Preparation and application of SWP26, a sporal wall protein of grouper enterospora, and its polyclonal antibody.

CN121108277BActive Publication Date: 2026-04-03QINGDAO AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-13
Publication Date
2026-04-03

AI Technical Summary

Technical Problem

Current technologies lack effective means of detecting and treating enterocystosis in grouper, especially the specific detection methods for early infection in grouper are not accurate enough, and there is insufficient development of immune response mechanisms and vaccines, resulting in weak disease control.

Method used

The spore wall protein SWP26 of grouper enterospora and its polyclonal antibody were prepared. The recombinant protein was expressed and purified by constructing the pET-32a-SWP26 plasmid, and a high-titer polyclonal antibody was prepared for the specific detection and treatment of grouper enterospora disease.

Benefits of technology

This technology enables specific detection of early-stage grouper infections, providing methods for the prevention and treatment of grouper enterospora disease, and laying the foundation for healthy grouper aquaculture.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121108277B_ABST
    Figure CN121108277B_ABST
Patent Text Reader

Abstract

This invention discloses the preparation and application of SWP26, a sporulation wall protein of *Enterocera dorsalis* from grouper, and its polyclonal antibody. It belongs to the field of animal quarantine. The *Enterocera dorsalis* gene was amplified using PCR, the target band was cut and transformed into the pET-32a vector to construct a recombinant plasmid, which was then transformed into *E. coli* BL21(DE3) for induced expression. The protein was purified using Ni-NTA affinity chromatography. The purified SWP26 recombinant protein was used for animal immunization and polyclonal antibody purification. Western blot analysis of the purified antibody showed a clear signal at approximately 43 kDa, confirming that the anti-SWP26 polyclonal antibody specifically reacts with the purified SWP26 protein. This invention is the first to clone and identify a high-abundance sporulation wall protein, SWP26, located on the surface of *Enterocera dorsalis* from grouper. It is a specific protein of *Enterocera dorsalis* and can serve as a drug target for treating grouper enterocytozoonosis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of animal quarantine technology, specifically to the preparation and application of SWP26, a sporocystis jirovecii cell wall protein of grouper, and its polyclonal antibody. Background Technology

[0002] Microsporidia are single-celled eukaryotic organisms with obligate intracellular parasitic characteristics. These organisms are extremely widespread in nature, capable of parasitizing the vast majority of animal groups, including invertebrates and vertebrates. To date, humans have discovered over 200 genera and more than 1,500 species of microsporidia. Among these, 21 genera, comprising over 160 species, can infect fish.

[0003] Grouper (Epinephelus spp.) is an important marine economic fish in my country. In recent years, microsporidiasis, which occurs during the grouper fry breeding stage, has spread widely in Hainan. Its main symptoms include anorexia, thinning of the intestinal wall, extreme emaciation of the fish, and excretion of white feces, causing a large number of deaths of fry and is one of the main diseases that harm grouper.

[0004] Currently, there is no effective method for detecting and treating grouper enterosporidiasis. Existing technologies include probe-based methods for early detection of intestinal microsporidia in grouper, but these methods lack specificity and may produce non-specific staining results. Furthermore, disease prevention and control remain lagging. Reports on the immune response mechanisms of grouper to this pathogen and vaccine development are scarce, resulting in weak current control measures for grouper enterosporidiasis. Sporulation wall proteins (SWPs) are known to play a central regulatory role in pathogen-mediated host adhesion, invasion, and pathogenicity mechanisms. To date, various SWPs have been identified from *Bombyx mori* and *Encephalitis microsporidia*. These proteins can trigger microsporidia infection of host cells by recognizing heparin-binding motifs and binding to sulfated glycosaminoglycans on the host cell surface. Therefore, SWPs are important detection targets for the treatment of microsporidiasis.

[0005] In view of the problems existing in the prior art, the present invention, combined with years of design and use experience in related fields, designed a method for the preparation and application of SWP26 sporocystis moniliformis and its polyclonal antibody to overcome the above defects. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention provides a method for preparing and applying the grouper enterocytozoan sporocyst wall protein SWP26 and its polyclonal antibody. Through biotechnology, this method enables the specific detection and prevention of whether grouper without obvious symptoms are infected with grouper enterocytozoan sporocystis.

[0007] To achieve the above objectives, the present invention provides a grouper enterospora sporocyst wall protein SWP26, the amino acid sequence of which is shown in SEQ ID NO.2; the grouper enterospora sporocyst wall protein SWP26 is located on the sporocyst wall of grouper enterospora during the infection period.

[0008] The present invention also provides a nucleic acid molecule encoding the above-mentioned grouper enterospora sporal wall protein SWP26, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0009] The present invention also provides a polyclonal antibody against the grouper enterospora sporal wall protein SWP26, which is obtained by immunization with the above-mentioned grouper enterospora sporal wall protein SWP26 as an antigen.

[0010] This invention also provides a method for preparing a polyclonal antibody against the spore wall protein SWP26 of grouper enterospora, comprising the following steps:

[0011] (1) Construct a prokaryotic expression recombinant plasmid pET-32a-SWP26 containing the nucleotide sequence shown in SEQ ID NO.1;

[0012] (2) The recombinant plasmid is transformed into an expression host to construct an engineered bacterium carrying the recombinant plasmid, and expressed by IPTG induction;

[0013] (3) The induced expression product was purified by Ni-NTA affinity chromatography to obtain purified SWP26 recombinant protein;

[0014] (4) Using the purified SWP26 recombinant protein as an antigen to immunize animals, antiserum was prepared;

[0015] (5) Purify the antiserum to obtain polyclonal antibody against the SWP26 sporal wall protein of the grouper enterospora.

[0016] Preferably, the expression host in step (2) is Escherichia coli BL21(DE3).

[0017] Preferably, the concentration of the IPTG solution in step (2) is 1 mM.

[0018] Preferably, step (2) is performed at 37°C for 12 hours.

[0019] Preferably, the preparation method further includes detecting the polyclonal antibody against the spore wall protein SWP26 by Western blotting or indirect immunofluorescence detection.

[0020] The present invention also provides the application of the polyclonal antibody against the grouper enterospora spore wall protein SWP26 as described above in the detection of grouper enterospora spore wall protein SWP26, for the detection of grouper enterospora for non-disease diagnosis and treatment purposes.

[0021] Preferably, the polyclonal antibody against the grouper enterospora sporangioides wall protein SWP26 is used to prepare a detection reagent for grouper enterospora.

[0022] The advantages of this invention are:

[0023] 1. This invention is the first to clone and identify a high-abundance sporal wall protein SWP26 located on the surface of grouper enterocystis, which is a specific protein of grouper enterocystis and has no homologous protein in other species. It plays an important role in the process of grouper enterocystis infecting the host and can be used as a drug target for the treatment of grouper enterocystis disease.

[0024] 2. This invention, by constructing the pET-32a-SWP26 plasmid recombinant vector and expressing and purifying its protein, not only prepares a high-titer polyclonal antibody with good specificity, but also lays the foundation for subsequent research on the related functions of the grouper enterospora sporangiophora protein SWP26, provides ideas for in-depth research on the detection of grouper enterospora diseases, and lays the foundation for the sustainable and healthy development of the aquaculture industry. Attached Figure Description

[0025] Figure 1 The image shows the results of DNA amplification using specific primers for the grouper enterospora larvae spore wall protein SWP26. M represents the DNA marker; lane 1 represents the size of the SWP26 DNA.

[0026] Figure 2 Image showing the localization analysis of the sporangial protein SWP26 on the surface of ECGI-21 intestinal epithelial cells of infected grouper. Cy5: red light; DAPI: blue fluorescence image under ultraviolet light after DAPI staining (showing the nuclei of intestinal epithelial cells and grouper enterospora infecting the grouper); DY96: green fluorescence image under ultraviolet light after DY96 staining (showing the localization of grouper enterospora on the surface of the grouper).

[0027] Figure 3SDS-PAGE electrophoresis of SWP26 gene-induced protein and purified SWP26 recombinant protein. M: protein marker; Lanes 1-4 are for SWP26-induced protein SDS-PAGE electrophoresis analysis, where lane 1: control group without IPTG solution; lane 2: whole bacterial culture after sonication lysis; lane 3: supernatant sample after sonication lysis; lane 4: bacterial precipitate after sonication lysis; Lanes 5-8 are for purified SWP26 recombinant protein SDS-PAGE electrophoresis analysis, where lane 5: bacterial lysate supernatant sample; lane 6: bacterial lysate supernatant sample after 5 passes through a nickel column; lane 7: sample after 10 passes through a nickel column with denaturing wash buffer; lane 8: sample after the first elution of SWP26 recombinant protein.

[0028] Figure 4 Western blot analysis of SWP26 recombinant protein: M: protein marker; A: ECL staining of SWP26 recombinant protein after incubation with mouse monoclonal antibody containing His tag; Lane 1: SWP26 bacterial culture induced by IPTG solution; Lane 2: purified SWP26 recombinant protein sample.

[0029] Figure 5 This is a Western blot analysis image of the anti-SWP26 protein polyclonal antibody. M: protein marker; A: ECL staining after incubation of the anti-SWP26 protein polyclonal antibody with purified SWP26 recombinant protein; Lane 1: purified SWP26 recombinant protein sample. Detailed Implementation

[0030] To facilitate understanding by those skilled in the art, the present invention will be further described below with reference to specific embodiments. Example 1

[0031] 1. Construction of recombinant plasmid for prokaryotic expression of spore wall protein SWP26

[0032] Using the extracted genomic DNA of *Enterocera stylosa* as a template, PCR amplification was performed using specific primers SWP26-F and SWP26-R, which were obtained by fusing the SWP26 gene with a 6×his tag.

[0033] (The sequence of SWP26-F (SEQ ID NO.3) is)

[0034] 5'-gctgatatcggatcc gaattc ATGAGAATATCAACTTATTTTTTACATGCT-3', underscore is EcoRⅠ Restriction enzyme cleavage site, TTTTTT is a 6×his tag;

[0035] The sequence of SWP26-R (SEQ ID NO.4) is:

[0036] 5'-ttgtcgacggagctc gaattc TAAACTCAAGATATTAAAGAAACATTTTGAA-3', underscore is EcoRⅠ (Restriction enzyme sites), resulting in a single target band of 687 bp, see... Figure 1 Lane 1 of the swimming pool. After agarose gel electrophoresis, the target band was excised under ultraviolet light and the target gene fragment was recovered by gel electrophoresis;

[0037] pET-32a vector EcoRⅠ The target gene fragment was digested with a single enzyme, and then the recovered target gene fragment was transferred into the vector to construct a prokaryotic expression recombinant plasmid. The recombinant plasmid was then sequenced for verification.

[0038] The PCR reaction system for PCR amplification is shown in Table 1, and the PCR reaction procedure is shown in Table 2.

[0039] Table 1 PCR reaction system

[0040]

[0041] Table 2 PCR reaction procedure

[0042]

[0043] 2. Prokaryotic expression and purification of spore wall protein SWP26

[0044] 2.1 Prokaryotic expression

[0045] The recombinant plasmid pET-32a-SWP26 was transformed into E. coli BL21(DE3) competent cells. Eight independent colonies were randomly selected for colony PCR detection. The correctly detected colonies were inoculated into 1 mL of LB liquid medium containing 100 mg / mL ampicillin and cultured at 37°C and 200 rpm. Colonies in the LB liquid medium that were verified as positive by agarose gel electrophoresis were sent for sequencing. The correctly sequenced colonies were then expanded. The remaining liquid from the 1 mL LB liquid medium was transferred at a volume ratio of 1:100 to LB liquid medium containing 100 mg / mL ampicillin and cultured at 37°C with shaking at 200 rpm until the OD600 value reached 0.6–0.8.

[0046] Two mL of bacterial culture was used as the control group (without IPTG induction), and the remaining bacterial cultures were used as the experimental group. IPTG solution with a final concentration of 1 mM was added to induce expression, and the cultures were induced at 37℃ and 200 rpm for 12 h. After induction, the bacterial cultures were centrifuged at 4℃ and 12000 rpm for 5 min, and the bacterial cell pellet was collected. The pellet was resuspended in PBS at a bacterial culture to PBS volume ratio of 50:6. The pellet was then subjected to sonication at 0℃ (200 W, 3 s intervals, 7 s intervals, for 15 min). Two mL of the sonicated bacterial culture was taken and centrifuged at 12000 rpm for 1 min at room temperature to obtain the supernatant and bacterial cell pellet. 60 μL of the supernatant was retained. After removing the supernatant, 1 mL of 1×PBS was added to the bacterial cell pellet for resuspending. SDS-PAGE electrophoresis analysis was performed on the control group, the sonicated whole bacteria, the supernatant, and the bacterial cell pellet to further detect the induced expression of the recombinant protein. Figure 3 As shown, the results indicate that the SWP26 recombinant protein exists in two forms: inclusion bodies and soluble protein, with inclusion bodies being the predominant form (see reference). Figure 3 (Middle lanes 1-4)

[0047] 2.2 Purification

[0048] The induced bacterial culture was centrifuged at 4℃ and 12000 rpm for 5 min, and the bacterial pellet was collected. Denaturing lysis buffer was added to the pellet at a ratio of 80 ml per 1 L of induced bacterial culture, and the pellet was resuspended. The pellet was then subjected to sonication on ice (250 W, 2 s intervals, 30 min). After centrifugation at 4℃ and 10,000 × g for 30 min, the bacterial lysis supernatant and pellet were collected. 20 μL of the bacterial lysis supernatant was analyzed by SDS-PAGE electrophoresis (see reference). Figure 3 Lane 5 (middle lane). The denaturation and lysis buffer was a mixed solution of 50 mM Tris, 500 mM NaCl, and 8 M urea, with the pH adjusted to 7.5 by hydrochloric acid.

[0049] Add 500 μL of agarose magnetic beads to the Ni-NTA affinity chromatography column, followed by 500 μL of denaturing lysis buffer to equilibrate the gel. Load 4 mL of bacterial lysis supernatant onto the column. After the supernatant has completely passed through the affinity chromatography column, repeat this loading procedure 5 times. Retain the last 20 μL of supernatant for SDS-PAGE electrophoresis (see reference). Figure 3 Lane 6); Wash 10 times with denaturing wash buffer, 1 mL each time, and collect the last 20 μL of wash buffer after column perforation for SDS-PAGE electrophoresis (refer to...). Figure 3 Lane 7 (middle lane). The denaturing wash solution was a mixture of 50 mM Tris, 500 mM NaCl, 8 M urea, and 15 mM imidazole, with the pH adjusted to 7.5 by hydrochloric acid.

[0050] Next, add denaturing elution buffer and elute 5 times, 500 μL each time. Perform SDS-PAGE electrophoresis on the sample eluted in the first elution (refer to...). Figure 3 (Channel 8) The eluted liquid was collected into separate centrifuge tubes, flash-frozen in liquid nitrogen, and stored at -80°C. The samples from the centrifuge tubes were added to dialysis bags and dialyzed overnight with PBS to obtain purified SWP26 recombinant protein samples. The denaturing eluent was a mixture of 50 mM Tris, 500 mM NaCl, 8 M urea, and 250 mM imidazole, with the pH adjusted to 7.5 by hydrochloric acid. In other embodiments, the 8 M urea in the denaturing lysis buffer, denaturing wash buffer, and denaturing eluent could be replaced with 6 M guanidine hydrochloride, and the imidazole concentration in the denaturing wash buffer could be controlled within 10-20 mM.

[0051] The purified SWP26 recombinant protein sample was transferred to a 0.45 μm PVDF membrane after SDS-PAGE electrophoresis. The transfer conditions were: constant current 200 mA, 50 min, followed by two washes with 1×TBST; blocking with 5% skim milk powder at room temperature for 2 h, followed by three washes with 1×TBST; incubation overnight at 4°C with 1:1500 diluted 6×his tag Anti-His Mouse as primary antibody, followed by three washes with 1×TBST; incubation for 1 h with 1:5000 diluted HRP-labeled Goat Anti-Mouse IgG as secondary antibody, followed by three washes with 1×TBST for 5 min each; and finally, Western blot analysis was performed using a chemiluminescent substrate. The results showed that... Figure 4 As shown, a clear signal appears at approximately 43 kDa, confirming that the recombinant protein that was induced to be expressed and successfully purified is the SWP26 recombinant protein.

[0052] 3. Preparation and purification of anti-SWP26 polyclonal antibody

[0053] 3.1 Animal Immunization

[0054] After determining the BCA concentration of recombinant SWP26 protein, healthy female New Zealand white rabbits (4 months old, weighing 2-2.5 kg) were immunized via subcutaneous injection in the back. The first four immunizations were completed on days 1, 14, 28, and 42. After the fourth immunization, blood was collected via ear vein for testing. The titer of the antiserum against SWP26 was determined using an indirect ELISA method. When the titer reached ≥1:50000, whole blood was collected via the carotid artery. The blood was incubated overnight at 4°C, and the serum was separated to prepare the antiserum.

[0055] 3.2 Antibody purification

[0056] Bestarose 4B activated with cyanogen bromide was packed into a purification column and washed three times with hydrochloric acid (approximately 30 ml in total). Residual hydrochloric acid was removed with 1×PBS buffer. The antigen (i.e., the purified SWP26 recombinant protein sample) was then dissolved in PBS and added to the purification column. The column was incubated overnight at 4°C. The column was then washed three times alternately with acid, water, and alkali, and finally washed with PBS to obtain the affinity purification column. Antiserum was added to the affinity purification column and incubated overnight. After pre-washing with hydrochloric acid to remove contaminating antibodies, the column was eluted with citrate buffer (pH 2.7). The eluent was collected and rapidly neutralized with 0.5 M sodium carbonate to obtain the affinity purified antibody, an anti-SWP26 protein polyclonal antibody. The concentration was measured after dialyzing in PBS, and the titers of the antiserum and purified antibody were determined by indirect ELISA. The ELISA titer showed that the anti-SWP26 protein polyclonal antibody had a titer ≥64000.

[0057] 4. Identification of anti-SWP26 polyclonal antibodies

[0058] Western blot analysis was performed on the purified antibody: The purified SWP26 recombinant protein sample was transferred to a 0.45 μm PVDF membrane after SDS-PAGE electrophoresis. The transfer conditions were constant current 200 mA, 50 min, and washing twice with 1×TBST. The membrane was blocked with 5% skim milk powder at room temperature for 2 h, washed three times with 1×TBST, and incubated overnight at 4°C with a 1:64000 dilution of anti-SWP26 polyclonal antibody as the primary antibody, followed by washing three times with 1×TBST. A 1:5000 dilution of HRP-Goat Anti-Rabbit IgG was used as the secondary antibody, incubated at room temperature for 1 h, and washed three times with 1×TBST for 5 min each time. Chemiluminescent substrate was added for Western blot analysis. The results showed a significant signal at approximately 43 kDa. Figure 5 As shown, this confirms that the anti-SWP26 polyclonal antibody can specifically react with the purified SWP26 recombinant protein sample, specifically recognize and bind to the protein, indicating that it can successfully generate an immune response against the protein.

[0059] 5. Localization and identification of SWP26 protein on the surface of Enterobacteriaceae in infected grouper

[0060] This invention relates to a cell line for in vitro culture of *Enterocera dorsalis* from grouper, derived from ECGI-21 intestinal epithelial cells of *Odontocerca obliquee* provided by Zhou Sheng of South China Agricultural University; the culture medium used is a modified Leibovitz L-15 medium. ECGI-21 cells were cultured at 10... 6 Seed 500 μL of cells per well into 24-well plates and incubate overnight at 28°C in a CO2-free environment for use.

[0061] The ECGI-21 intestinal cells of the oblique-banded grouper are preserved under the GDMCC No. 62408. The specific formulation of the modified Leibovitz L-15 medium is as follows: based on Leibovitz L-15 medium, supplemented with 10% (v / v) fetal bovine serum, 100 IU / mL penicillin, 0.1 mg / mL streptomycin, 0.05 mg / mL 4-hydroxyethylpiperazine ethanesulfonic acid solution, and 2.66 mg / mL NaCl.

[0062] The subcellular localization of SWP26 protein on the surface of *Enterocera dorsalis* in infected grouper was identified by indirect immunofluorescence localization analysis. The specific steps are as follows:

[0063] Grouper intestinal epithelial cells were cultured in 24-well plates containing cell spreaders. 500 μL of grouper enterospora solution diluted with modified Leibovitz L-15 medium was added to each well, bringing the final concentration of grouper enterospora in each well to 1 × 10⁻⁶. 7 After 4 hours of infection at 28℃, the original culture medium was discarded, and the sample was washed three times with 500 μL PBS.

[0064] Add 500 μL of 4% paraformaldehyde to cover the cells and grouper enterospora, fix for 15 min, then wash 3 times with 500 μL PBS; add 200 μL of 0.01% Triton X-100 to cover, permeabilize for 30 min, then wash 3 times with 500 μL PBS; add 200 μL of immunofluorescence blocking buffer to cover the slide, block at room temperature for 1 h; add 200 μL of anti-SWP26 polyclonal antibody diluted 1000 times with immunofluorescence blocking buffer to the wells, incubate at 37℃ for 1 h, then wash 3 times with 500 μL PBS; add 50 μL of goat anti-rabbit Cy5 diluted 100 times with immunofluorescence blocking buffer as a secondary antibody to the wells, incubate at 37℃ for 1 h, then wash 3 times with 500 μL PBS; add 100 μL of DAPI dye, incubate at room temperature in the dark for 10 min, then wash with 500 μL of PBS. Wash three times with PBS; add 100 μL of DY96 dye (direct yellow dye), incubate at room temperature in the dark for 10 min, and wash three times with 500 μL of PBS; add 5 μL of anti-fluorescence quencher to the sample placement area of ​​the slide, mount, and observe using a confocal fluorescence microscope. Results showed that in the experimental group, a uniform and bright green fluorescent signal appeared on the spore wall of the infected grouper enterocybe, in a circular pattern, while no green fluorescent signal appeared in other areas; the red fluorescent signal overlapped with the green fluorescent signal; the control group, using negative serum as the primary antibody, did not show a red fluorescent signal. Figure 2As shown in the figure. The above results indicate that SWP26 protein is a spore wall protein located on the surface of *Enterocera dorsalis* during the infection period. The extremely strong signal observed confirms that the spore wall protein SWP26 of *Enterocera dorsalis* is highly abundant.

[0065] The nucleotide sequence of the gene encoding the grouper enterospora sporangiophora wall protein SWP26 (SEQ ID NO.1):

[0066] ATGAGAATATCAACTTATTTTTTACATGCTTTAACGGAAGCTGATGTCCAGGTCAATTCT

[0067] AACAAATCATCTGCTCAGACAATCTACAACATCAAAGTTTTAGCACCTGCTAGTTATGCA

[0068] AATAAATATGAAGAGACACATGAATCATTAGGAAGTGATTTACAGAAAATAAAAGAGAAA

[0069] GTTCAGAATGAATTAAATAGATCAGTGAGATTCCGGGAAAATGGGATTTCAATACAAATA

[0070] AATTTAGAAAGCCCAACATCACATCCAGTTATGGATGAATTGGATGATTCAATATGTGAA

[0071] GGTTCATAACATCAATAACATCTTTATTGGATAAAATTAATGTAGTAGATGCATCATCT

[0072] CACTATATAGTGTTATTACCATGTTTACCAAATAACTACACAAATATATTTTTATCTGCA

[0073] CATATAGATGTTCCAATTGTACAGCACAAAATAAATGCACAGTGTTCAAATAGATTGGCA

[0074] ATATTCCAGGAGAGGGAGTACAAATATTTGCTAGCTTCATTCGGTAATGCAATTTTGAAG

[0075] ACATTGGGTGCACCATTAGAGGACTATTCAAAGTTAACGACAACAAGTTCAGGGGATAAT

[0076] GGATTAGAGTCAAATATAACAATAAGTGAGTCATCTGTTCATGACATATTAAATTCAAAA

[0077] TGTTTCTTTAATATCTTGAGTTTATAA

[0078] The amino acid sequence of SWP26, the sporangiosome wall protein of grouper enterospora, is as follows (SEQ ID NO.2):

[0079] MRISTYFLHALTEADVQVNSNKSSAQTIYNIKVLAPASYANKYEETHESLGSDLQKIKEKVQNELNRSVRFRENGISIQINLESPTSHPVMDELDDSICEGSLTSITSLLDKIN VVDASSHYIVLLPCLPNNYTNIFLSAHIDVPIVQHKINAQCSNRLAIFQEREYKYLLASFGNAILKTLGAPLEDYSKLTTTSSGDNGLESNITISESSVHDILNSKCFFNILSL

[0080] The sequence of SWP26-F (SEQ ID NO.3):

[0081] gctgatatcggatccgaattcATGAGAATATCAACTTATTTTTTACATGCT

[0082] The sequence of SWP26-R (SEQ ID NO.4):

[0083] ttgtcgacggagctcgaattcTAAACTCAAGATATTAAAGAAACATTTTGAA

[0084] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of protection of the invention. Furthermore, it should be understood that after reading the technical description of this invention, those skilled in the art can make various alterations, modifications, and / or variations to the invention, and all such equivalent forms also fall within the scope of protection defined by the appended claims.

Claims

1. A grouper enterocytozoan sporocyst wall protein SWP26, characterized in that, The amino acid sequence of the grouper enterospora sporocyst wall protein SWP26 is shown in SEQ ID NO.2; the grouper enterospora sporocyst wall protein SWP26 is located on the sporocyst wall of grouper enterospora during the infection period.

2. A nucleic acid molecule encoding the grouper enterospora sporangioides wall protein SWP26 as described in claim 1, characterized in that, The nucleotide sequence of the nucleic acid molecule is shown in SEQ ID NO.

1.

3. A polyclonal antibody against SWP26, a sporangiophora wall protein of grouper, characterized in that, The polyclonal antibody was obtained by immunization with the grouper enterospora sporal wall protein SWP26 as described in claim 1 as an antigen.

4. The method for preparing a polyclonal antibody against the spore wall protein SWP26 of grouper enterospora according to claim 3, characterized in that, Includes the following steps: (1) Construct a prokaryotic expression recombinant plasmid pET-32a-SWP26 containing the nucleotide sequence shown in SEQ ID NO.1; (2) The recombinant plasmid is transformed into an expression host to construct an engineered bacterium carrying the recombinant plasmid, and expressed by IPTG induction; (3) The induced expression product was purified by Ni-NTA affinity chromatography to obtain purified SWP26 recombinant protein; (4) Using the purified SWP26 recombinant protein as an antigen to immunize animals, antiserum was prepared; (5) Purify the antiserum to obtain polyclonal antibody against the SWP26 sporal wall protein of the grouper enterospora.

5. The method for preparing a polyclonal antibody against the spore wall protein SWP26 of grouper enterospora according to claim 4, characterized in that, The expression host in step (2) is Escherichia coli BL21(DE3).

6. The method for preparing a polyclonal antibody against the spore wall protein SWP26 of grouper enterospora according to claim 4, characterized in that, The concentration of IPTG in step (2) is 1 mM.

7. The method for preparing a polyclonal antibody against the spore wall protein SWP26 of grouper enterospora according to claim 4, characterized in that, Step (2) Induction at 37°C for 12 hours.

8. The method for preparing a polyclonal antibody against the spore wall protein SWP26 of grouper enterospora according to claim 4, characterized in that, The preparation method further includes detecting the polyclonal antibody against the spore wall protein SWP26 by Western blotting or indirect immunofluorescence detection.

9. The application of the polyclonal antibody against the grouper enterocytozoan spore wall protein SWP26 as described in claim 3 in the detection of grouper enterocytozoan spore wall protein SWP26, characterized in that, The application is used for the detection of Enterobacteriaceae in grouper for non-disease diagnosis and treatment purposes.

10. The application of the polyclonal antibody against the grouper enterocytozoan spore wall protein SWP26 according to claim 9 in the detection of grouper enterocytozoan spore wall protein SWP26, characterized in that, The polyclonal antibody against the grouper enterospora sporangiosum spore wall protein SWP26 is used to prepare a detection reagent for grouper enterospora.

Citation Information

Patent Citations

  • Method for early detection of grouper intestinal tract microsporidia and application thereof

    CN105695574A

  • High-sensitivity target gene for enterocytozoon hepatopenaei disease, primer pair, kit and detection method

    CN109486976A