Novel soybean downy mildew resistance molecule detection method

Abstract

The invention discloses a novel soybean downy mildew resistance molecule detection method. The invention provides a method for predicting soybean downy mildew resistance, which comprises the following steps: 1) acquiring the expression quantity ratio of Pm18s gene to GmActin gene in inoculated leaves of to-be-detected soybean inoculated with downy mildew, and recording the expression quantity ratio as Pm18s / GmActin ratio as sample data; and 2) predicting the downy mildew resistance of the soybean to be detected according to the sample data. The method comprises the following steps of: inoculating downy mildew bacteria on the back of a main leaf by using a smearing method by taking a soybean of which the first main leaf is completely expanded as a material, extracting RNA (Ribonucleic Acid) 8 days after inoculation, measuring the ratio of a downy mildew bacteria Pm18s gene / soybean Actin by semi-quantitative RT-PCR (Reverse Transcription-Polymerase Chain Reaction), and screening resistant soybeans. The technology not only has the advantages of accurate detection result and no climate influence, but also can greatly shorten the identification period and save land and labor.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a novel molecular detection method for soybean downy mildew resistance. Background Technology

[0002] Soybean downy mildew is a fungal disease caused by an obligate parasite. It is a global disease and one of the major soybean diseases in Northeast my country. When it occurs, it can significantly reduce the quality and yield of soybeans; in severe cases, the yield can decrease by up to 50%. The pathogen of soybean downy mildew is *Peronospora manschurica* (Pm), belonging to the genus *Peronospora* of the order Peronosporales in the class Oomycetes of the phylum Oomycetes. It is an obligate parasitic fungus.

[0003] Soybean downy mildew fungus overwinters as oospores on seeds and diseased plant debris. The oospores initially infect the hypocotyl of soybean seedlings, gradually spreading to true leaves and axillary buds, forming a systemic infection. Subsequently, numerous sporangia are produced on the leaves of diseased seedlings, spread by wind and rain to healthy leaves. The sporangia germinate into germ tubes, which invade cells through hydathodes and stomata, forming haustoria, appressoria, and prickles. The infection gradually expands at the site of invasion, causing the leaves to turn pale yellow and form bright yellow spots. Studies have found that the germination of sporangia, formation of germ tubes, and development of haustoria, appressoria, and prickles of soybean downy mildew fungus are all completed within 36 hours. This process is consistent in both resistant and susceptible soybean downy mildew-affected materials. However, in the subsequent stages, the fungal growth process differs significantly between resistant and susceptible varieties. In susceptible varieties, soybean downy mildew mycelia spread within the leaves at a rate of 59 pm / h, forming haustoria at a density of approximately 57 haustoria / mm. The mycelia enter a rapid growth phase from 36 hours post-infection, slowing down after 120 hours, and lesions begin to appear on the leaves after 144 hours. In resistant varieties, soybean downy mildew mycelia still grow very slowly after 36 hours, with few haustoria forming, and no or only a few lesions appear on the leaves after 144 hours. The study found a negative correlation between the number of haustoria and lesions on different soybean materials and their resistance to soybean downy mildew; that is, downy mildew-resistant varieties form fewer haustoria and lesions, resulting in milder disease; while susceptible varieties form more haustoria and lesions, leading to more severe disease. Summary of the Invention

[0004] The technical problem solved by this invention is how to overcome the shortcomings of existing methods for identifying soybean downy mildew resistance, such as susceptibility to environmental and climatic influences, reliance on operator experience, and the need for repeated identification at multiple locations over many years, which affect the identification of soybean downy mildew resistance.

[0005] To address the aforementioned technical problems, the first aspect of this invention provides a method for predicting resistance to soybean downy mildew, comprising the following steps:

[0006] 1) Obtain the expression ratio of Pm18s gene and GmActin gene in the inoculated leaves of soybeans after inoculation with downy mildew, and record it as the Pm18s / GmActin ratio as the sample data;

[0007] 2) Predict the downy mildew resistance of the soybean to be tested based on the sample data.

[0008] In the method described above, the soybeans to be tested after inoculation with downy mildew are defined as soybeans 8 days after inoculation, with the day of inoculation being recorded as day 0.

[0009] In the method described above, the inoculation with downy mildew is performed when the first pair of true leaves of the soybean to be tested are fully expanded.

[0010] In the method described above, the ratio of the expression levels of the Pm18s gene and the GmActin gene in the inoculated leaves of the soybean to be tested after inoculation with downy mildew is obtained by semi-quantitative PCR of the inoculated leaves of the soybean to be tested after inoculation with downy mildew.

[0011] In the method described above, the step of predicting the downy mildew resistance of the soybean to be tested based on sample data is any one of the following:

[0012] 1) Soybeans with a smaller Pm18s / GmActin ratio showed higher downy mildew resistance than soybeans with a larger Pm18s / GmActin ratio.

[0013] 2) When Pm18s / GmActin<1, the downy mildew resistance of the soybean being tested is highly resistant; when 1≤Pm18s / GmActin<2, the downy mildew resistance of the soybean material is resistant; when 2≤Pm18s / GmActin<4, the downy mildew resistance of the soybean being tested is moderately resistant; when 4≤Pm18s / GmActin<6, the downy mildew resistance of the soybean being tested is susceptible; when Pm18s / GmActin≥6, the downy mildew resistance of the soybean being tested is highly susceptible.

[0014] In a second aspect, the present invention provides a method for breeding soybeans with high resistance to downy mildew, comprising the following steps: selecting soybeans with a small Pm18s / GmActin ratio in the first aspect;

[0015] Alternatively, select soybeans with Pm18s / GmActin < 1 in the first aspect;

[0016] Or select soybeans that meet the criteria of 1≤Pm18s / GmActin<2 in the first aspect;

[0017] Alternatively, select soybeans that meet the criteria of 2≤Pm18s / GmActin<4 in the first aspect.

[0018] Thirdly, the present invention provides a method for breeding soybeans with high resistance to downy mildew, comprising the following steps: selecting soybeans with a small Pm18s / GmActin ratio in the first aspect;

[0019] Alternatively, select soybeans with Pm18s / GmActin < 1 in the first aspect;

[0020] Or select soybeans that meet the criteria of 1≤Pm18s / GmActin<2 in the first aspect;

[0021] Alternatively, select soybeans that meet the criteria of 2≤Pm18s / GmActin<4 in the first aspect.

[0022] Fourthly, the present invention provides an apparatus for predicting the downy mildew resistance of the soybean to be tested, the apparatus comprising:

[0023] S1, Data receiving module: used to receive sample data, which is the expression ratio of Pm18s gene and GmActin gene in soybean leaves after inoculation with downy mildew, denoted as Pm18s / GmActin ratio.

[0024] S2, Data Output Module: Predicts the downy mildew resistance of the soybean to be tested using the sample data.

[0025] In the device described above, the soybeans to be tested after inoculation with downy mildew are soybeans to be tested 8 days after inoculation with downy mildew, with the day of inoculation being recorded as day 0.

[0026] Or / and, the inoculation of downy mildew is carried out when the first pair of true leaves of the soybean to be tested are fully expanded.

[0027] In the apparatus described above, the ratio of the expression levels of the Pm18s gene and the GmActin gene in the inoculated leaves of the soybean to be tested after inoculation with downy mildew is obtained by semi-quantitative PCR of the inoculated leaves of the soybean to be tested after inoculation with downy mildew.

[0028] The semi-quantitative PCR described above includes the following steps:

[0029] 1) Extract cDNA from the inoculated leaves of the soybeans to be tested after inoculation with downy mildew;

[0030] 2) Using cDNA as a template, semi-quantitative PCR amplification was performed using the Pm18s gene primer pair and the GmActin gene primer pair to obtain the Pm18s gene amplification product and the GmActin gene amplification product.

[0031] 3) Electrophoresis was used to detect the Pm18s gene amplification products and GmActin gene amplification products. Image scanning was performed using Image J1.53k software to obtain the band brightness values ​​of the Pm18s gene amplification products and GmActin gene amplification products. The brightness values ​​of Pm18s and GmActin genes were used as the ratio of Pm18s and GmActin expression levels, denoted as the Pm18s / GmActin ratio.

[0032] The primer pair for the Pm18s gene is as follows: Pm18s - F: GCATATTGCACTTCCGGGTT and Pm18s - R: AGGACTCACAGCCGATCAAA;

[0033] The primer pairs for the GmActin gene are as follows: GmActin / F: GCGTGATCTCACTGATGCC and GmActin / R: TCGCAATCCACATCTGTTGG.

[0034] The prediction of the downy mildew resistance of the soybean to be tested based on the sample data is any one of the following:

[0035] 1) Soybeans with a smaller Pm18s / GmActin ratio showed higher downy mildew resistance than soybeans with a larger Pm18s / GmActin ratio.

[0036] 2) When Pm18s / GmActin<1, the downy mildew resistance of the soybean being tested is highly resistant; when 1≤Pm18s / GmActin<2, the downy mildew resistance of the soybean material is resistant; when 2≤Pm18s / GmActin<4, the downy mildew resistance of the soybean being tested is moderately resistant; when 4≤Pm18s / GmActin<6, the downy mildew resistance of the soybean being tested is susceptible; when Pm18s / GmActin≥6, the downy mildew resistance of the soybean being tested is highly susceptible.

[0037] In the above text, the device is a computer processing device.

[0038] The methods described above focus solely on data. All of these methods can be information processing methods in which all steps are performed by a data processing device such as a computer.

[0039] This invention, by detecting the relative expression levels of the downy mildew internal reference gene Pm18S and the soybean GmActin gene in leaves of different soybean downy mildew-resistant and susceptible materials at different days after inoculation, found that the Pm18S / GmActin ratio is negatively correlated with soybean downy mildew resistance; that is, the higher the Pm18S / GmActin ratio, the more susceptible the soybean material is to downy mildew, and vice versa. Therefore, this invention establishes a new method for rapidly and accurately identifying soybean downy mildew resistance in the early stages of infection.

[0040] Experiments of this invention demonstrate that, using soybeans with fully expanded first true leaves as material, downy mildew is inoculated onto the underside of the true leaves using a smear method. Eight days after inoculation, RNA is extracted, and the ratio of the downy mildew Pm18s gene to soybean Actin is determined by semi-quantitative RT-PCR to screen for resistant soybeans. This technology not only offers advantages such as accurate detection results and independence from climate influences, but also significantly shortens the identification cycle and saves land and labor. Attached Figure Description

[0041] Figure 1 The relative expression levels of Pm18s and GmActin genes at different time points after inoculation of Jilin Xiaoli 1 and Heinong 10 with downy mildew were determined.

[0042] Figure 2 Correlation analysis of the Pm18s / GmActin ratio with soybean downy mildew resistance. Detailed Implementation

[0043] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0045] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0046] Plant total RNA extraction kit: FastPure Universal Plant Total RNA Isolation Kit, Nanjing Novizan Biotechnology Co., Ltd. (Vazyme), product code: RC411-01; Reverse transcription kit: HiScript III 1st Strand cDNA Synthesis Kit, Nanjing Novizan Biotechnology Co., Ltd. (Vazyme), product code: R312-02; 2×Rapid Tap Master Mix, Nanjing Novizan Biotechnology Co., Ltd. (Vazyme), product code: R222-03. Other experimental reagents and consumables, such as agarose, nucleic acid dyes, RNase-free centrifuge tubes, etc., were purchased from Bioman (Beijing) Technology Co., Ltd.

[0047] Example 1: Condition exploration for detecting downy mildew resistance using the Pm18s / GmActin ratio

[0048] 1. Inoculation with downy mildew

[0049] Jilin Xiaoli 1 (HR), a highly resistant material to downy mildew, and Heinong 10 (HS), a highly susceptible material, were sown in nutrient pots (33 pots for each material), with 12 healthy seedlings retained in each pot. The plants were then placed in a greenhouse for cultivation (16 hours of light / 8 hours of darkness, 18–23°C).

[0050] When the first pair of true leaves of the resistant materials were fully expanded, they were inoculated with downy mildew fungus (Peronospora manschurica, Pm., described in the following literature: Genetic analysis of resistance to soybean downy mildew (Peronospora manschurica), Soybean Science, 1992: 11(1): 31-35). The inoculation method was as follows: Soybean leaves with typical soybean downy mildew symptoms were collected, rinsed with tap water, and then disinfected with 75% alcohol for 0.5 min. The leaves were kept moist at 18-20℃ for about 15 h until downy mildew sporangia were produced. The sporangia were then rinsed with sterile water and collected, and prepared into 1.4×10 6 Sporangium suspension per mL was prepared by applying the suspension evenly to the underside of the first pair of true leaves of the resistant material using a cotton swab. The entire leaf was treated once, without repeated application. Immediately after inoculation, the plants were covered with a plastic bag and placed in an artificial climate chamber (18-23℃, 100% humidity). The day of application was recorded as day 0 of inoculation.

[0051] 2. Detection of the Pm18s / GmActin ratio

[0052] Primers were designed based on the Pm18s (DQ202400.1) sequence published in Genebank for the downy mildew pathogen: Pm18s / F: GCATATTGCACTTCCGGGTT (sequence 1) and Pm18s / R: AGGACTCACAGCCGATCAAA (sequence 2); primers were designed based on the soybean GmActin (XM_009530461) sequence: GmActin / F: GCGTGATCTCACTGATGCC (sequence 3) and GmActin / R: TCGCAATCCACATCTGTTGG (sequence 4).

[0053] 1) Extracting cDNA

[0054] After inoculation with downy mildew, soybean leaves from resistant and susceptible materials were collected at 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 days post-inoculation. Two holes were punched in the middle of each inoculated leaf for sampling. To minimize experimental error, 12 plants from the same soybean material were pooled as one biological replicate, with three replicates per material. Total RNA was extracted according to the instructions of the FastPure Universal Plant Total RNA Isolation Kit (Vazyme). The RNA was reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (Vazyme), yielding cDNA from downy mildew-inoculated Jilin Xiaoli 1 and downy mildew-inoculated Heinong 10.

[0055] 2) Semi-quantitative PCR amplification

[0056] Using the cDNA extracted from the various materials above as templates, semi-quantitative PCR amplification of the Pm18s and GmActin genes was performed using 2×Rapid Taq Master Mix (Vazyme) with Pm18s / F and Pm18s / R, GmActin / F and GmActin / R as primers.

[0057] The PCR reaction system is shown in Table 1 below:

[0058] Table 1 shows the PCR reaction system.

[0059]

[0060]

[0061] The PCR reaction conditions were: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 10 sec, 56℃ annealing for 15 sec, 72℃ extension for 15 sec, 28 cycles, and a final extension at 72℃ for 5 min.

[0062] PCR products were subjected to 1.0% agarose gel electrophoresis. Due to the different relative expression levels of each gene, the bands of each gene appeared at different brightness levels in the gel electrophoresis image. Image J 1.53k software was used to scan the image and obtain the brightness value of each gene band. This brightness value is directly proportional to the expression level of the gene. The ratio of the brightness values ​​of the Pm18s and GmActin genes is the ratio of the relative expression levels of Pm18s / GmActin, denoted as the Pm18s / GmActin ratio.

[0063] The ratio of Pm18s / GmActin in resistant and susceptible materials was obtained at different time points after inoculation with downy mildew (leaves at different times after inoculation).

[0064] The results are shown in Table 2, with each material having three biological replicates.

[0065] Table 2 shows the RT-PCR detection of Pm18s / GmActin at different time points after Pm inoculation.

[0066]

[0067] In the table above, dpi in column 1 represents the number of days after infection; columns 2 and 3 represent the Pm18s / GmActin ratios of Heinong 10 (HS) and Jilin Xiaoli 1 (HR), respectively; column 4 shows the difference between susceptibility and resistance (multiples), which is the multiple obtained by dividing the Pm18s / GmActin ratio of the susceptible material in column 2 by the Pm18s / GmActin ratio of the resistant material in column 3.

[0068] The results are as follows Figure 1As shown, the GmActin gene was normally amplified at all time points in Jilin Xiaoli 1 and Heinong 10. The Pm18s gene was not detected in the highly resistant and highly susceptible soybean materials 3 days before downy mildew inoculation, indicating that downy mildew had not yet proliferated extensively in the plants at this stage, and the internal reference gene of the downy mildew fungus was not detected. From 4 days after inoculation, the expression of the Pm18s gene was detected in both Jilin Xiaoli 1 and Heinong 10, and the expression level gradually increased with time. There were significant differences in the Pm18s / GmActin values ​​between downy mildew-resistant and susceptible varieties, with the Pm18s / GmActin values ​​in susceptible varieties being 2.21–15.50 times higher than those in resistant varieties. Taking 4 dpi, 6 dpi, and 8 dpi as examples, the Pm18s / GmActin values ​​for susceptible varieties were 0.31±0.14, 6.30±3.92, and 10.81±7.16, respectively, while those for resistant varieties were 0.02±0.04, 0.58±0.42, and 0.81±0.30, respectively. The Pm18s / GmActin values ​​for susceptible varieties were 15.5 times, 10.86 times, and 13.35 times higher than those for resistant varieties. Soybeans with a lower Pm18s / GmActin ratio showed greater resistance to downy mildew than soybeans with a higher Pm18s / GmActin ratio.

[0069] Four days after inoculation, the relative expression level of Pm18s / GmActin in the susceptible material Heinong 10 was 15.50 times that in the resistant material Jilin Xiaoli 1, which showed a greater difference than that in the resistant material on day 8. However, the relative expression level of Pm18s / GmActin in the resistant material on day 4 was very low, only 0.31 and 0.02, making it difficult to detect. On day 8, the resistant material showed a significant difference in the relative expression level of Pm18s / GmActin, with the susceptible material Heinong 10 showing 13.35 times higher than the resistant material Jilin Xiaoli 1, and the relative expression levels were also higher, at 0.81 and 10.81 respectively. Therefore, day 8 after inoculation was chosen as the detection time point.

[0070] Example 2: Application of Pm18s / GmActin ratio in detecting downy mildew resistance

[0071] I. Field resistance identification of different soybean varieties to downy mildew (SMD inoculation resistance identification)

[0072] Downy mildew inoculation identification was performed on 25 soybean materials: Shanning 16, Jidou 12, Mengdou 26, Guanyun Fenqingdou, Daqingdou, Huaidou 10, Bainong 7, Donghai Shihou Liuyuezao, Yyukimusume, M85-610W, Fengshou 26, Chengnan Huangdou, Dunbar, LN92-7369, ASTRA, ДВ2834, N38, WDD00852, Duludou, BYSTRITCA 2, Huangchao, Qinghuangdou, Haodou 2000, Tie 79163-5, and Putou 506. The details are as follows:

[0073] The seeds of the 25 soybean materials were sown in square flowerpots with sides of 20 cm and cultured at 16 h light / 8 h dark and 18–23 °C. Three pots were sown for each material, weak seedlings were removed, and 12 healthy seedlings were retained in each pot for downy mildew identification.

[0074] After the first pair of true leaves of the soybean material have fully unfolded, inoculate with downy mildew fungus according to method 1 in Example 1. Record the day of application as day 0 of inoculation.

[0075] A survey was conducted 15 days after inoculation when soybean disease was prevalent. All inoculated leaves of each plant were examined based on lesion reaction type and lesion number. Disease resistance was evaluated using a 6-level grading system. The grading standards and resistance levels were based on Part 3 of the "Technical Specifications for Identification of Soybean Disease and Insect Resistance" (NY / T 3114) promulgated and implemented by the Ministry of Agriculture of the People's Republic of China on January 1, 2018: Technical Specifications for Identification of Soybean Downy Mildew Resistance, as detailed in Tables 3 and 4. Disease severity scores were converted to a Disease Indication (DI) using the following formula: DI = ([0×n0 + 1×n1 + 3×n3 + 5×n5 + 7×n5 + 9×n9] / (9×N)) × 100, where ni (i = 0 to 9) represents the number of plants corresponding to disease severity scores from 0 to 9, and N is the total number of plants evaluated. The resistance level of soybean germplasm resources was determined based on the maximum DI value from three biological replicates.

[0076] Table 3 shows the grading standards for soybean downy mildew.

[0077]

[0078] Table 4 shows the classification of resistance levels.

[0079] Disease Index (DI) Resistance evaluation 0 immunity DI≤20 Highly resistant (HR) 20<DI≤40 Resistant® 40<DI≤60 Moderately resistant(MR) 60<DI≤80 Susceptible (S) 80<DI≤100 Highly susceptible (HS)

[0080] Disease index (DI) of 25 soybean materials was obtained through investigation and calculation. The resistance level of soybean germplasm resources was determined based on the maximum DI value of three biological replicates. The specific results are shown in Table 5.

[0081] Table 5 shows the inoculation and identification results of 25 soybean materials against downy mildew.

[0082]

[0083]

[0084] As shown in the table above, among the 25 materials, the highly resistant (HR) varieties are: Guanyun Fenqingdou, Yyukimusume, Shanning 16, M85-610W, and Chengnanhuangdou; the resistant (R) varieties are: Jidou 12, Huaidou 10, LN92-7369, Dunbar, and Bainong 7; the moderately resistant (MR) varieties are: Liuyuezao, ASTRA, Qinghuangdou, Donghai Shihu Daqingdou, and Huangchao; the susceptible (S) varieties are: Haodou 2000, ДВ2834, WDD00852, N38, and Tie 79163-5; and the highly susceptible (HS) varieties are: Mengdou 26, Duludou, Fengshou 26, Pudou 506, and BYSTRITCA 2.

[0085] II. Detection of downy mildew resistance using the Pm18s / GmActin ratio

[0086] After the first pair of true leaves of the soybean materials had fully unfolded, the above 25 materials were inoculated with downy mildew fungus according to the method in Example 1.1. The day of application was recorded as day 0 of inoculation.

[0087] The detection was performed according to the method in Example 1, paragraph 2: Leaves inoculated with downy mildew for 8 days after inoculation were collected, and total leaf RNA was extracted using the FastPure Universal Plant Total RNA Isolation Kit (Novizan). The RNA was then reverse transcribed into cDNA using the HiScript III 1st Strand cDNA Synthesis Kit (Novizan). Semi-quantitative RT-PCR was used to detect the transcriptional expression of Pm18s and GmActin in 25 soybean materials (three biological replicates per material), and the Pm18s / GmActin ratio was analyzed.

[0088] The results are shown in Table 6. It can be seen that at 8 dpi, the Pm18s / GmActin value of the HS group is 53.07 times that of the HR group.

[0089] Table 6 shows the Pm18s / GmActin ratio and resistance of 25 soybean materials.

[0090]

[0091]

[0092] The above results indicate that the Pm18s / GmActin ratio at 8 dpi after soybean inoculation is closely related to downy mildew resistance in soybeans. Therefore, downy mildew resistance in soybeans can be distinguished based on the Pm18s / GmActin ratio. The resistance classification criteria are as follows: when Pm18s / GmActin < 1, the downy mildew resistance of soybean materials is HR; when 1 ≤ Pm18s / GmActin < 2, the downy mildew resistance of soybean materials is R; when 2 ≤ Pm18s / GmActin < 4, the downy mildew resistance of soybean materials is MR; when 4 ≤ Pm18s / GmActin < 6, the downy mildew resistance of soybean materials is S; and when Pm18s / GmActin ≥ 6, the downy mildew resistance of soybean materials is HS. Based on the above criteria, the resistance of 25 soybean materials was graded, and the specific resistance results are shown in Table 5. The results show that the Pm18s / GmActin ratio can effectively distinguish downy mildew resistance in soybean materials.

[0093] Correlation coefficient analysis was performed on the results of two sets of identification methods: one using downy mildew inoculation and the other using Pm18s / GmActin. The correlation coefficient between the two sets of results was: R 2 =0.9111 (see) Figure 2 This demonstrates that using the Pm18s / GmActin ratio to detect soybean downy mildew resistance is highly accurate and can be used for this purpose. The soybean resistance identified by the Pm18s / GmActin ratio is consistent with the resistance identified through SMD inoculation. This proves the accuracy of the method of this invention.

[0094] Therefore, a method for detecting resistance to downy mildew can be established using the Pm18s / GmActin ratio, with the following steps:

[0095] 1. Downy mildew inoculation

[0096] 1.4 × 10⁻⁶ of downy mildew. 6 The sporangium suspension of 1 sporangium / mL was evenly spread on the back of the first pair of true leaves of the soybean to be tested when the first pair of true leaves were fully expanded; the day of application was recorded as day 0 of inoculation.

[0097] 2. Detection of the Pm18s / GmActin ratio

[0098] 1) Extracting cDNA

[0099] cDNA was extracted from soybean leaves inoculated on day 8 post-inoculation.

[0100] 2) Semi-quantitative PCR amplification

[0101] Using the above cDNA as a template, Pm18s were used respectively. - F and Pm18s -Semi-quantitative PCR amplification of Pm18s and GmActin was performed using R, GmActin / F, and GmActin / R.

[0102] After electrophoresis of the PCR products on a 1.0% agarose gel, the images were scanned using Image J 1.53k software to analyze the Pm18s / GmActin ratio in the leaves 8 days after inoculation.

[0103] The smaller the Pm18s / GmActin ratio, the higher the downy mildew resistance level of soybean materials; the larger the Pm18s / GmActin ratio, the lower the downy mildew resistance level of soybean materials.

[0104] Soybean materials with a smaller Pm18s / GmActin ratio have a higher downy mildew resistance level than soybean materials with a larger Pm18s / GmActin ratio; that is, soybean materials with a smaller Pm18s / GmActin ratio have a higher downy mildew resistance than soybean materials with a larger Pm18s / GmActin ratio.

[0105] Alternatively, the downy mildew resistance of soybean materials is HR when Pm18s / GmActin < 1; R when 1 ≤ Pm18s / GmActin < 2; MR when 2 ≤ Pm18s / GmActin < 4; S when 4 ≤ Pm18s / GmActin < 6; and HS when Pm18s / GmActin ≥ 6.

[0106] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. A method for predicting resistance to soybean downy mildew includes the following steps: 1) Obtain the expression ratio of Pm18s gene and GmActin gene in the inoculated leaves of soybeans after inoculation with downy mildew, and record it as the Pm18s / GmActin ratio as the sample data; 2) Predict the downy mildew resistance of the soybean to be tested based on the sample data.

2. The method according to claim 1, characterized in that: The soybeans to be tested after inoculation with downy mildew are defined as soybeans 8 days after inoculation, with the day of inoculation recorded as day 0.

3. The method according to claim 2, characterized in that: The inoculation with downy mildew was carried out when the first pair of true leaves of the soybean to be tested were fully expanded.

4. The method according to any one of claims 1-3, characterized in that: The ratio of Pm18s gene expression to GmActin gene expression in the inoculated leaves of soybeans after inoculation with downy mildew was obtained by semi-quantitative PCR.

5. The method according to any one of claims 1-4, characterized in that: The prediction of the downy mildew resistance of the soybean to be tested based on the sample data is any one of the following: 1) Soybeans with a smaller Pm18s / GmActin ratio showed higher downy mildew resistance than soybeans with a larger Pm18s / GmActin ratio. 2) When Pm18s / GmActin<1, the downy mildew resistance of the soybean being tested is highly resistant; when 1≤Pm18s / GmActin<2, the downy mildew resistance of the soybean material is resistant; when 2≤Pm18s / GmActin<4, the downy mildew resistance of the soybean being tested is moderately resistant; when 4≤Pm18s / GmActin<6, the downy mildew resistance of the soybean being tested is susceptible; when Pm18s / GmActin≥6, the downy mildew resistance of the soybean being tested is highly susceptible.

6. A method for breeding soybeans with high downy mildew resistance, comprising the following steps: selecting soybeans with a small Pm18s / GmActin ratio as described in claim 5; Or select soybeans to be tested that have Pm18s / GmActin < 1 as described in claim 5; Or select soybeans that meet the criteria of claim 5, where 1 ≤ Pm18s / GmActin < 2; Alternatively, select soybeans that meet the criteria of claim 5, where 2 ≤ Pm18s / GmActin < 4.

7. A method for breeding soybeans with high resistance to downy mildew, comprising the following steps: selecting soybeans to be tested with a small Pm18s / GmActin ratio as described in claim 5; Or select soybeans to be tested that have Pm18s / GmActin < 1 as described in claim 5; Or select soybeans that meet the criteria of claim 5, where 1 ≤ Pm18s / GmActin < 2; Alternatively, select soybeans that meet the criteria of claim 5, where 2 ≤ Pm18s / GmActin < 4.

8. An apparatus for predicting the downy mildew resistance of the soybean to be tested, the apparatus comprising: S1, Data receiving module: used to receive sample data, which is the expression ratio of Pm18s gene and GmActin gene in soybean leaves after inoculation with downy mildew, denoted as Pm18s / GmActin ratio. S2, Data Output Module: Predicts the downy mildew resistance of the soybean to be tested using the sample data.

9. The apparatus according to claim 8, characterized in that: The soybeans to be tested after inoculation with downy mildew were defined as soybeans 8 days after inoculation, with the day of inoculation as day 0. Or / and, the inoculation of downy mildew is carried out when the first pair of true leaves of the soybean to be tested are fully expanded.

10. The apparatus according to claim 8 or 9, characterized in that: The ratio of Pm18s gene expression to GmActin gene expression in the inoculated leaves of soybeans after inoculation with downy mildew was obtained by semi-quantitative PCR.

Images