LAMP (loop-mediated isothermal amplification) detection primer group for phomopsis asparagi and detection method thereof

Abstract

The invention relates to the field of agriculture, and discloses a phomopsis asparagi LAMP (loop-mediated isothermal amplification) detection primer group and a detection method thereof, the phomopsis asparagi LAMP detection primer group comprises an inner primer, an outer primer and a loop primer, the sequences of the inner primer comprise SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.6 and SEQ ID NO.7, the sequences of the outer primer comprise SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.8 and SEQ ID NO.9, and the sequences of the loop primer comprise SEQ ID NO.5 and SEQ ID NO.10. A double-target primer group is designed aiming at pathogenic related protein gene PevD1 and ITS2 regions of the phomopsis asparagi, and the PevD1 gene is a specific pathogenic gene of the phomopsis asparagi, so that pathogenic strains are identified.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of agriculture, in particular to a LAMP detection primer set for Phoma asparagi and a detection method thereof. BACKGROUND

[0002] Asparagus is an important perennial herbaceous economic crop in the world, with both edible and medicinal values, and has formed a large-scale planting industry in Shandong, Henan, Yunnan, Jiangsu and other regions of China. Its yield and quality are directly related to the economic benefits of the growers and the sustainable development of the industry. Phoma asparagi is a devastating fungal disease caused by Phoma asparogi, which mainly infects asparagus stems, lateral branches, phyllodes and tender stems. After the disease occurs, brown fusiform lesions are formed, and the upper tissues are withered and broken at the later stage, which can cause total loss of the whole field. It is one of the core diseases that restrict the healthy development of asparagus industry.

[0003] In the comprehensive prevention and control system of asparagus stem blight, early and accurate detection of the pathogen is a key technical link. Currently, the commonly used existing technology mainly uses pathogen isolation and culture method. However, the nutritional and temperature requirements of different geographical populations of the pathogen are significantly different, and some strains are sensitive to the carbon-nitrogen ratio of the culture medium. Under conventional conditions, the growth of the strains is inhibited or no typical identification characteristics are produced, making it difficult to accurately identify the strains, and the accuracy of the detection results is insufficient. SUMMARY

[0004] In view of the deficiencies of the prior art, the present application provides a LAMP detection primer set for Phoma asparogi and a detection method thereof, which solves the problem of insufficient accuracy of the detection results of the detection method of the prior art in the detection of Phoma asparogi.

[0005] To achieve the above purpose, the present application realizes the following technical scheme: a LAMP detection primer set for Phoma asparogi, comprising an inner primer, an outer primer and a loop primer, the sequence of the inner primer comprising SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 and SEQ ID NO. 7, the sequence of the outer primer comprising SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 8 and SEQ ID NO. 9, and the sequence of the loop primer comprising SEQ ID NO. 5 and SEQ ID NO. 10.

[0006] By adopting the technical scheme, the double-target point primers are designed for the pathogenicity-related protein gene PevD1 and the ITS2 region of the asparagus stem blight fungus, the PevD1 gene is a pathogenic gene specific to the asparagus stem blight fungus, and has low homology with other fungi, so that the pathogenic strain is recognized; the ITS2 region is a conservative region of fungi, and can cover asparagus stem blight fungus strains of different geographical populations, and the double-target point is amplified at the same time, and the result is determined only when they are all positive, thereby effectively avoiding the problems of false positive and false negative caused by strain variation or cross reaction of related bacteria in the traditional single-target point detection, improving the accuracy of the detection result, and solving the problem of insufficient accuracy of the detection result in the detection method of the prior art.

[0007] A detection method of the asparagus stem blight fungus LAMP detection primer group is applied to the asparagus stem blight fungus LAMP detection primer group, and includes the following steps: Step one: extracting DNA of the sample to be detected as a template; Step two: using the primer group and the template to prepare a LAMP reaction system; Step three: performing isothermal amplification on the reaction system at 60-65 DEG C to obtain an amplification product; Step four: detecting and determining the amplification product, and when the PevD1 gene and the ITS2 region in the template are both positive, it is determined that the sample to be detected contains the asparagus stem blight fungus.

[0008] Preferably, in step one, the sample to be detected includes one of the stems, leaves, seeds or rhizosphere soil of asparagus, and the DNA extraction method includes the following steps: When the stem or leaf is used as the sample to be detected, the sample to be detected is ground and then added to 2% CTAB lysis solution for incubation at room temperature for 8 minutes, and then centrifuged to obtain the supernatant as the DNA template; When the seed is used as the sample to be detected, the sample to be detected is ground after surface sterilization, and a plant genomic DNA extraction kit is used to extract DNA; When the rhizosphere soil is used as the sample to be detected, a soil DNA extraction kit containing humic acid removal column is used to extract DNA.

[0009] Preferably, in step two, the total volume of the LAMP reaction system is 25 μL, including 10 x ThermoPol buffer 2.5 μL, dNTP mixture 4 μL, Bst DNA polymerase 1 μL, fluorescent dye 1 μL, DNA template 2 μL, inner primer, outer primer and loop primer, and sterile deionized water is added to 25 μL.

[0010] Preferably, the inner primer has a final concentration of 400 nM in the reaction system, the outer primer has a final concentration of 100 nM in the reaction system, and the loop primer has a final concentration of 300 nM in the reaction system.

[0011] Preferably, the concentration of each dNTP in the dNTP mixture is 10 mM, the Bst DNA polymerase is Bst3.0 DNA polymerase and is used in an amount of 8 U, and the fluorescent dye is SYBR Green I and is used in a concentration of 1000x dilution.

[0012] Preferably, in step three, the isothermal amplification is performed for 35-45 minutes.

[0013] In step four, the detection and determination is performed by one or more of visual fluorescence, real-time fluorescence, or agarose electrophoresis.

[0014] The present application provides a LAMP detection primer set for Phoma asparagi and a detection method thereof. 1. The present application designs a double-target primer set for the pathogenicity-related protein gene PevD1 and the ITS2 region of Phoma asparagi, which can effectively avoid false positives and false negatives caused by strain variation or cross-reactions of related bacteria in traditional single-target detection, improve the accuracy of the detection results, and solve the problem of insufficient accuracy of the detection results in the prior art.

[0015] 2. The present application introduces LNA modification, which can enhance the binding affinity of the primer to the target sequence, increase the Tm value of the primer, and allow stable binding and efficient amplification even if there is single nucleotide polymorphism in the target gene, so that the primer set has good coverage for Phoma asparagi strains from different geographical sources, and solves the problem of missed detection caused by strain variation in traditional primers.

[0016] 3. The present application can effectively cope with matrix interference of different samples by adapting to the detection of samples such as stems, leaves, seeds, and rhizosphere soil of asparagus, and can meet the whole industry chain disease control needs of asparagus seed quarantine, field monitoring, and soil early warning. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 The present application provides a detection method for a LAMP detection primer set for Phoma asparagi. DETAILED DESCRIPTION

[0018] The technical solutions of the present application will be described clearly and completely below in combination with the drawings of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the scope of protection of the present application.

[0019] The embodiment of the present application provides a LAMP detection primer set for Phoma asparagi, which comprises an inner primer, an outer primer and a loop primer, the sequence of the inner primer comprises SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 and SEQ ID NO. 7, the sequence of the outer primer comprises SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 8 and SEQ ID NO. 9, and the sequence of the loop primer comprises SEQ ID NO. 5 and SEQ ID NO. 10.

[0020] Specifically, the primer set is designed for two specific target genes of Phoma asparagi, which are pathogenic related protein gene PevD1 and ITS2 region, respectively. By simultaneously targeting the two genes, the detection of Phoma asparagi can be realized, and the false positive or false negative problems that may occur in single target detection can be effectively avoided. The sequences of the primers and the corresponding targets are as follows: Embodiment 1 Specificity verification of LAMP detection primer set for Phoma asparagi The purpose of the test of the present embodiment is to verify the specificity of the above-mentioned double-target LAMP primer set for Phoma asparagi, and to exclude the cross-reaction with related fungi and other asparagus pathogenic fungi.

[0021] The test materials used in this example include test strains, main reagents and instruments. The test strains include 15 strains, of which 6 strains of target fungi are isolated from diseased asparagus stems in Weifang, Shandong (Pa-SD1), Kaifeng, Henan (Pa-HN1), Kunming, Yunnan (Pa-YN1), Xuzhou, Jiangsu (Pa-JS1), Baoding, Hebei (Pa-HE1), and Fuyang, Anhui (Pa-AH1), and confirmed by morphological identification and ITS sequence alignment; 9 strains of control fungi include Phomopsis vexans, Diaporthe eres, Fusarium oxysporum, Puccinia asparagi, Colletotrichum gloeosporioides, Rhizoctonia solani, Aspergillus niger, Penicillium italicum, and Trichoderma viride, which are provided by the Culture Collection of Plant Protection Institute, Chinese Academy of Agricultural Sciences. The main reagents include the above-mentioned LAMP primer set, Bst 3.0 DNA polymerase 8U per microliter, SYBR Green I fluorescent dye 1000-fold dilution, plant genomic DNA extraction kit, and instruments including constant temperature water bath, real-time fluorescent quantitative PCR instrument, high-speed centrifuge, and gel imaging system.

[0022] Specifically, the test method includes three parts of strain DNA extraction, LAMP reaction system and condition setting, and result determination. The strain DNA extraction process is as follows: about 0.1 gram of activated mycelium of each strain is taken, and the cell wall is broken by liquid nitrogen freezing grinding method. A small amount of sterile quartz sand is added during grinding to improve grinding efficiency. The ground powder is transferred to a centrifuge tube, and the lysis solution in the plant genomic DNA extraction kit is added. After mixing uniformly according to the steps in the kit instructions, water bath heating is performed, then the adsorption column is centrifuged to adsorb the DNA on the column, the adsorption column is washed twice with the washing solution in the kit to remove impurities, and finally the DNA is eluted with elution solution to obtain total DNA. The DNA concentration is measured by NanoDrop 2000 and adjusted to 100 nanograms per microliter, and the purity is measured to ensure that the OD 260 / OD 280 ratio is between 1.8 and 2.0. The treated DNA is stored at minus 20 degrees Celsius for standby use.

[0023] The LAMP reaction system and conditions are set as follows: 25 microliters of reaction system is prepared, which contains 2.5 microliters of 10x ThermoPol buffer, 4 microliters of 10 mM each dNTP mixture, 1 microliter of 8 U Bst 3.0 DNA polymerase, 1 microliter of SYBR Green I dye, 2 microliters of DNA template, and the remaining volume is supplemented with sterile deionized water. The negative control is set by replacing the template with sterile deionized water, and the positive control uses the DNA of the Phoma asparogii Pa-SD1 strain. The reaction tube is placed in a 63-degree constant temperature water bath for amplification for 40 minutes, and the result is determined after amplification.

[0024] The result determination is carried out by combining fluorescence visual method, real-time fluorescence method and agarose electrophoresis method. In the fluorescence visual method, the solution in the reaction tube is green for positive and orange for negative. In the real-time fluorescence method, the PevD1 target is detected by FAM fluorescence labeling, and the ITS2 target is detected by HEX fluorescence labeling. Both targets appear S-shaped curve and the Ct value is less than or equal to 35 for positive. In the agarose electrophoresis method, 5 microliters of amplification product is taken for 1.5% agarose gel electrophoresis, and the ladder-shaped band appears for positive. Only when all three methods are determined to be positive, the comprehensive determination is positive. If any method is determined to be negative, the comprehensive determination is negative.

[0025] The specificity verification results of the LAMP detection primer group of Phoma asparogii are shown in Table 1. As shown in Table 1, the PevD1 target and the ITS2 target of the 6 strains of Phoma asparogii are all amplified positively, the fluorescence visual is green, the real-time fluorescence appears S-shaped curve and the Ct value meets the requirements, and the electrophoresis appears ladder-shaped band, and the comprehensive determination is positive. The two targets of the 9 strains of control strains and the negative control are not amplified, the fluorescence visual is orange, the real-time fluorescence has no curve, and the electrophoresis has no band, and the comprehensive determination is negative, without cross reaction.

[0026] Table 1: Specificity verification results of LAMP primer group of Phoma asparogii The results of this example show that the double-target LAMP primer group only produces specific amplification for Phoma asparogii, and has no cross reaction with related fungi, other asparagus pathogenic fungi and common soil fungi, with excellent specificity. This result benefits from the synergistic design of double targets. The PevD1 gene is a pathogenic related gene specific to Phoma asparogii, with low homology with other fungi. Although the ITS2 region is a conservative region, the specific design of the primer enhances the binding specificity with the target sequence, effectively avoiding non-specific amplification of related bacteria.

[0027] Example 2 Verification of sensitivity of LAMP detection method for Phoma asparagi The purpose of the test of this example is to determine the minimum detection limit of the LAMP detection method for Phoma asparagi and verify its detection capability in low concentration pathogen samples.

[0028] The test materials used in this example include template DNA, main reagents and instruments. The template DNA is selected from the DNA of Phoma asparagi Pa-SD1 strain, the concentration of which is 100 ng / μL, and the OD 260 / OD 280 The ratio is 1.92, and 8 concentration gradients are obtained by 10-fold gradient dilution with sterile deionized water, which are 100 ng / μL, 10 ng / μL, 1 ng / μL, 100 pg / μL, 10 pg / μL, 1 pg / μL, 100 fg / μL, and 10 fg / μL, respectively. Each concentration gradient is set with 3 repeats. The main reagents and instruments are the same as in Example 1, and the LAMP reaction system and amplification conditions are also consistent with those in Example 1.

[0029] The test method is operated according to the LAMP reaction system and conditions of Example 1, and the DNA of 8 concentration gradients is used as the template for amplification, and a negative control is set with sterile water instead of the template. After amplification, the Ct value is recorded by fluorescence visual method and real-time fluorescence method, and the result is determined by agarose electrophoresis method, and the lowest concentration that can be stably amplified by 3 repeats is taken as the sensitivity of the method.

[0030] The results of the sensitivity verification of the LAMP detection method for Phoma asparagi are shown in Table 2. As shown in Table 2, when the DNA concentration is greater than or equal to 100 fg / μL, the PevD1 target and the ITS2 target of the three repeats are all amplified positively, the fluorescence visual is green, the real-time fluorescence Ct value is between 22.3 and 34.8, and the electrophoresis appears clear ladder-like bands; when the DNA concentration is 10 fg / μL, only one of the 3 repeats is amplified positively, and the Ct value is greater than 35, which is 36.2, and it is determined as unstable amplification; the negative control has no amplification. Therefore, the minimum detection limit of the LAMP detection method is 100 fg / μL.

[0031] Table 2: Sensitivity verification results of LAMP detection method for Phoma asparagi The results of this embodiment show that the minimum detection limit of the LAMP detection method is 100 picograms per microliter, and the sensitivity is high. This advantage comes from two aspects. First, the double target point cooperative amplification enhances the signal strength, and even low concentration templates can produce detectable amplification products. Second, the design of the loop primer improves the binding efficiency of the primer and the target sequence, shortens the amplification time, and reduces the amplification threshold of low concentration templates, which can meet the detection needs of low concentration pathogen samples such as seed infection and early disease plants.

[0032] Example 3 Actual sample detection of Phoma asparagi LAMP detection method The purpose of this example is to verify the practical application effect of the LAMP detection method of the application in the whole industry chain samples of asparagus, and to evaluate the accuracy, sensitivity and specificity of the method by comparison with the traditional tissue separation method, to ensure that it meets the needs of the basic detection scene.

[0033] The test materials used in this example include actual samples, main reagents and instruments. The actual samples were collected from Shandong Weifang, Henan Kaifeng and Yunnan Kunming from March to May 2024, a total of 100, including 30 asparagus stem samples, 15 of which were diseased stems showing brown fusiform lesions and 15 were healthy stems, 20 asparagus leaf samples, 10 of which were diseased leaves showing brown irregular lesions and 10 were healthy leaves, 30 asparagus seed samples, 15 of which were infected seeds inoculated with Phoma asparagi and 15 were sterile seeds, and 20 asparagus rhizosphere soil samples, 10 of which were diseased field soil and 10 were healthy field soil. In addition to the reagents used in Example 1, the main reagents also include PDA medium used in traditional tissue separation method, the formula of which is potato 200 grams, glucose 20 grams, agar 15 grams, water 1000 milliliters; the instruments are the same as in Example 1.

[0034] The test method includes four parts of sample DNA extraction, LAMP detection, traditional tissue separation method control and performance index calculation. The sample DNA extraction is carried out as follows: for asparagus stem or leaf samples, 0.2 grams of tissue at the junction of disease and health is taken, ground and added to 2% CTAB lysis solution, incubated at room temperature for 8 minutes, centrifuged at 8000 revolutions per minute for 5 minutes, and the supernatant is the DNA template; for asparagus seed samples, 100 seeds are surface sterilized, first soaked in 75% ethanol for 30 seconds, then washed with sterile water for 3 times, sterilized and ground, and the DNA is extracted using a plant genomic DNA extraction kit; for asparagus rhizosphere soil samples, 10 grams of soil is weighed, and the soil DNA extraction kit containing humic acid removal column is used to extract DNA, and the operation is carried out according to the corresponding kit instruction.

[0035] The LAMP detection was performed according to the reaction system and conditions of Example 1, and the fluorescence visual method was used for preliminary judgment. For the suspected samples with fluorescence color between green and orange, the real-time fluorescence method was used for verification.

[0036] As a control, the traditional tissue separation method was used, and the specific operation was as follows: for asparagus stem or leaf samples, 0.5 cm of tissue at the healthy and diseased junction was taken, surface sterilized, first immersed in 75% ethanol for 30 seconds, then immersed in 0.1% mercury solution for 1 minute, and finally washed with sterile water for 3 times. The sterilized tissue was inoculated into PDA medium and cultured at 25 degrees Celsius for 5 days. The colony morphology was observed to see whether black conidiophores appeared, and the conidial morphology was observed under a microscope to confirm whether it was asparagus stem blight fungus. For asparagus seed samples, 100 seeds were surface sterilized and inoculated into PDA medium, and cultured at 25 degrees Celsius for 7 days. The number of seeds with bacteria was counted. For asparagus rhizosphere soil samples, the dilution plate method was used. 10 grams of soil was diluted to 10⁻³ concentration, and 100 microliters of the diluted solution was spread on PDA medium. The medium was incubated at 25 degrees Celsius for 7 days, and the number of asparagus stem blight fungus colonies was counted.

[0037] The performance index calculation was based on the detection results of the two methods. The accuracy was equal to the sum of true positive number and true negative number divided by the total sample number multiplied by 100%. The sensitivity was equal to the true positive number divided by the sum of true positive number and false negative number multiplied by 100%. The specificity was equal to the true negative number divided by the sum of true negative number and false positive number multiplied by 100%.

[0038] The actual sample detection results of the asparagus stem blight fungus LAMP detection method are shown in Table 3. According to Table 3, among the 100 actual samples, the traditional tissue separation method detected 48 positive samples and 52 negative samples. The LAMP method detected 47 positive samples and 53 negative samples, of which 47 were true positives, 52 were true negatives, 1 was false negative (soil sample), and 0 was false positive. Calculation showed that the accuracy of this method was 99.0% (99 divided by 100 multiplied by 100%), the sensitivity was 97.9% (47 divided by 48 multiplied by 100%), and the specificity was 100% (52 divided by 52 multiplied by 100%).

[0039] Table 3: Actual sample detection results of asparagus stem blight fungus LAMP detection method The results of the present embodiment show that the LAMP detection method has excellent detection performance on actual samples, high accuracy, sensitivity and specificity, and only one soil sample shows false negative, which is speculated to be caused by the extremely low content of pathogenic bacteria in the soil sample, less than 100 CFU per gram, and the residual amount of humic acid inhibitor in the soil affects the LAMP amplification. Overall, the method can effectively detect P. asparagi in asparagus stem, leaf, seed, rhizosphere soil, and the operation is simple without complex purification steps, and the results can be obtained in 30 to 40 minutes, which is suitable for on-site detection of primary agricultural technology stations and asparagus planting bases, and can cover the disease control needs of the whole industry chain of asparagus seed quarantine, field monitoring and soil early warning.

[0040] SEQUENCE SEQ ID NO. 1: GCAACGGTGCTGCTGCTG-+C+T+GGTGGTGGTGGTGGTGGT SEQ ID NO. 2: CGGTGGTGGTGGTGGTGGT-+A+G+CGACGACGACGACGAC SEQ ID NO. 3: GCTGCTGCTGCTGCTGCTG SEQ ID NO. 4: CGACGACGACGACGACGAC SEQ ID NO. 5: +T+G+CTGCTGCTGCTGCTGCTGCT SEQ ID NO. 6: TCGGAGGGCGTGTGCTGAC-+G+A+TCGATCGATCGATCGATC SEQ ID NO. 7: ACGAGCCGAGTGATCCACCG-+C+T+GAGAGAGAGAGAGAGAGA SEQ ID NO. 8: GCGGTAATCCTGCCCTGAG SEQ ID NO. 9: CCGCTTATTGATATGCTTAAGT SEQ ID NO. 10: +A+C+GAGAGAGAGAGAGAGAGAG While embodiments of the application have been shown and described, it is to be understood that the embodiments described are merely exemplary of the principles and application of the present application. Numerous modifications and adaptions can be effected without departing from the spirit and scope of the present application, which is not limited to the exact construction and arrangement described. It is intended, therefore, to cover all modifications and adaptions that fall within the scope of the claims and their equivalents.

Claims

1. A LAMP detection primer set for Phoma asparagi, comprising an inner primer, an outer primer and a loop primer, characterized in that: The sequence of the inner primer comprises SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 6 and SEQ ID NO. 7, the sequence of the outer primer comprises SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 8 and SEQ ID NO. 9, and the sequence of the loop primer comprises SEQ ID NO. 5 and SEQ ID NO.

10.

2. A detection method of a primer set for LAMP detection of Phoma asparagi, characterized by: The LAMP detection primer group for the Phoma asparagi in claim 1 comprises the following steps: Step one: extracting DNA of the sample to be detected as a template; Step two: using the primer group and the template to prepare a LAMP reaction system; Step three: carrying out isothermal amplification of the reaction system at 60-65 DEG C to obtain an amplification product; Step four: detecting and determining the amplification product, and determining that the sample to be detected contains the Phoma asparagi when the PevD1 gene and the ITS2 region in the template are both positive.

3. The method according to claim 2, wherein the method is characterized by: In step one, the sample to be detected comprises one of the stems, leaves, seeds or rhizosphere soil of asparagus, and the DNA extraction method comprises the following steps: When the stems or leaves are used as the sample to be detected, the sample to be detected is ground and then added to 2% CTAB lysis solution for incubation at room temperature for 8 minutes, and the supernatant is taken after centrifugation as the DNA template; When the seeds are used as the sample to be detected, the sample to be detected is ground after surface sterilization, and a plant genomic DNA extraction kit is used to extract DNA; When the rhizosphere soil is used as the sample to be detected, a soil DNA extraction kit containing a humic acid removal column is used to extract DNA.

4. The method according to claim 2, wherein the method is characterized by: In step two, the total volume of the LAMP reaction system is 25 μL, which comprises 10 x ThermoPol buffer 2.5 μL, dNTP mixture 4 μL, Bst DNA polymerase 1 μL, fluorescent dye 1 μL, DNA template 2 μL, inner primer, outer primer and loop primer, and sterile deionized water is added to 25 μL.

5. The method according to claim 4, wherein the method is characterized by: The final concentration of the inner primer in the reaction system is 400 nM, the final concentration of the outer primer in the reaction system is 100 nM, and the final concentration of the loop primer in the reaction system is 300 nM.

6. The detection method of the LAMP primer set for asparagus stem blight pathogen according to claim 4, characterized in that: The concentration of each dNTP in the dNTP mixture is 10 mM, the Bst DNA polymerase is Bst 3.0 DNA polymerase and the amount used is 8 U, and the fluorescent dye is SYBR Green I and the concentration used is 1000 x dilution.

7. The detection method of the LAMP primer set for asparagus stem blight pathogen according to claim 2, characterized in that: In step three, the time of isothermal amplification is 35-45 minutes.

8. The detection method of the LAMP primer set for asparagus stem blight pathogen according to claim 2, characterized in that: In step four, the detection and determination method is one or more of fluorescence visual method, real-time fluorescence method or agarose electrophoresis method.

Images