Recombinant triple-helix collagen with high-temperature stability and self-assembly as well as preparation method and application of recombinant triple-helix collagen
By designing recombinant triple-helix collagen through genetic engineering, the problems of allergy and high-temperature denaturation of traditional type III collagen have been solved, achieving low-temperature self-assembly and high-temperature stability, which can be applied to skin repair and anti-wrinkle biomaterials.
Patent Information
- Application Number
- CN202511658786.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-13
- Publication Date
- 2025-12-12
- Estimated Expiration
- 2045-11-13
AI Technical Summary
Traditional methods for extracting type III collagen can lead to allergic reactions due to differences in animal sources, and it is prone to denaturation and loss of biological activity at high temperatures, making it unsuitable for effective skin repair and anti-wrinkle applications.
Recombinant triple-helix collagen was designed using genetic engineering technology. A prokaryotic expression system was constructed using a specific amino acid sequence (SEQ ID NO.1) and nucleotide sequence (SEQ ID NO.2) to prepare recombinant triple-helix collagen with low-temperature self-assembly and high-temperature stability.
The recombinant triple-helix collagen was able to self-assemble into a gel at low temperatures and maintain stability at high temperatures, significantly promoting skin repair and anti-wrinkle effects, and was applied to skin repair and anti-wrinkle biomaterials.
Smart Images

Figure CN121108313A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biological materials, and particularly relates to a recombinant triple helix collagen protein with high-temperature stability and self-assembly as well as a preparation method and application thereof. BACKGROUND
[0002] Type III collagen is an important member of the collagen family, mainly exists in human skin, fascia, tendon and other positions, and can provide elasticity and strength for these tissues. Type III collagen has a triple helix structure, strong cell adhesion, can promote tissue regeneration, has high repair efficiency, and can be effectively applied to skin repair, anti-aging, moisturizing and regeneration and the like.
[0003] Type III collagen is called infant collagen, and the content thereof in infant skin is as high as 80%, and is gradually lost with age. After adulthood, the dermal cells lose the ability of synthesis, resulting in decreased skin elasticity and increased wrinkles.
[0004] Traditional extraction methods of Type III collagen have disadvantages. Animal-derived collagen has sequence differences with natural collagen, and is prone to induce allergic reactions when used in human body. In addition, the extraction process is easy to damage the activity and structure of collagen, resulting in loss of function. The in vivo half-life of natural Type III collagen is short, and unmodified Type III collagen is easy to denature at high temperature, lose the triple helix structure, and thus affect the biological activity. Therefore, there is an urgent need to design a recombinant triple helix collagen protein (humanized Type III collagen) with low-temperature self-assembly and high-temperature stability and to apply it to the fields of skin repair and anti-wrinkle. SUMMARY
[0005] The main purpose of the present application is to provide a recombinant triple helix collagen protein with high-temperature stability and self-assembly as well as a preparation method and application thereof.
[0006] In one aspect of the present application, a recombinant triple helix collagen protein is provided, and the amino acid sequence thereof is shown in SEQ ID NO. 1.
[0007] SEQ ID NO. 1: GPRGERGYYGYGGAPGPGPATPTGKYKAYYGGAGPAGAPGPGPATPTGKYKAYYGGAPGEKGEGGPRGDKGETGERGEPGPRGERGEPGGKGERGAPGEKGEGGPRGDKGETGERGEPGPRGERGEPGKGERGAPGEKGEGGPRGDKGETGERGEPGPRGERGEPGGKGERGAPGEKGEGGPRGDKGETGERGEPGPRGERGEPGKGERGAPGEKGEGGPRGDKGETGERGEPGPRGERG.
[0008] Optionally, the recombinant triple-helical collagen protein has an amino acid sequence with more than 90% sequence identity to the amino acid sequence shown in SEQ ID NO. 1, and retains the same biological function as the amino acid sequence shown in SEQ ID NO. 1.
[0009] Optionally, the amino acid sequence has one or more amino acid residues added, substituted, deleted or inserted in the amino acid sequence shown in SEQ ID NO. 1, and retains the same biological function as the amino acid sequence shown in SEQ ID NO. 1.
[0010] One aspect of the present application is to provide a nucleic acid molecule encoding a recombinant triple-helical collagen protein with high temperature stability and self-assembly, the nucleotide sequence of which is shown in SEQ ID NO. 2.
[0011] SEQ ID NO. 2: ggcccgcgcggcgaacgcggctattatggctatggcggcgcgccgggcccgggcccggcg accccgaccggcaaatataaagcgtattatggcggcgcgggcccggcgggcgcgccgggc ccgggcccggcgaccccgaccggcaaatataaagcgtattatggcggcgcgccgggcgaa aaaggcgaaggcggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggc ccgcgcggcgaacgcggcgaaccgggcggcaaaggcgaacgcggcgcgccgggcgaaaaa ggcgaaggcggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccg cgcggcgaacgcggcgaaccgggcaaaggcgaacgcggcgcgccgggcgaaaaaggcgaa ggcggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccgcgcggc gaacgcggcgaaccgggcggcaaaggcgaacgcggcgcgccgggcgaaaaaggcgaaggc ggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccgcgcggcgaa cgcggcgaaccgggcaaaggcgaacgcggcgcgccggmcgaaaaaggcgaaggcggcccg cgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccgcgcggcgaacgcggc。
[0012] An aspect of the present application is to provide a vector comprising a nucleic acid molecule as shown in SEQ ID NO. 2.
[0013] An aspect of the present application is to provide an engineered bacterium comprising the above-mentioned vector. Preferably, the engineered bacterium is Escherichia coli.
[0014] An aspect of the present application is to provide a method for preparing a recombinant triple helix collagen with high temperature stability and self-assembly, in particular: (1) synthesizing a gene fragment according to the nucleotide sequence shown in Seq ID NO. 2, and inserting the synthesized gene fragment into the restriction sites Nco I and Xho I on the pET32a plasmid through T4 ligase overnight to obtain a recombinant plasmid; (2) mixing the recombinant plasmid with DH5α competent cells, performing electroporation, adding sorbitol solution, mixing, transferring to a sterile EP tube, incubating at 37℃ for 1h, coating on ampicillin sodium-LB solid plates, and then incubating at 37℃ for 24h until single colonies are formed, picking single colonies for colony PCR to verify the correctness of positive clones, and successfully constructing a recombinant prokaryotic expression vector; (3) picking the plasmid vector correctly expressed in the colony, transforming into E. coli BL21, using ampicillin sodium-LB solid plate to select single colony, adding 5ml LB medium to culture overnight, according to the volume ratio of bacteria liquid to LB medium as 1:100 to transfer, culturing in a shaking flask at 37℃ until OD600 is between 0.4-0.6, adding IPTG according to the volume ratio of IPTG to LB medium as 1:5000, culturing at 20℃ for 8-12 hours, centrifuging to collect the bacterial body, and storing for the next step of purification; (4) washing the precipitate with PBS buffer, resuspending the precipitate with 20-40ml volume, lysing the bacteria with lysozyme and Triton-X, and performing ultrasonic wave to break the bacteria in an ice water mixed environment, 2s ultrasonic wave, 5s interval, ultrasonic wave for 20min, centrifuging at 12000r / min for 20min, and collecting the supernatant; (5) purifying the induced supernatant through cation exchange chromatography column, eluting and collecting the protein corresponding to the elution peak, so as to obtain the recombinant triple helical collagen protein with a purity of 98%.
[0015] Another aspect of the present application is to provide a high-temperature stable and self-assembled recombinant triple helical collagen protein, wherein the high-temperature stable and self-assembled recombinant triple helical collagen protein of the present application has the ability of low-temperature self-assembly into glue.
[0016] Another aspect of the present application is to provide a high-temperature stable and self-assembled recombinant triple helical collagen protein, wherein the high-temperature stable and self-assembled recombinant triple helical collagen protein of the present application has high-temperature resistance stability.
[0017] Another aspect of the present application is to provide the application of a high-temperature stable and self-assembled recombinant triple helical collagen protein, preferably, the application is used for preparing a biological material for promoting skin repair and skin anti-wrinkle.
[0018] The beneficial technical effects of the present application are: The recombinant triple helical collagen protein is prepared by constructing a prokaryotic expression system of the nucleic acid coding the recombinant triple helical collagen protein through genetic engineering technology. The recombinant triple helical collagen protein prepared by the present application has low-temperature self-assembly and high-temperature resistance stability, and can enter the human epidermis and dermal tissue in a short time, and can be effectively applied to skin repair and skin anti-wrinkle. BRIEF DESCRIPTION OF DRAWINGS
[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creating laborious work.
[0020] Figure 1 Low temperature self-assembly of recombinant triple-helical collagen into a gel; Figure 2 Circular dichroism spectra of recombinant triple-helical collagen at different temperatures; Figure 3 Mouse skin fibroblast proliferation experiment chart; Figure 4 Laminin protein WB chart; Figure 5 Human Raman transdermal experiment chart; Figure 6 Human anti-wrinkle experiment effect chart. DETAILED DESCRIPTION
[0021] The following detailed description of embodiments of the application provided in the accompanying drawings is not intended to limit the scope of the application as claimed, but merely represents selected embodiments of the application. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application.
[0022] Example 1: Preparation of recombinant triple-helical collagen According to the nucleotide sequence shown in Seq ID NO. 2, a gene fragment is synthesized, and the synthesized gene fragment is connected by T4 ligase overnight, inserted into the restriction sites Nco I and Xho I on the pET32a plasmid, and a recombinant plasmid is obtained; The recombinant plasmid is mixed with DH5α competent cells, subjected to electroporation, and then sorbitol solution is added. After mixing, it is transferred to a sterile EP tube, incubated at 37°C for 1 h, then plated on ampicillin sodium-LB solid plates, and then incubated at 37°C for 24 h until single colonies are formed. Single colonies are picked for colony PCR to verify the correctness of positive clones, and a recombinant prokaryotic expression vector is successfully constructed; The plasmid vector correctly expressed in the colony is transformed into E. coli BL21, and single colony clones are selected on ampicillin sodium-LB solid plates. 5 ml of LB medium is added and incubated overnight. The volume ratio of bacterial solution to LB medium is 1:100 for transfer. The culture is incubated at 37°C in a shaking flask until the OD600 is 0.6. IPTG is added at a volume ratio of 1:5000, and the culture is incubated at 20°C for 12 hours. The bacterial cells are collected by centrifugation and stored for the next step of purification; The precipitate was washed with PBS buffer, resuspended with 30 ml volume, lysed with lysozyme in combination with Triton-X, and then ultrasonically broken in an ice-water mixed environment for 20 min with 2 s ultrasonication and 5 s interval. The supernatant was collected by centrifugation at 12000 r / min for 20 min. The induction supernatant was purified by cation exchange chromatography column, eluted, and the protein corresponding to the elution peak was collected, thereby obtaining recombinant triple-helical collagen protein with a purity of 98%.
[0023] Example 2: Low-temperature self-assembly characteristics of recombinant triple-helical collagen protein The recombinant triple-helical collagen protein prepared in Example 1 was stored at 4°C, and its gel formation was observed with the naked eye.
[0024] The results showed that the prepared recombinant triple-helical collagen protein had the characteristics of low-temperature self-assembly into a gel Figure 1 ).
[0025] Example 3: High-temperature stability experiment of low-temperature self-assembled recombinant triple-helical collagen protein The recombinant triple-helical collagen protein obtained in Example 1 was freeze-dried, a certain amount of freeze-dried powder was weighed, dissolved in a certain volume of deionized water, and prepared into a solution with a final concentration of 10 μM. The solution was placed in a microcuvette with a thickness of 1 mm to investigate the effect of temperature on the conformation of the recombinant triple-helical collagen protein. When the set temperature was reached and stabilized, the recombinant triple-helical collagen protein was incubated for 10-15 min, and circular dichroism spectrum measurement was performed with a scanning wavelength range of 190-260 nm and an interval of 1 nm.
[0026] The conformational changes of the recombinant triple-helical collagen protein at different temperatures were studied by circular dichroism analysis. The results showed that the recombinant triple-helical collagen protein had a strong absorption peak between 190-200 nm and had strong high-temperature stability Figure 2 ).
[0027] Example 4: In vitro experiment of high-temperature stable and self-assembled recombinant triple-helical collagen protein promoting skin fibroblast proliferation The mouse skin fibroblasts were selected and cultured in complete medium at 37°C in 5% carbon dioxide. The cell concentration was adjusted to 1.0×10 5 cells / ml-5.0×10 5 cells / ml, and used after 24-36 h of subculture. The culture solution in the culture bottle was discarded, and the cells were digested and collected, and the complete cell culture solution was prepared to 5.0×10 5 cells / ml-8.0×10 5The cells were suspended in PBS buffer at a concentration of 1.5 x 105cells / ml and inoculated into 96-well cell culture plates at 100 μL per well, and incubated at 37°C in 5% carbon dioxide; 24 h later, the PBS buffer was replaced with fresh PBS buffer, and the cells were incubated at 37°C in 5% carbon dioxide for 24 h; the prepared cell culture plates were discarded, and 0.05 mg / ml of the standard (animal-derived collagen type III commercially available) and 0.05 mg / ml of the recombinant triple-helical collagen protein of Example 1 were added to each well, and the negative control was added with PBS, at 100 μL per well, and incubated at 37°C in 5% carbon dioxide for 64-72 h; 20 μL of MTT solution was added to each well, and incubated at 37°C in 5% carbon dioxide for 6 h. The above operations were performed under sterile conditions. After the liquid in the culture plates was discarded, 100 μL of DMSO was added to each well, mixed, and the absorbance was measured at a wavelength of 570 nm with 630 nm as the reference wavelength on a microplate reader, and the results were recorded.
[0028] The results show that the high-temperature stable and self-assembled recombinant triple-helical collagen protein of the present application has a significant effect of promoting the proliferation of skin fibroblasts compared with the standard (Table 1, Figure 3 ).
[0029] Table 1: Experimental results of promoting the proliferation of mouse skin fibroblasts
[0030] Example 5: Anti-wrinkle experiment of high-temperature stable and self-assembled recombinant triple-helical collagen protein in animals (1) Construct a photo-aged mouse model: 6-week-old SPF ICR mice were divided into a blank group, a standard group, and an experimental group. After the hair on the back of the ICR mice was shaved, the skin was induced to age by using an ultraviolet irradiation lamp for continuous treatment for 8 weeks.
[0031] (2) After 8 weeks, the blank group was not treated, the standard group was applied with 0.05 mg / ml of the standard (animal-derived collagen type III commercially available) on the irradiated site, and the experimental group was applied with 0.05 mg / ml of the recombinant triple-helical collagen protein of Example 1 on the irradiated site. The application was performed once a day for 8 weeks.
[0032] (3) The skin condition of the irradiated site was observed regularly, and the back skin tissue of the mice was collected for detection of the Laminin protein content by the WB method.
[0033] The results show that the skin of the mice in the standard group and the experimental group is bright, has few wrinkles and has a certain elasticity. The skin of the mice in the blank group is seriously photoaged, is dry and loose, has many wrinkles and produces melanin deposition. The WB experiment shows that the expression amount of Laminin protein in the experimental group is slightly higher than that in the standard group, and the expression amount of Laminin protein in the experimental group and the standard group is significantly higher than that in the blank group, which shows that the high-temperature stable and self-assembled recombinant triple-helix collagen protein has good skin repair and anti-wrinkle effect. Figure 4 .
[0034] Effect example: human body related experiment of high-temperature stable and self-assembled recombinant triple-helix collagen protein
[0035] A suitable subject is selected, and the subject has good skin condition and does not use other drugs or cosmetics that affect the test results.
[0036] (1) The penetration rate of the high-temperature stable and self-assembled recombinant triple-helix collagen protein of the application to the skin is verified by human Raman transdermal experiment. The subject applies 0.1 mg / ml of the high-temperature stable and self-assembled recombinant triple-helix collagen protein of the application, and scans the skin using a confocal Raman spectrometer at 0, 0.5, 2, 3, 4, 6, 8 and 12 h, and records the Raman spectrum signal. The results show that the relative penetration rate of the high-temperature stable and self-assembled recombinant triple-helix collagen protein of the application is 0%, 0.21%, 0.95%, 2.38%, 2.76%, 4.18%, 6.03% and 7.20% at corresponding 0, 0.5, 2, 3, 4, 6, 8 and 12 h, respectively, and the collagen protein enters the epidermis layer at 3 h and enters the dermis layer at 4 h. Figure 5 .
[0037] (2) The test is carried out by using T / ZHCA 006-2019 'Cosmetic Anti-wrinkle Effect Test Method', the eye wrinkle condition of the subject before using the collagen protein of the application is recorded, the subject applies 0.1 mg / ml of the high-temperature stable and self-assembled recombinant triple-helix collagen protein of the application once a day, and the eye wrinkle condition is observed after continuously applying for 4 weeks. The results show that the high-temperature stable and self-assembled recombinant triple-helix collagen protein of the application has obvious anti-wrinkle effect after 4 weeks of application. Figure 6 .
[0038] The above description is only optional embodiments of the application, and does not limit the patent scope of the application, and any equivalent structural transformation made according to the application concept, or direct / indirect application in other related technical fields is included in the patent protection scope of the application.
Claims
1. A recombinant triple-helical collagen protein that is stable at high temperatures and self-assembles, characterized in that, The high-temperature stable and self-assembled recombinant triple-helical collagen protein comprises: (1) an amino acid sequence as shown in SEQ ID NO. 1; (2) an amino acid sequence having more than 90% sequence identity with the amino acid sequence shown in SEQ ID NO. 1, and retaining the same biological function as the amino acid sequence shown in SEQ ID NO. 1; (3) an amino acid sequence with one or more amino acid residues added, substituted, deleted or inserted in the amino acid sequence shown in SEQ ID NO. 1, and retaining the same biological function as the amino acid sequence shown in SEQ ID NO.
1.
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the high-temperature stable and self-assembled recombinant triple-helical collagen protein of claim 1.
3. The nucleic acid molecule of claim 2, wherein, The sequence of the nucleic acid molecule is as shown in SEQ ID NO.
2.
4. A vector, characterized by, The vector comprises the nucleic acid molecule of claim 2 or 3.
5. An engineered bacterium, characterized in that, The engineered bacteria comprise the nucleic acid molecule of claim 2 or 3 or the vector of claim 4.
6. The engineered bacterium of claim 5, wherein, The engineered bacteria are Escherichia coli.
7. A method of preparing a high temperature stable and self-assembling recombinant triple helical collagen protein according to claim 1, characterized by, The recombinant triple-helical collagen protein is obtained by introducing the nucleic acid as shown in SEQ ID NO. 2 into a plasmid, transforming the plasmid into Escherichia coli, culturing the Escherichia coli, inducing expression, and then isolating and purifying.
8. Use of the high-temperature stable and self-assembled recombinant triple-helical collagen protein of claim 1 in the preparation of a biological material for skin repair and anti-wrinkle.
Citation Information
Patent Citations
Triple-helix recombinant humanized III-type collagen, preparation method and application
CN115521372A
Triple-helix collagen with thermal stability as well as preparation method and application of triple-helix collagen
CN117903292A
Recombinant (X VII) type collagen with triple helix structure and application of recombinant (X VII) type collagen
CN117964740A
Recombinant (X VII) type collagen with triple helix structure and application of recombinant (X VII) type collagen
CN118240066A
Recombinant humanized III-type collagen with triple helix structure and application of recombinant humanized III-type collagen
CN118255871A