Molecular marker closely linked with soybean plant height QTL qPH1.01 and application thereof

Abstract

The invention belongs to the technical field of molecular biology and genetic breeding, and discloses a molecular marker closely linked with soybean plant height QTL qPH1.01 and application of the molecular marker. According to the present invention, the major QTL qPH1.01 for regulating corn plant height variation is identified by using linkage analysis, the significantly associated SNP is located at the 27th, 318th and 904th bases of the first chromosome of the reference genome Glycinemaxv2.1, 6.28-11.14% phenotypic variation can be explained in the single environment, the PARMS marker developed by using the SNP is used to detect 96 soybean varieties, the typing is clear, the operation is simple and convenient, the method is suitable for soybean plant polymer breeding, and the application prospect is broad. And a new high-yield soybean variety with proper plant height and lodging resistance is cultivated.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology and genetic breeding technology, specifically relating to a molecular marker closely linked to soybean plant height QTLqPH1.01 and its application. Background Technology

[0002] Soybean (Glycine max L.) is a globally important dual-purpose crop for both food and oilseed production. Plant height is a key agronomic trait determining planting density, lodging resistance, and yield. With the development of modern agriculture towards mechanization and intensification, the requirements for soybean plant height are becoming increasingly refined. Different ecological zones and planting patterns require soybean varieties with specific plant height ranges. Plants that are too short will lead to reduced yield, while plants that are too tall are prone to lodging and yield reduction. Furthermore, plant height indirectly regulates yield by affecting agronomic traits such as the number of pods per plant and plant height (Chang et al., 2018; Li MW et al., 2020). Plant height is a typical quantitative trait controlled by multiple genes and is significantly influenced by environmental conditions (Lee et al., 1996).

[0003] Researchers used linkage analysis and genome-wide association analysis to locate QTLs related to plant height. Linkage analysis based on biparental populations (Xu et al., 2017) identified 238 plant height-related QTLs across all 20 chromosomes. Early studies often used low-throughput molecular markers such as RFLP, AFLP, and SSR to construct linkage maps, resulting in insufficient marker density, excessively large QTL localization intervals, and difficulties in candidate gene prediction and marker-assisted selection. With the development of molecular marker technology, high-throughput SNP markers have gradually become the mainstream marker type for QTL localization (Adewusi et al., 2017; Gomez-Casati et al., 2017; Zhang et al., 2019; Karikari et al., 2020; Tian et al., 2020; Salari et al., 2021; Silva et al., 2021). To improve localization accuracy, SNP genotyping technology is widely used in linkage map construction. Cao et al. (2019) constructed genetic linkage maps for two RIL populations using 3,958 and 2,600 SNP markers, respectively, identifying 8 and 12 plant height QTLs on chromosomes 2, 5, 6, 7, 9, 10, 15, 16, 17, and 19, with phenotypic explained rates ranging from 1.8% to 50.7%. Wang et al. (2021) constructed a high-density map containing 2,225 molecular markers, detecting 39 plant height QTLs on chromosomes 5, 6, 7, 9, 10, 12, 15, 16, 18, and 20, with phenotypic explained rates ranging from 1.11% to 18.9%.

[0004] 9%. Furthermore, most reported plant height QTLs lack stability verification under different genetic backgrounds and environments, limiting their breeding application value. Therefore, identifying soybean plant height QTLs that can be stably detected in multiple environments and developing reliable molecular markers are of great significance for achieving precise improvement of plant height traits. Summary of the Invention

[0005] The purpose of this invention is to provide a reagent for detecting bases at positions 27,318,904 on soybean chromosome 1, for use in soybean plant height screening breeding.

[0006] Another object of the present invention is to provide the application of a reagent for detecting bases at position 27,318,904 of soybean chromosome 1 in the preparation of a soybean plant height screening kit.

[0007] The final objective of this invention is to provide a method for screening soybean plant height for breeding.

[0008] To achieve the above objectives, the present invention adopts the following technical measures:

[0009] Obtaining a molecular marker tightly linked to the soybean plant height QTL qPH1.01:

[0010] (1) Population construction and phenotypic identification: The shorter soybean variety Changjiangchun 2 and the taller soybean variety Jiyu 166 were crossed and self-pollinated to construct a population of recombinant inbred lines (RILs), containing 290 F1 lines. 10:11 Family pedigrees. The RIL population and its parents were planted under three experimental conditions: the Guizhou Nanfan Breeding Base in Ledong Li Autonomous County, Hainan Province (2022LD) in 2022; the Baishiyi Base of the Chongqing Academy of Agricultural Sciences (2023CQ) in 2023; and the Agricultural Science Research Institute Base in Gucheng County, Xiangyang City, Hubei Province (2023GC). Plant height and other agronomic and quality-related phenotypic characteristics were investigated. The field trial employed a randomized block design with three replicates. Planting was done in two rows, with 20 plants per family per row, 2m long and 0.5m apart. After grain maturity and harvest, plant height was measured for each family and its parents, with 10 plants measured per row. The average of the three replicates for each condition was taken as the phenotypic value for that condition.

[0011] (2) Construction of High-Density Genetic Maps: Leaf samples were taken from the parents during the flowering and pod-setting stage and from 290 RIL families. DNA was extracted using magnetic beads at a sequencing company (MolBreeding, China). SNPs were identified using GATK v4.1.8. SNPs were rigorously screened using three criteria: (a) diversity between parents; (b) support from at least 8 reads; and (c) a Mendelian segregation ratio of 1:1 (chi-square test, P < 0.001). Based on the genotype data of 290 RIL families, genetic maps were constructed using the Kosambi mapping function of Joinmap v4.0 software. The LOD was set to 5.0 to determine the genetic location of each marker. Based on the resequencing data, 1,241,115 SNPs were detected between the two parents. After rigorous screening, linkage maps were constructed using 4,472 high-quality SNPs. Finally, using the Kosambi mapping function of Joinmap v4.1 software, a linkage map consisting of 1946 SNPs distributed in 20 linkage groups was constructed, with a total length of 22432.61 cM and an average marker distance of 1.25 cM.

[0012] (3) Plant height QTL detection: Plant height QTLs were detected using the R / qtl composite interval plotting method, based on the genotypes and plant height phenotypes of each family in the RIL population. The 1.5 LOD-drop method was used to define QTL confidence intervals. The additive effects of QTLs were calculated using a linear QTL model to interpret phenotypic variation. QTL analysis was performed using the CIM model in R / qtl, based on the genotypes and phenotypes of the population. Through single-environment QTL analysis, a total of 6 plant height QTLs were identified, located on chromosomes 1, 6, 15, 18, and 20, respectively. Figure 3 One major QTL controlling soybean plant height variation, detected on chromosome 1, was named qPH1.01. qPH1.01 was detected in all three environments, and the alleles increasing plant height all originated from the tall parent, Jiyu 166. In a single environment, it explained 6.28%–11.14% of the phenotypic variation. The SNP marker at its LOD peak was named S01_27318904, located at base 27318904 on chromosome 1 of the soybean Glycine_max_v2.1 reference genome, with an allele of C / G.

[0013] (4) PARMS marker development: Specific primers were designed based on the upstream and downstream sequences of the S01_27318904 site to construct a PARMS detection system. The primer sequences are as follows:

[0014] PARMS1:TTATTGCGCTTTCCTTGAG,

[0015] PARMS1P1:GAAGGTGACCAAGTTCATGCAACTATGAAGCTGAATGAAAC, and PARMS1P2:GAAGGTCGGAGTCAACGGAAACTATGAAGCTGAATGAAAG.

[0016] The scope of protection of this invention includes:

[0017] Application of reagents for detecting the genotype of soybean chromosome 1 at positions 27,318,904 in soybean plant height breeding.

[0018] Application of reagents for detecting bases at positions 27,318,904 on soybean chromosome 1 in the preparation of soybean plant height screening kits.

[0019] In the above-described applications, if the base at position 27,318,904 of soybean chromosome 1 is detected to be C, then the soybean is determined to be a tall plant material.

[0020] If the base at position 27,318,904 of soybean chromosome 1 is detected as G, then the soybean is determined to be a dwarf-tall material.

[0021] In the above applications, the preferred reagent is a primer.

[0022] The primers described above are preferably PARMS detection primers, and more preferably the primers provided by the present invention: PARMS1: TTATTGCGCTTTCTCTTGAG, PARMS1P1: GAAGGTGACCAAGTTCATGCAACTATGA AGCTGAATGAAAC and PARMS1P2: GAAGGTCGGAGTCAACGGAAACTATGAAGCTGAA TGAAAG.

[0023] A method for screening soybean plant height includes detecting bases at positions 27,318,904 of soybean chromosome 1 using conventional methods in the art. These conventional methods include, but are not limited to, sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry.

[0024] The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gr amene.org / Glycine_max / .

[0025] Compared with the prior art, the present invention has the following advantages:

[0026] (1) The QTL qPH1.01 identified in this invention is stably expressed under three environmental conditions, and can explain 6.28% to 11.14% of the plant height phenotypic variation under a single environment, thus having high breeding application value. qPH1.01 is a QTL locus with both high genetic stability and the ability to explain a large proportion of phenotypic variation, thus having great potential for breeding applications.

[0027] (2) The developed PARMS markers are easy to operate, low in cost, and have clear typing, making them suitable for high-throughput screening of large-scale breeding populations. Attached Figure Description

[0028] Figure 1 Phenotypic analysis chart of parental and RIL families.

[0029] Figure 2 High-resolution genetic linkage map of the Changjiangchun 2 × Jiyu 166RIL population.

[0030] Figure 3 The figure shows the QTL results of plant height detected in the RIL population under three different environments.

[0031] Figure 4 This is a graph showing the results of molecular marker fluorescence detection. Detailed Implementation

[0032] Unless otherwise specified, the technical solutions described in this invention are all conventional techniques in the field; the reagents or materials described, unless otherwise specified, are all from commercial sources. The version number of the soybean reference genome used in this invention is Glycine_max_v2.1, and the URL is https: / / ensembl.gramene.org / Glycine_max / .

[0033] Example 1:

[0034] SNP molecular markers significantly associated with soybean plant height QTL qPH1.01:

[0035] Test materials: The short-statured soybean variety Changjiangchun 2 and the taller soybean variety Jiyu 166 were crossed and self-crossed to construct a RIL population containing 290 F1 cells. 10:11 Family lineage.

[0036] (1) Phenotypic identification of plant height in the RIL population: The RIL population and its parents were planted in three experimental environments: the Guizhou Nanfan Base in Ledong Li Autonomous County, Hainan Province in 2022 (2022LD), the Baishiyi Base of Chongqing Academy of Agricultural Sciences in 2023 (2023CQ), and the Agricultural Science Research Institute Base in Gucheng County, Xiangyang City, Hubei Province (2023GC). Plant height and other agronomic and quality-related phenotypes were investigated. The field experiment adopted a randomized block design with three replicates; two rows were planted, with 20 plants per family per row, 2m long and 0.5m apart. After grain maturity and harvest, the plant height of each family and its parents in the RIL population was measured, with 10 plants per row. The average of the three replicates in each environment was taken as the phenotypic value of the material in that environment. Figure 1 ).

[0037] (2) Construction of High-Density Genetic Maps: Leaf samples were taken from the parents during the flowering and pod-setting stage and from 290 RIL families. DNA was extracted using magnetic beads at a sequencing company (MolBreeding, China). SNPs were identified using GATK v4.1.8. SNPs were rigorously screened using three criteria: (a) diversity between parents; (b) support from at least 8 reads; and (c) a Mendelian segregation ratio of 1:1 (chi-square test, P < 0.001). Based on the genotype data of 290 RIL families, genetic maps were constructed using the Kosambi mapping function of Joinmap v4.0 software. The LOD was set to 5.0 to determine the genetic location of each marker. Based on the resequencing data, 1,241,115 SNPs were detected between the two parents. After rigorous screening, linkage maps were constructed using 4,472 high-quality SNPs. Finally, using the Kosambi mapping function of Joinmap v4.1 software, a linkage map consisting of 1946 SNPs distributed across 20 linkage groups was constructed, with a total length of 22432.61 cM and an average marker distance of 1.25 cM. Figure 2 ).

[0038] (3) Plant height QTL detection: Plant height QTLs were detected using the R / qtl composite interval plotting method, based on the genotypes and plant height phenotypes of each family in the RIL population. The 1.5 LOD-drop method was used to define QTL confidence intervals. The additive effects of QTLs were calculated using a linear QTL model to interpret phenotypic variation. QTL analysis was performed using the CIM model in R / qtl, based on the genotypes and phenotypes of the population. Through single-environment QTL analysis, a total of 6 plant height QTLs were identified, located on chromosomes 1, 6, 15, 18, and 20, respectively. Figure 3 ).

[0039] (4) Obtaining qPH1.01 and its significantly associated SNP markers: A QTL controlling soybean plant height variation was detected on chromosome 1 and named qPH1.01. qPH1.01 was detected in all three environments. The alleles that increased plant height all came from the tall parent Jiyu 166, and could explain 6.28% to 11.14% of the phenotypic variation in a single environment (Table 1). The SNP marker at its LOD peak was named S01_27318904, located at base 27318904 on chromosome 1 of the soybean Glycine_max_v2.1 reference genome, with an allele of C / G. Its flanking sequence is: 5'-GTTTACTTGCTACTTATTGGTTCTTGTGATGCAATAAGAATAGGCCAAACTATGAAGCTGAATGAAA[C / G]AAGAGAGATTCTCAAGAGAAAGC GCAATAACC-3'.

[0040] Table 1 Initial localization results of qPH1.01

[0041]

[0042] Note: Reference genome Glycine_max_v2.1, a represents the experimental environment: 2022LD (2022 Ledong), 2023CQ (2023 Chongqing), and 2023GC (2023 Gucheng); b represents chromosomes; c represents additive effects; d represents explained phenotypic variation.

[0043] Example 2:

[0044] Development of a PARMS marker closely linked to soybean plant height:

[0045] PARMS marker development: Specific primers were designed based on the upstream and downstream sequences of the SNP marker S01_27318904 at the LOD peak, and a PARMS detection system was constructed. The primer sequences are as follows:

[0046] PARMS1:TTATTGCGCTTTCCTTGAG,

[0047] PARMS1P1: GAAGGTGACCAAGTTCATGC AACTATGAAGCTGAATGAAAC, PARMS1P2: GAAGGTCG GAGTCAACGGA AACTATGAAGCTGAATGAAAG.

[0048] The underlined part is the fluorescent connector.

[0049] The method for detecting the genotype of the soybean qPH1.01 locus using the above PARMS primer set is as follows:

[0050] (1) Extract genomic DNA from the soybeans to be tested.

[0051] (2) Preparation of the reaction system. The reaction system consisted of 5 μL, including 2.5 μL of 2×PARMS PCR reaction mix (a product of Wuhan Jingtai Biotechnology Co., Ltd.), aqueous solutions of primers PARMS1, PARMS1P1, and PARMS1P2, DNA, and water. In the reaction system, the concentrations of primers PARMS1P1 and PARMS1P2 were both 150 nM, and the concentration of primer PARM S1 was 400 nM.

[0052] (3) Add 5 μL of paraffin oil to the reaction system (to prevent sample evaporation), and then perform PCR amplification.

[0053] The reaction program was as follows: 95℃ for 15 min; 95℃ for 20 s, 65℃ for 1 min, decreasing by 0.8℃ per cycle until reaching 57℃, for 10 cycles; 95℃ for 20 s, 57℃ for 1 min, for 32 cycles.

[0054] (4) After completing step (3), the signal is read on the TECAN Infinite M1000 and then the following judgment is made: if blue is displayed, the corresponding soybean is or is suspected to be a short-planted tall soybean; if green is displayed, the corresponding soybean is or is suspected to be a tall-planted tall soybean.

[0055] Using the primers described above, the sequence amplified in the tall plant material Jiyu 166 is:

[0056] AACTATGAAGCTGAATGAAA C AAGAGAGATTCTCAAGAGAAAGCGCAATAA

[0057] The amplification product sequence of the dwarf-growing, tall material Changjiangchun 2 is:

[0058] AACTATGAAGCTGAATGAAA G AAGAGAGATTCTCAAGAGAAAGCGCAATAA.

[0059] Example 3:

[0060] Universality of PARMS markers in soybean plant height selection:

[0061] The PARMS primer set designed in Example 2 was used to detect the genotype and genetic effect of the qPH1.01 locus in the soybeans to be tested. The soybeans to be tested consisted of 96 domestic and international soybean varieties (lines). Following the method used in Example 1, field identification was conducted in 2024 at the Baishiyi Base of the Chongqing Academy of Agricultural Sciences (2024CQ), and plant height was also examined.

[0062] The results showed that among the 96 soybean varieties (lines) mentioned above, 61 individual plants with the GG genotype exhibited FAM blue fluorescence signal, with an average plant height of 50.19 cm; 35 individual plants with the CC genotype exhibited HEX green fluorescence signal, with an average plant height of 54.39 cm. Figure 4 The difference in plant height between the CC and GG genotypes was highly significant (P-value = 1.12e-3). This result indicates that the genotype at the qPH1.01 locus is segregated in 96 domestic and international soybean varieties (lines) and has a stable and reliable genetic effect.

[0063] The above results indicate that the prepared PARMS molecular marker qPH1.01 has a significant genetic effect on soybean plant height and has a good screening effect.

Claims

1. Application of reagents for detecting bases at positions 27,318,904 on soybean chromosome 1 in soybean plant height screening breeding.

2. Application of reagents for detecting bases at positions 27,318,904 of soybean chromosome 1 in the preparation of soybean plant height screening kits.

3. The application according to claim 1 or 2, characterized in that: If the reagent detects that the base at position 27,318,904 of soybean chromosome 1 is C, then the soybean is determined to be a tall plant material.

4. The application according to claim 1 or 2, characterized in that: If the reagent detects that the base at position 27,318,904 of soybean chromosome 1 is G, then the soybean is determined to be a dwarf-tall material.

5. The application according to claim 1 or 2, characterized in that: The reagent is a primer.

6. The application according to claim 5, characterized in that: The primers are PARMS1:TTATTGCGCTTTCTCTTGAG; PARMS1P1:GAAGGTGACCAAGTTCATGCAACTATGAAGCTGAATGAAAC; PARMS1P2:GAAGGTCGGAGTCAACGGAAACTATGAAGCTGAATGAAAG.

7. A method for screening soybean plant height, comprising detecting the genotype at position 27,318,904 of soybean chromosome 1, wherein the method comprises sequencing, TaqMan probe method, AS-PCR method, molecular beacon method, high-resolution melting curve method, CAPS method, SNaPshot method, KASP method, PARMS method, gene chip method, or mass spectrometry method.

Images