SNP site should not be a limiting factor of the protection scope of the present application, which can be 25 bp, 50 bp, 70 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp before and after the SNP site, or other arbitrary values, which functions to assist in locating the position of the SNP on chromosome 3 of the pig genome.

[0028] The before and after described herein should be defined as before or after in the direction recognized by the skilled in the art, such as the 5'-3' direction.

[0029] Any of the pigs described above is all pig breeds.

[0030] The SNP molecular marker of the application is related to the content of glycerophosphoryl ethanolamine in the longissimus dorsi of pigs, is a new molecular marker, and can save production cost, improve meat quality and flavor, and accelerate genetic progress, better serve pig breeding, and has great economic application value and scientific research value. DETAILED DESCRIPTION

[0031] The application will be further described in detail below in conjunction with specific embodiments. The examples provided below are only intended to illustrate the application, and are not intended to limit the scope of the application. The examples provided below can serve as a guide for further improvement by those of ordinary skill in the art, and do not constitute any limitation on the application in any way.

[0032] In the following examples, the experimental methods are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial channels, unless otherwise specified.

[0033] In the quantitative test in the following examples, three repeated experiments were set, and the average value was taken, unless otherwise specified.

[0034] In the following examples, the data were processed using GraphPad Prism 8 statistical software, and the experimental results were expressed as mean ± standard deviation, and One-way ANOVA test was used, P<0.05 (*) indicating significant difference.

[0035] Example 1, determination of the correlation between specific SNP and the content of glycerophosphoryl ethanolamine in longissimus dorsi Test animals: Landrace pigs, Large White pigs, and Three-way pigs, all from COFCO Jiajiakang (Chifeng) Co., Ltd.

[0036] I. Determination of the content of glycerophosphoryl ethanolamine in longissimus dorsi Under the same feeding conditions, 521 healthy pigs were randomly selected at 180 days, and 10 g of longissimus dorsi samples were collected and stored in liquid nitrogen for frozen preservation.

[0037] Pre-treatment sample: uniform sampling of the sample, muscle tissue is ground and mixed, accurately take about 40 mg sample (take a certain sample in a mortar, add liquid nitrogen and weigh, to prevent sample degradation) in a 2 mL centrifuge tube, add 300 uL of methanol, add 5 mm steel ball, homogenate the muscle tissue with homogenizer (60 Hz, 60 s). Remove the steel ball with a magnet, add 1 ml MTBE, vortex for 1 min, add 250 uL of water after vortexing to separate layers, stand for 5 min. After sufficient extraction, centrifuge at 4℃ for 5 min at 5000 rpm. Take 250 ul of the lower layer to dry, and the lower layer is reconstituted with 200 ul of 80% methanol water as the sample to be tested, and the content of glycerophosphoethanolamine in longissimus dorsi muscle is detected by liquid chromatography-mass spectrometry (the peak area size is taken as a relative response value, that is, the content of glycerophosphoethanolamine in longissimus dorsi muscle).

[0038] Instrument equipment: automatic sampler, liquid chromatograph, mass spectrometer, liquid chromatograph column (ACQUITY UPLC HSS T3 Column, 2.1 mm x 100 mm, Waters).

[0039] Preparation of mobile phase: mobile phase A: dissolve 0.315 g of ammonium formate in 1000 mL of deionized water (5% ammonium formate); mobile phase B: dissolve 0.315 g of ammonium formate in 20 mL of deionized water, then add 980 mL of acetonitrile (5% ammonium formate); The retention time of glycerophosphoethanolamine is 0.86061 ± 0.01 min.

[0040]

[0041]

[0042] II. Detection of SNP molecular markers 1. Blood sample collection: collect the venous blood of the pig to be tested with a heparin sodium anticoagulation blood collection tube, and store at -20℃ for standby.

[0043] The above-mentioned pig to be tested is selected from 521 pigs in good health.

[0044] 2. Whole blood genomic DNA extraction: the specific operation method is carried out according to the blood genomic DNA extraction kit (Tiangen, DP319) instruction manual.

[0045] 3. Genotyping: The genomic DNA of each pig was sequenced by Illumina Hiseq X-Ten sequencing platform, and the sequencing depth of each individual was about 5x. The specific method was according to the standard operating procedure provided by Illumina. After quality control, the sequence alignment and genotype extraction were performed by BWA and GATK bioinformatics software.

[0046] III. Genome-wide association analysis of longissimus dorsi glycerophosphoethanolamine The genome-wide association analysis of the longissimus dorsi glycerophosphoethanolamine content obtained in the above and the genotype obtained in the above was statistically analyzed by using the compressed mixed linear model of EMMAX software. The result of the association analysis found that a SNP at position 20767343 of chromosome 3 was significantly related to the glycerophosphoethanolamine trait, and therefore the SNP was named as "Chr3: 20767343 SNP", i.e. the nucleotide at position 20767343 of chromosome 3 of the pig genome (Sscrofa11.1, GCF_000003025.6) (corresponding to the nucleotide at position 193 of the nucleotide sequence SEQ ID NO: 1), the base of the SNP site was R, R was G or C, and the genotype of the SNP site was GG, CC or GC. For the sake of brevity, it was referred to as specific SNP hereinafter. The glycerophosphoethanolamine content of the pig with specific SNP genotype GG was greater than that of the pig with specific SNP genotype CC or GC.

[0047] A pair of primers was designed based on the specific SNP, which was composed of F and R. The target sequence of F and R in the pig genomic DNA was 405 bp, and the specific SNP was located at the 193rd nucleotide of the target sequence.

[0048] F (SEQ ID NO: 2): 5'- CAGCAAGTACTCCCACAGGG -3'; R (SEQ ID NO: 3): 5'- GCAAAGCGTTTGTTCTCGGT -3'.

[0049] As can be seen, the genotype of the specific SNP of the pig to be tested can be defined according to the following rules: GG genotype: if the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains only DNA fragments with nucleotide sequence SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is G, and does not contain DNA fragments with nucleotide sequence SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is GG or the bases of the SNP site in the genome on both homologous chromosomes of the pig to be tested are G.

[0050] CC genotype: if the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R does not contain DNA fragments with nucleotide sequence SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is G, and contains only DNA fragments with nucleotide sequence SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is CC or the bases of the SNP site in the genome on both homologous chromosomes of the pig to be tested are C.

[0051] GC genotype: if the PCR product obtained by amplifying the genomic DNA of the pig to be tested using upstream primer F and downstream primer R contains both DNA fragments with nucleotide sequence SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is G, and DNA fragments with nucleotide sequence SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is GC, or only the base of the SNP site in the genome on one homologous chromosome is C, and the base of the SNP site in the genome on the other homologous chromosome is G.

[0052] Four, a method for detecting the content of glycerophosphoryl ethanolamine in the longissimus dorsi muscle of pigs 1. Extract the genomic DNA of the pig to be tested; 2. Using the genomic DNA as the template, perform PCR amplification using F primer shown in SEQ ID NO: 2 and R primer shown in SEQ ID NO: 3 to obtain a PCR product.

[0053] The reaction system of the above PCR amplification is as follows: 2x Taq PCR MasterMix 5.00 μL (Solabio, PC1120-1ml), ddH2O 3.00 μL, F primer 0.5 μL, R primer 0.5 μL, DNA template 1.0 μL.

[0054] The reaction procedure of the PCR amplification is as follows: 95℃ 5min; 95℃ 15s, 63℃ 15s, 72℃ 10s, 35 cycles in total; 72℃ 5min; 4℃ preservation.

[0055] 3. Detection The PCR product is sent for sequencing, and the results are as follows: If the PCR product contains only the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is G, and does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is GG or the bases of the SNP site in the genome on both homologous chromosomes of the pig to be tested are G.

[0056] If the PCR product does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is G, and contains only the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is CC or the bases of the SNP site in the genome on both homologous chromosomes of the pig to be tested are C.

[0057] If the PCR product contains both the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is G, and the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the 193rd nucleotide of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is GC or the base of the SNP site in the genome on only one homologous chromosome is C and the base of the SNP site in the genome on the other homologous chromosome is G.

[0058] The content of glycerophosphorylethanolamine in the longissimus dorsi muscle of the pig with the specific SNP genotype of GG is greater than or is expected to be greater than that of the pig with the specific SNP genotype of CC or GC.

[0059] Or, the content of glycerophosphorylethanolamine in the longissimus dorsi muscle of the pig with the bases of the SNP site in the genome on both homologous chromosomes being G is higher or is expected to be higher than that of the pig with the bases of the SNP site in the genome on both homologous chromosomes being C; Or, the content of glycerophosphorylethanolamine in the longissimus dorsi muscle of the pig with the bases of the SNP site in the genome on both homologous chromosomes being G is higher or is expected to be higher than that of the pig with the base of the SNP site in the genome on only one homologous chromosome being C.

[0060] Wherein the pig can be a population or an individual.

[0061] Example 2, Application of specific SNP in genetic improvement of glycerophosphoryl ethanolamine content trait in longissimus dorsi muscle of pig Test animals: 491 long white pigs, large white pigs, three element pigs, from COFCO JIAJIAKANG (Chifeng) Co., Ltd.

[0062] I. Determination of glycerophosphoryl ethanolamine content in longissimus dorsi muscle Feeding under the same feeding conditions until 180 days. 491 healthy pigs were randomly selected, and 40 mg of longissimus dorsi muscle samples were collected and stored in liquid nitrogen.

[0063] Pre-treatment of sample: uniformly sample, grind and mix, accurately weigh 40 mg sample (take a certain sample in a mortar, weigh after adding liquid nitrogen, to prevent sample degradation) in a 2 mL centrifuge tube, add 300 uL methanol, add 5 mm steel ball, homogenize the muscle tissue with a homogenizer (60 Hz, 60 s). Remove the steel ball with a magnet, add 1 ml MTBE, vortex for 1 min, add 250 uL water after vortexing to separate layers, stand for 5 min. After sufficient extraction, centrifuge at 4°C for 5 min at 5000 rpm. Take 250 ul of the supernatant, dry, and reconstitute the lower layer with 200 ul of 80% methanol water for detection.

[0064] Instrument equipment: automatic sampler, liquid chromatograph, mass spectrometer, liquid chromatograph column (ACQUITY UPLC HSS T3 Column, 2.1 mm x 100 mm, Waters).

[0065] Solid phase microextraction conditions and gas chromatography-mass spectrometry conditions are shown in Table 1 and Table 2.

[0066] The results of glycerophosphoryl ethanolamine content (relative content) in longissimus dorsi muscle of test animals with different genotypes are shown in Table 3.

[0067] II. Detection of specific SNP in glycerophosphoryl ethanolamine content trait in longissimus dorsi muscle of pig 1. Blood sample collection The venous blood of test animals was collected with heparin sodium anticoagulation blood collection tube and stored at -20°C for standby.

[0068] 2. Extraction of genomic DNA The venous blood obtained in step 1 was used to extract genomic DNA.

[0069] 3. Genotype detection The genomic DNA obtained in step 2 was used as a template, and the primer pair composed of F shown in SEQ ID NO: 2 and R shown in SEQ ID NO: 3 was used for PCR amplification according to the method of Example 1, and then the PCR amplification product was sequenced.

[0070] The results show that 491 test animals all have PCR amplification products with a size of 405 bp, and after sequencing, the genotyping results are shown in Table 3.

[0071] Based on the specific SNP, the 491 test animals are divided into three genotypes, as shown in Table 4, GG genotype (372 test animals), GC genotype (104 test animals) and CC genotype (15 test animals). The glycerophosphoethanolamine content of the pig population with the specific SNP genotype GG is greater than that of the pig population with the specific SNP genotype CC or GC.

[0072] The relative content of glycerophosphoethanolamine detected above corresponds to each genotype group, and the results are shown in Table 4. The results show that the relative content of glycerophosphoethanolamine of the three genotypes of pigs is significantly different (P<0.05), the relative content of glycerophosphoethanolamine of the test pig with genotype GG is higher than that of the test pig with genotype GC (P<0.05) or CC (P<0.05), the relative content of glycerophosphoethanolamine of the test pig with genotype GC is higher than that of the test pig with genotype CC. Consistent with the specific SNP detection of the present application, it is shown that the method of the present application can detect or assist in detecting the relative content of glycerophosphoethanolamine of pigs.

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081]

[0082]

[0083]

[0084]

[0085]

[0086]

[0087]

[0088] The application has been described in detail. Those skilled in the art will understand that they can make modifications and alterations to this application without departing from the spirit and scope of the application. Although this application presents specific examples, it is to be understood that further modifications can be made. In general, the principles of the application are intended to be included in any alteration, modification or improvement to the application, including changes made outside the scope of the disclosure herein using conventional techniques known in the art. Some of the essential features can be applied within the scope of the following claims.

Claims

1. Use of a substance for detecting the genotype of a SNP site in the genome of a pig in at least one of the following, A1) detecting or assisting in detecting the glycerophosphoryl ethanolamine content status of a pig to be tested; A2) breeding pigs with high glycerophosphoryl ethanolamine content; A3) pig breeding; A4) preparing a product for detecting or assisting in detecting the glycerophosphoryl ethanolamine content status of a pig to be tested; A5) preparing a product for breeding pigs with high glycerophosphoryl ethanolamine content; A6) preparing a product for pig breeding; the SNP site is the 193rd nucleotide of SEQ ID NO: 1; the genotype of the SNP site is GG or CC or GC.

2. Use of a substance for detecting the base of a SNP site in the genome of a pig in at least one of the following, A1) detecting or assisting in detecting the glycerophosphoryl ethanolamine content status of a pig to be tested; A2) breeding pigs with high glycerophosphoryl ethanolamine content; A3) pig breeding; A4) preparing a product for detecting or assisting in detecting the glycerophosphoryl ethanolamine content status of a pig to be tested; A5) preparing a product for breeding pigs with high glycerophosphoryl ethanolamine content; A6) preparing a product for pig breeding; the SNP site is the 193rd nucleotide of SEQ ID NO: 1; the base of the SNP site is G or C.

3. The use of claim 1 or 2, wherein: the substance is any one of B1-B2): B1) a primer pair; B2) a PCR reagent or kit containing the primer pair of B1); the primer pair consists of a single-stranded DNA molecule represented by SEQ ID NO: 2 and a single-stranded DNA molecule represented by SEQ ID NO:

3.

4. A method for detecting or assisting in detecting the glycerophosphoryl ethanolamine content status of a pig to be tested, comprising the following steps: detecting the genotype of the SNP site in claim 1 in the genome of the pig to be tested, the genotype of the SNP site is GG or CC or GC, the glycerophosphoryl ethanolamine content of the pig to be tested with the genotype of the SNP site being GG is higher than or is suspected to be higher than the pig to be tested with the genotype of the SNP site being CC or GC.

5. A method for detecting or assisting in detecting the glycerophosphoryl ethanolamine content status of a pig to be tested, comprising the following steps: detecting the base of the SNP site in claim 1 in the genome of the pig to be tested, the base of the SNP site is G or C, the glycerophosphoryl ethanolamine content of the pig to be tested with the base of the SNP site being G on both homologous chromosomes is higher than or is suspected to be higher than the pig to be tested with the base of the SNP site being C on both homologous chromosomes; or the glycerophosphoryl ethanolamine content of the pig to be tested with the base of the SNP site being G on both homologous chromosomes is higher than or is suspected to be higher than the pig to be tested with the base of the SNP site being C on only one homologous chromosome.

6. The method of claim 5, wherein: the method for detecting the genotype of the SNP site in claim 1 in the genome of the pig to be tested comprises the following steps: using the genomic DNA of the pig to be tested as a template, performing PCR amplification with the primer pair in claim 3 to obtain a PCR product, and sequencing the PCR product, if the PCR product only contains the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is G, and does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is GG; if the PCR product does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is G, and only contains the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is CC; if the PCR product contains both the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is G, and the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is C, then the specific SNP genotype of the pig to be tested is GC.

7. The method of claim 5, wherein: the method for detecting the base of the SNP site in the genome of the pig to be tested in claim 1 comprises the following steps: using the genomic DNA of the pig to be tested as a template, performing PCR amplification with the primers in claim 2 to obtain a PCR product, and sequencing the PCR product, if the PCR product only contains the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is G, and does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is C, then the base of the SNP site in the genome of both homologous chromosomes of the pig to be tested is G; if the PCR product does not contain the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is G, and only contains the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is C, then the base of the SNP site in the genome of both homologous chromosomes of the pig to be tested is C; if the PCR product contains both the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is G, and the DNA fragment with the nucleotide sequence of SEQ ID NO: 1 and the nucleotide at the 193rd position of SEQ ID NO: 1 is C, then the base of the SNP site in the genome of only one homologous chromosome of the pig to be tested is C, and the base of the SNP site in the genome of the other homologous chromosome is G.

8. A method for selecting a pig with high glycerophosphoryl ethanolamine content, comprising the following steps: Selecting the test pig with genotype GG of the SNP site in the method of claim 4, breeding, and realizing the breeding of pigs with high glycerophosphoryl ethanolamine content; Or selecting the test pig with both bases G of the SNP site in the genome on the two homologous chromosomes in the method of claim 5, breeding, and realizing the breeding of pigs with high glycerophosphoryl ethanolamine content.

9. A product comprising any one of B1-B2): B1) a primer pair; B2) a PCR reagent or kit containing the primer pair of B1); The primer pair consists of a single-stranded DNA molecule shown as SEQ ID NO: 2 and a single-stranded DNA molecule shown as SEQ ID NO:

3.

10. The product of claim 9, characterized in that: The product has at least one of the following applications: A1) detecting or assisting in detecting the glycerophosphoryl ethanolamine content status of a test pig; A2) breeding pigs with high glycerophosphoryl ethanolamine content; A3) pig breeding.

Citation Information

Patent Citations

  • Molecular marker related to acetoin content in pig muscle and application of molecular marker

    CN119955956A

  • Molecular marker related to content of 2-acetyl-3-methylpyrazine in pig muscle and application of molecular marker

    CN120174113A

  • Application of molecular marker related to pork flavor

    CN120843692A

  • SNP molecular marker associated with intramuscular fat traits in pigs, use thereof, and method for detecting same

    WO2024021172A1

  • SNP molecular markers associated with pig body length, amplification primer thereof, and use thereof

    WO2024036775A1