Debaryomyces nepalensis, microbial agent and application of debaryomyces nepalensis and microbial agent
By co-fermenting Nepalese Debali yeast with low-grade extracts, the problem of insufficient quality of low-grade extracts in the tobacco industry has been solved, improving the aroma quality and sensory experience of extracts and cigarettes, and realizing the development of specialty tobacco extracts and product formula upgrades.
Patent Information
- Application Number
- CN202511466055.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-14
- Publication Date
- 2025-12-12
AI Technical Summary
In the tobacco industry, low-grade tobacco extracts, due to their complex composition, insufficient sensory quality, and poor stability, are unable to meet the demands of mid-to-high-end tobacco products for consistent aroma components and a superior sensory experience.
The aroma quality of the extract was improved by co-fermentation of low-grade extract with Debaryomyces nepalensis H1. Tobacco extract was prepared by inoculating low-grade extract with Debaryomyces nepalensis H1 and adding it to cigarette products, which significantly improved the sensory evaluation results of cigarettes.
It significantly improves the aroma quality of low-grade extracts and the sensory evaluation results of cigarettes, enhances the aroma quality of extracts, and meets the needs of mid-to-high-end tobacco products.
Smart Images

Figure FT_1 
Figure FT_2 
Figure SMS_1
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of tobacco, in particular to Debaryomyces nepalensis, microbial inoculant and application thereof. BACKGROUND
[0002] In the tobacco industry, the low-grade cut filler is generally in a low-quality dilemma due to its complex components, insufficient sensory quality and poor stability, which is difficult to meet the stringent requirements of high-end tobacco products on aroma consistency and high-quality sensory experience. At the same time, with the vigorous development of global bio-manufacturing industry, bio-aroma technology is increasingly becoming a key direction and strategic highland for future development in this field due to its high efficiency, precision and environmental friendliness in synthesizing complex natural aroma substances. Tobacco-derived microbial resources are important strategic biological resources for the country and industry, an important breakthrough for biotechnological innovation, and an inexhaustible driving force for the high-quality development of bio-manufacturing industry and bio-economy. The co-fermentation technology of aroma-producing microorganisms and low-grade cut filler is conducive to improving the quality of low-grade cut filler, developing characteristic cut filler, enhancing the value of cut filler, upgrading product formula, and accelerating the innovation and industrialization of bio-aroma technology. SUMMARY
[0003] Therefore, the present application provides Debaryomyces nepalensis, microbial inoculant and application thereof. The Debaryomyces nepalensis H1 provided by the present application can effectively improve the aroma quality of low-grade cut filler after co-fermentation with low-grade cut filler. The fermentation broth after co-fermentation can significantly improve the sensory evaluation results of cigarettes when added into cigarette products. The Debaryomyces nepalensis H1 has great application potential in developing characteristic cut filler, improving quality and value, upgrading product formula, and accelerating the innovation and industrialization of bio-aroma technology.
[0004] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0005] The present application provides Debaryomyces nepalensis, which has a preservation number of CGMCC No.34871.
[0006] The present application also provides a microbial inoculant, which comprises the above-mentioned Debaryomyces nepalensis.
[0007] The present application also provides a preparation method of the microbial inoculant, which inoculates and cultures the Debaryomyces nepalensis to obtain the microbial inoculant.
[0008] The application further provides use of the above-mentioned Debaryomyces nepalensis, the above-mentioned microbial inoculum and / or the microbial inoculum obtained by the above-mentioned preparation method in preparation of a tobacco extract.
[0009] The application further provides use of the above-mentioned Debaryomyces nepalensis, the above-mentioned microbial inoculum and / or the microbial inoculum obtained by the above-mentioned preparation method in improving the quality of a low-grade tobacco extract.
[0010] In some embodiments of the application in the above-mentioned use, the Debaryomyces nepalensis, the microbial inoculum and / or the microbial inoculum obtained by the above-mentioned preparation method improve the aroma quality of the low-grade tobacco extract.
[0011] The application further provides a preparation method of a tobacco extract, inoculating the above-mentioned Debaryomyces nepalensis, the above-mentioned microbial inoculum and / or the microbial inoculum obtained by the above-mentioned preparation method to obtain the tobacco extract.
[0012] In some embodiments of the above-mentioned preparation method, the viable cell count when inoculating is 1.0×10 9 CFU / mL, and the inoculation amount is 1%.
[0013] The application further provides the tobacco extract obtained by the above-mentioned preparation method.
[0014] The application further provides use of the above-mentioned tobacco extract in preparation of a cigarette.
[0015] In some embodiments of the present application, the sequence of SEQ ID NO: 1 is: GCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGCCTTCGGTGTCCGAGTTGTAATTTGAAGAAGGTAACTTTGGAGTTGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGCCCAATTCTATGTAAAGTGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCGATCCTTTCCTTCTTGGTTGGGTTCTCCGCAGCTTACTGGGCCAGCATCGGTTTGGATGGTAGGATAATGATTAAGGAATGTGGCTCTACTTCGGTGGAGTGTTATAGCCTTGGTTGATACTGCCTGTCTAGACCGAGGACTGCGTCTTTGACTAGGATGCTGGCATAATGATCTTAAGCCACCCGTCTTG.
[0016] The above-mentioned Saccharomyces debayii of Nepal provided by the present application is obtained by a directional screening method, and after co-fermentation with low-grade extract, the Saccharomyces debayii can effectively improve the aroma quality of the low-grade extract. The fermentation liquor after co-fermentation is added into a cigarette product, and it is verified that the fermentation liquor can significantly improve the sensory evaluation and smoking results of the cigarette. BRIEF DESCRIPTION OF DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below.
[0018] Figure 1 Colony picture (left) and microscopic picture (right) of H1 yeast strain are shown;
[0019] Figure 2 Phylogenetic tree of H1 is shown.
[0020] BIOLOGICAL PRESERVATION
[0021] Biological material: H1; classification name: Debaryomyces nepalensis; preserved on June 12, 2025 at the China General Microbiological Culture Collection Center; address: No. 1, Yihuangyuan 3rd, Beijing Chaoyang District, Institute of Microbiology, Chinese Academy of Sciences; preservation number: CGMCC No. 34871. DETAILED DESCRIPTION
[0022] The present application discloses Debaryomyces nepalensis, microbial inoculant and application thereof.
[0023] It should be understood that the expression "one or more of the items recited following this expression" includes each individual item recited after the expression as well as various combinations of two or more of the items recited following the expression, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.
[0024] The terms "comprising", "having", or "including", including their grammatical variations, are generally understood to be open-ended and non-limiting, for example, not excluding additional unrecited elements or steps, unless otherwise specifically stated or understood from the context.
[0025] It should be understood that the order of steps or order for performing certain actions is immaterial so long as the application remains operable. Moreover, two or more steps or actions can be conducted simultaneously.
[0026] The use of any and all examples, or exemplary language herein, for example, "for instance" or "such as", is intended merely to better illustrate the application and does not indicate that any non-recited item is essential to the practice of the application unless claim language states otherwise. No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the application.
[0027] Further, the numerical ranges and parameters setting forth the broadest scope of the application are approximations, and are only used to convey generally understood precision. Numerical parameters are only approximations of numerical values in the specific examples described herein. Any numerical value, however, inherently contains certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Therefore, unless otherwise specified, all ranges disclosed herein are to be understood to be approximations, and the stated ranges should be construed to include the endpoints and all the values between the endpoints. Herein, "about" or "approximately" shall generally mean within 10%, 5%, 1%, or 0.5% of a given value or range.
[0028] The application provides a Debaryomyces nepalensis, named Debaryomyces nepalensis H1, with a preservation number of CGMCC No.34871.
[0029] The Debaryomyces nepalensis H1 is obtained by isolation and screening from cigar tobacco leaves, is classified as Debaryomyces nepalensis H1, and has been preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 12, 2025, with a preservation number of CGMCC No.34871 and a preservation address of No.3, Beichen Road, HuaYu District, Beijing. The H1 strain can effectively improve the aroma quality of low-grade extract after co-fermentation with the low-grade extract. The fermentation liquid after co-fermentation can be added into a cigarette product to verify that the cigarette can be significantly improved in sensory evaluation and smoking results.
[0030] The application also provides a microbial preparation containing the Debaryomyces nepalensis, preferably, the concentration of the Debaryomyces nepalensis is about 1.0x10 9 CFU / mL. The dosage form of the microbial preparation is a liquid preparation.
[0031] The application also provides a production method of the microbial preparation, which comprises culturing the Debaryomyces nepalensis at a temperature of 28 DEG C for 18 hours. The stirring speed of the Debaryomyces nepalensis during the culturing process is preferably 160 rpm to accelerate the growth of the yeast to obtain a seed liquid. The OD 600 value of the seed liquid is measured by a UV spectrophotometer, the seed liquid is diluted to an OD 600 value of 1, and the concentration of the microbial preparation is about 1x10 9 CFU / mL.
[0032] Further, the culture medium used for culturing the Debaryomyces nepalensis is preferably a YPD liquid medium, which comprises, in terms of mass percentage, 1% of yeast extract, 2% of peptone and 2% of glucose.
[0033] The application also provides an application of the Debaryomyces nepalensis or the microbial preparation in improving the quality of low-grade extract for cigarettes. The application is that the Debaryomyces nepalensis or the microbial preparation can effectively improve the aroma quality of low-grade extract after co-fermentation with the low-grade extract, and the fermentation liquid can be added into a cigarette product to verify that the cigarette can be significantly improved in sensory evaluation and smoking results.
[0034] The application comprises the following steps: inoculating the Nepalese Debaryomyces strain or microbial preparation into an extract fermentation medium, and then fermenting for 48 hours; and then using the fermentation supernatant to evaluate the aroma-producing effect and the application effect of the fermented supernatant in cigarette flavoring through HS-SPME-GC-MS.
[0035] Preferably, the fermentation culture condition is 28 DEG C and 180 rpm.
[0036] Preferably, the microbial preparation is a liquid preparation, the liquid microbial preparation is inoculated into the fermentation medium, the fermentation medium without the microbial preparation is used as a control, the concentration of the liquid microbial preparation is 1.0 x 10 9 CFU / mL, and the inoculation amount is 1%.
[0037] Preferably, the fermentation supernatant is obtained by centrifugation at 8000 rpm for 10 min.
[0038] The YPD solid culture medium is prepared according to the following proportion: 10 g / L of yeast extract, 20 g / L of peptone, 20 g / L of glucose and 15 g / L of agar, and sterilized at 115 DEG C for 30 min.
[0039] The YPD liquid culture medium is prepared according to the following proportion: 10 g / L of yeast extract, 20 g / L of peptone and 20 g / L of glucose, and sterilized at 115 DEG C for 30 min.
[0040] The low-grade tobacco extract for cigarettes is obtained from Jilin Tobacco Industry Co., Ltd.
[0041] The cigar tobacco leaf is obtained from Zhengzhou Tobacco Research Institute of China Tobacco Corporation.
[0042] In the examples 1 to 3 of the present application, the raw materials and reagents can be purchased from the market.
[0043] The present application is further described below in combination with examples:
[0044] Example 1: Screening of aroma-producing yeast and evaluation of aroma-producing effect
[0045] 5.0 g of the cigar tobacco leaf is added into 45 mL of sterile PBS buffer, and then oscillated at 28 DEG C and 180 rpm for 30 min, and then left to stand at room temperature for 1 min to obtain a bacterial suspension stock solution. The bacterial suspension stock solution is diluted by 10 times in turn to obtain bacterial suspensions with dilutions of 10 -1 、10 -2The yeast strain to be identified was inoculated into YPD liquid medium and cultured at 28°C and 160 rpm to obtain a seed liquid. The seed liquid of the strain to be screened was coated on YPD solid medium to obtain the aroma-producing yeast strains H1, H5, H23, H52 and H82.
[0046] To evaluate the aroma-producing effect of the above five aroma-producing yeast strains after co-fermentation with low-grade extract, the yeast strain H1, H5, H23, H52 and H82 was inoculated into low-grade extract and fermented for 48 h. The supernatant after fermentation was determined for volatile aroma components by headspace solid-phase microextraction gas chromatography-mass spectrometry (HS-SPME-GC-MS) technology. The aroma-enhancing effect of H1, H5, H23, H52 and H82 on low-grade extract after fermentation was tested.
[0047] Specifically, the yeast strains H1, H5, H23, H52 and H82 were activated on YPD solid medium and placed in a 28°C, 75% humidity incubator. After single colonies were cultured, the single colonies were inoculated into YPD liquid medium and cultured at 28°C and 160 rpm for 18 h to obtain a seed liquid. The OD 600 value of the seed liquid was determined by ultraviolet spectrophotometry, and the seed liquid was diluted to OD 600 =1, and the concentration of the bacterial suspension was about 1×10 9 CFU / mL. The bacterial suspension was inoculated into extract fermentation medium (extract: water = 1:10) at a 1% inoculation amount, and fermented at 28°C and 180 rpm. After 48 h of fermentation, the supernatant was obtained after centrifugation (8000 rpm for 10 min) to remove bacteria. The volatile aroma components were determined by HS-SPME-GC-MS. The control group was inoculated with sterile water, and the other conditions were the same as those of the experimental group.
[0048] HS-SPME-GC-MS analysis: 5 mL of fermentation liquid was taken into a 20 mL headspace bottle, and the extraction head was inserted into the bottle. The SPME fiber coated with 50 / 30 μm DVB / CAR / PDMS was used to extract the headspace at 80°C for 30 min. After extraction, the extraction head was inserted into the GC-MS system inlet, and desorption was performed for 5 min.
[0049] GC conditions: Column: HP-INNOWAX (30 m x 0.25 mm, 0.25 μm); temperature program: initial temperature 40 °C, hold for 3 min, increase to 180 °C at a rate of 10 °C / min, hold for 0 min, then increase to 260 °C at a rate of 4 °C / min; carrier gas He; flow rate 1 mL / min; injection port temperature 260 °C; splitless mode; desorption time 5 min.
[0050] MS conditions: Electron impact ion source (EI), electron energy 70 ev, ion source temperature 230 °C, quadrupole temperature 150 °C, full scan mode, scan mass range 30-600 amμ.
[0051] After determination, the differences in aroma components between the experimental group and the control group were compared by peak area normalization method, and the aroma-producing effects of H1, H5, H23, H52 and H82 strains on low-grade extract after fermentation were analyzed and compared.
[0052] The aroma component determination results are shown in Table 1.
[0053] Table 1 Aroma component determination results of low-grade extract after fermentation by aroma-producing yeast
[0054]
[0055] Note: CK represents the relative content of aroma components in the control group fermentation broth; H1, H5, H23, H52 and H82 represent the relative content of aroma components in the fermentation broth of different treatment groups.
[0056] As can be seen from Table 1, after fermentation of the extract added with H1, the total relative content of aroma substances increased the most, which was 2.45 times that of the control group, and the aroma-producing capacity was significantly improved by 145.43% compared with the control group. The total relative content of aroma substances in the fermentation broth after fermentation by H5, H52 and H82 yeast strains was 1.10 times, 1.365 times and 1.415 times that of the control group, respectively. The total relative content of aroma substances in the fermentation broth after fermentation by H23 yeast strain was lower than that of the control group, which was 0.56 times that of the control group. Therefore, the fermentation aroma-producing effect of H1 strain on low-grade extract was the best.
[0057] Further analysis of the changes in aroma components after low-level extract fermentation by strain H1 revealed five new aroma compounds: two alcohols, two olefins, and one ketone. Compared with the control group, the treatment group showed a significant increase in the relative content of eight aroma compounds, including four ketones (solanone, damascene, 4,7,9-megastigmatrien-3-one, and α-cyperone), two heterocyclic compounds (2-acetylfuran and 2-acetylpyrrole), one aldehyde, and one alcohol (benzaldehyde and phenethyl alcohol). Flavor analysis showed that damascene and phenethyl alcohol, with significantly increased relative content, had a rose aroma; benzaldehyde, 2-acetylfuran, and 2-acetylpyrrole had nutty aromas such as almond and walnut; α-cyperone exhibited an aromatic scent; 4,7,9-megastigmatrien-3-one had a sweet tobacco aroma; and solanone had a fresh carrot-like aroma, which could enhance the tobacco aroma and make the smoke fuller, smoother, and more delicate. Therefore, it can be seen that the H1 yeast strain provided in this embodiment, after co-fermentation with low-grade extract, can significantly increase the relative content of aroma substances in low-grade extract, and enhance the floral, fruity and nutty aroma flavors in the extract. Thus, the H1 yeast strain can increase the relative content of aroma substances in the extract and has a significant effect on improving the aroma quality of the extract.
[0058] Example 2: Evaluation of the effect of aroma-producing yeast in adding flavoring to cigarettes after fermentation of low-level extracts
[0059] The fermentation broth was prepared in the same manner as in Example 1. After centrifugation to remove bacteria (8000 rpm, 10 min), the application effects of yeast strains H1, H5, H23, H52, and H82 after fermentation of low-level extracts were evaluated by sensory analysis.
[0060] Specifically, the sterilized fermentation broth from both the treatment and control groups was evenly sprayed onto cigarette tobacco and placed in an environment with a temperature of (22±1)℃ and a relative humidity of (60±2)% for 48 hours to allow the moisture content of the tobacco to reach (12.5±0.5)%, and then cigarettes were produced. Sensory evaluation of the cigarettes was conducted according to the YC / T 415-2011 "Sensory Evaluation Method for Tobacco Products" standard, selecting eight indicators: aroma quality, aroma quantity, permeability, off-flavors, concentration, fineness, irritation, and cleanliness.
[0061] Table 2. Quantitative description of individual sensory evaluation indicators using a 9-point scoring system.
[0062]
[0063] The results are shown in Table 3.
[0064] Table 3. Sensory results of aroma-producing yeast fermentation extract after cigarette flavoring.
[0065]
[0066] Note: CK represents the sensory evaluation score of the control group without adding the strain; H1, H5, H23, H52, H82 represent the sensory evaluation score of the fermentation liquid of different treatment groups.
[0067] From the comparison of the above sensory evaluation table, it can be seen that the treatment group after adding H1 yeast strain to ferment low-grade extract has the highest total sensory evaluation score, which increases from 40 to 55. Among them, the aroma quality, aroma amount, delicate degree and clean degree are significantly improved, and the offensive odor and irritation are significantly reduced. In addition, it is found in the sensory evaluation that the aroma style of the H1 fermentation liquid is flower and fruit aroma, which is consistent with the detection results of the aroma-producing substances in Example 1. In addition, after the low-grade extract is fermented by H5, H52 and H82 yeast strains, the total sensory evaluation score increases from 40 to 47, 48 and 51, respectively, and the evaluation score is slightly higher than that of the control group; after the low-grade extract is fermented by H23 yeast strain, the total sensory evaluation score decreases from 40 to 29, and the evaluation result is lower than that of the control group.
[0068] This result shows that the sensory evaluation result of the low-grade extract after adding H1 yeast strain for fermentation is significantly improved, and this yeast has great application potential in low-grade extract.
[0069] Example 3 Identification of H1 yeast strain
[0070] 1) Morphological identification
[0071] The yeast strain H1 with the best application effect in producing aroma and the best application effect in sensory evaluation was inoculated on YPD solid culture medium plate, and the colony morphology was observed after 2 d of culture at 28°C. As shown in Figure 1 , the colony of strain H1 is round and smooth, the colony is small, the whole is milky white, the colony edge is neat, and the surface is dry. Microscopic examination shows that the spores are round and the division is budding spores.
[0072] 2) Molecular biology identification
[0073] Yeast strain H1 was sent to Huada Biological for 26S sequencing, and the 26S nucleotide sequence of yeast strain H1 was measured as shown in SEQ ID No: 1. The sequencing result was submitted to NCBI database for comparison, and strain identification was performed. The identification result showed that the 26S sequence of strain H1 had 100% similarity with the 26S sequence of Debaryomyces nepalensis (MT333851.1), and the phylogenetic tree was constructed by MEGA 11.0 software, as shown in Figure 2 .
[0074] From the above, it can be seen that the 26S sequence of strain H1 is consistent with the 26S sequence of Debaryomyces nepalensis, and the phylogenetic tree is consistent with the phylogenetic tree of Debaryomyces nepalensis, which further proves that the strain H1 is Debaryomyces nepalensis. Figure 2It can be known that the yeast strain H1 belongs to the Debaryomyces nepalensis evolutionary branch. In combination with morphological characteristics and 26S sequence analysis, the yeast strain H1 is identified as Debaryomyces nepalensis, named as Debaryomyces nepalensis H1, and has been preserved in the China General Microbiological Culture Collection Center (CGMCC) on June 12, 2025, with a preservation number of CGMCC 34871 and a preservation address of No. 1 Beichen Road, Chaoyang District, Beijing.
[0075] Therefore, 5 strains of aroma-producing yeast strains are obtained by the directional screening method in the embodiments of the present application, and among them, the H1 strain has the best application effect: after the strain is co-fermented with low-grade extract, the aroma quality of the low-grade extract can be significantly improved, and after the cigarette is flavored, the H1 strain can also significantly improve the smoking result of the low-grade extract. It is identified that the H1 strain is Debaryomyces nepalensis. Therefore, the H1 strain can significantly improve the aroma quality of the low-grade extract in the fermentation process of the low-grade extract, thereby having a potential effect of improving the quality of the cigarette product in the application of the cigarette flavoring.
[0076] The above only describes the preferred embodiments of the present application, and it should be noted that for ordinary skilled persons in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as the protection scope of the present application.
Claims
1. Debaryomyces nepalensis characterized in that, The preservation number is CGMCC No. 34871.
2. Microbial inoculant characterized in that, It comprises: The Debaryomyces nepalensis according to claim 1.
3. The method for preparing the microbial inoculant as described in claim 2, characterized in that, Inoculating the Debaryomyces nepalensis to obtain the microbial inoculum.
4. The Debaryomyces nepalensis according to claim 1, the microbial inoculum according to claim 2 and / or the microbial inoculum obtained by the preparation method according to claim 3 are used for preparing the tobacco extract.
5. The Debaryomyces nepalensis according to claim 1, the microbial inoculum according to claim 2 and / or the microbial inoculum obtained by the preparation method according to claim 3 are used for improving the quality of the low-grade tobacco extract.
6. The use according to claim 5, wherein the compound is ###0002### The Debaryomyces nepalensis, the microbial inoculum and / or the microbial inoculum obtained by the preparation method improve the aroma quality of the low-grade tobacco extract.
7. A process for the preparation of a smoking extract, characterised in that, Inoculating the Debaryomyces nepalensis according to claim 1, the microbial inoculum according to claim 2 and / or the microbial inoculum obtained by the preparation method according to claim 3 to obtain the tobacco extract.
8. The production method according to claim 7, wherein The viable cell count at the time of inoculation was 1.0 x 10 9 CFU / mL, and the inoculum was 1%.
9. The tobacco extract obtained by the preparation method according to claim 7 or 8.
10. The tobacco extract according to claim 9 is used for preparing cigarettes.