Strain for producing L-lactic acid with high optical purity and application of strain

By modifying Bacillus coagulans through ultraviolet and plasma mutagenesis, a mutant strain JDKJ1.2406-2505 was screened to produce L-lactic acid efficiently. A three-stage fermentation technology was adopted to solve the problems of low lactic acid purity, low conversion rate and long cycle in the existing Bacillus coagulans production, and to achieve high-efficiency and low-cost production of high-purity L-lactic acid.

CN121109221APending Publication Date: 2025-12-12HENAN JINDAN LACTIC ACID TECH CO LTD
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202511359680.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-23
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

Existing methods of using Bacillus coagulans in L-lactic acid production suffer from problems such as low lactic acid purity, low sugar-acid conversion rate, and long fermentation cycle, leading to increased production costs and substandard purity.

Method used

Ultraviolet mutagenesis and ambient temperature and pressure plasma mutagenesis were used to improve Bacillus coagulans, and a mutant strain JDKJ1.2406-2505 with high efficiency in producing L-lactic acid was screened. The fermentation process was optimized by a three-stage fermentation technology, including liquid seed culture, fermentation culture and terminal extraction process.

Benefits of technology

It achieves high yield and high purity production of L-lactic acid with high optical purity, shortens the fermentation cycle, improves sugar-acid conversion rate, reduces production cost, and is suitable for industrial application.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention belongs to the technical field of microorganisms, and particularly relates to a strain for producing high-optical-purity L-lactic acid and application of the strain. The strain is preserved in the China General Microbiological Culture Collection Center (CGMCC) on May 13, 2025, and the preservation number of the strain is CGMCC No. 34537; the preservation address is Institute of Microbiology, Chinese Academy of Sciences, No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing. When the strain is used for fermentation production of L-lactic acid, the fermentation period is short, the sugar-acid conversion rate is high, the yield of L-lactic acid is high, and the optical purity is high. In addition, the strain also has excellent growth and metabolism stability, lactic acid with optical purity can still be efficiently produced after passage to the tenth generation, and the strain is suitable for industrial production of high-purity L-lactic acid.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of microbial technology, and particularly relates to a strain for producing L-lactic acid with high optical purity and application thereof. BACKGROUND

[0002] Lactic acid is an important industrial chemical, which is widely used in food, medicine, leather and textile industry. High-purity L-lactic acid can be polymerized to generate linear or cyclic poly-L-lactic acid (PLA), which is a non-toxic polymer compound and can be slowly decomposed into CO2 and H2O under natural conditions without causing white pollution. Therefore, PLA can be used to replace PP and PVC plastics for the production of container films, fibers and other products, forming a virtuous cycle of green and renewable resources. Meanwhile, PLA has biocompatibility and can be decomposed into L-lactic acid in vivo, thereby being metabolized by the human body without causing adverse reactions. Therefore, PLA can be used to manufacture sustained-release capsule preparations, biodegradable fibers, biological implants and the like. Due to its biocompatibility, degradability and non-toxicity, PLA can be recycled in the biosphere, and is a very ideal polymer material with broad application prospects in industry.

[0003] The production methods of lactic acid mainly include microbial fermentation method and chemical synthesis method. The microbial fermentation method has the advantages of low cost, high optical purity, easy operation, high safety and small pollution. However, the synthesis of PLA requires high-optical-purity L-lactic acid as a precursor. Most of the homofermentative lactic acid-producing strains have high lactic acid production capacity, but they are accompanied by the generation of D-lactic acid, and the optical purity of L-lactic acid cannot reach the polymerization grade. Meanwhile, during the fermentation process using the production strain, some other secondary metabolites except lactic acid are produced with the extension of the fermentation period, which affects the chemical purity of the fermentation end product. At this time, the downstream separation and purification steps must be added, which increases the production cost.

[0004] The existing reports on the strains for producing L-lactic acid include lactic acid bacteria (Lactobacillus sp.) (Liu et al., 2017), Rhizopus oryzae (Zhang et al., 2017), Bacillus sp. (Zhang et al., 2017), Escherichia coli (Zhang et al., 2017), Saccharomyces cerevisiae (Zhang et al., 2017), Corynebacterium glutamicum (Zhang et al., 2017) and the like. Lactobacillus Rhizopusoryzae Bacillus subtilis Escherichia coli Saccharomyces cerevisiae Corynebacterium glutamicum Bacillus coagulans Bacillus coagulans in thermophilic environment is a new strain that can be used for the fermentation production of L-lactic acid. The relatively high fermentation temperature of 40-60℃ greatly reduces the risk of contamination by other bacteria and the use amount of cooling water, and has good industrial production prospects in the production of L-lactic acid. However, studies have shown that the existing Bacillus coagulans strains for producing L-lactic acid have problems such as low lactic acid purity, low sugar-acid conversion rate and long fermentation period. ​​​​​​SUMMARY

[0005] To solve the above technical problems, the present application provides a strain for high optical purity L-lactic acid production and its application. The strain JDKJ1.2406-2505 can efficiently produce lactic acid, has a short fermentation period, high sugar-acid conversion rate, high yield and purity of L-lactic acid, and can be used for industrial production of high purity L-lactic acid.

[0006] To achieve the above-mentioned application purposes, the present application adopts the following technical solutions: The present application provides a strain of Bacillus coagulans JDKJ1.2406-2505 for high optical purity L-lactic acid production, which is classified as Bacillus coagulans (Bacillus coagulans) Bacillus coagulans ), and was preserved in the China General Microbiological Culture Collection Center on May 13, 2025, with the preservation number of CGMCC No. 34537 and the preservation address of No. 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing City, Chaoyang District, Beichen West Road 1st Courtyard 3rd.

[0007] The Bacillus coagulans JDKJ1.2406-2505 provided by the present application is a mutant strain obtained by directional artificial screening to improve the optical purity of L-lactic acid, using the Bacillus coagulans isolated and purified from industrial production fermentation broth as the starting strain, and through ultraviolet mutagenesis and normal temperature and pressure plasma mutagenesis. The mutant strain has the advantages of short fermentation period, high sugar-acid conversion rate and high optical purity of L-lactic acid in the fermentation production of L-lactic acid. In addition, the strain also has excellent growth and metabolic stability, and can still efficiently produce L-lactic acid with high optical purity after being passed to the 10th generation, which is suitable for industrial production of high purity L-lactic acid.

[0008] The present application provides the application of the above-mentioned Bacillus coagulans JDKJ1.2406-2505 in the fermentation production of L-lactic acid.

[0009] The present application provides a method for fermentation production of L-lactic acid by using the above-mentioned Bacillus coagulans JDKJ1.2406-2505, which specifically comprises the following steps: S1, the Bacillus coagulans JDKJ1.2406-2505 strain is expanded, and the strain is grown to the logarithmic growth phase, then the strain is fermented in the liquid seed culture medium to the late logarithmic growth phase, and then transferred to the liquid seed culture medium for expansion as a primary fermentation seed liquid; S2, the primary fermentation seed liquid is inoculated into a fermentation container containing liquid seed culture medium for fermentation to the late logarithmic growth phase as a secondary fermentation seed liquid; S3, inoculating the secondary fermentation seed liquid into the fermentation medium for fermentation culture, and taking the fermentation end point when the glucose concentration of the fermentation system is reduced to below 0.5%; and then separating and extracting L-lactic acid from the fermentation liquid obtained by fermentation, thereby obtaining the L-lactic acid.

[0010] Preferably, the components of the culture medium used in S1 for the propagation culture are: yeast powder 1%, peptone 0.5%, potassium phosphate dibasic 0.5%, ammonium sulfate 0.5%, magnesium sulfate 0.05%, manganese sulfate 0.1%, glucose 5%, calcium carbonate 20%, agar powder 2%, and the base is water.

[0011] Preferably, the components of the liquid seed culture medium in S1 and S2 are: yeast powder 1%, peptone 0.5%, potassium phosphate dibasic 0.5%, ammonium sulfate 0.5%, magnesium sulfate 0.05%, manganese sulfate 0.1%, glucose 16%, calcium carbonate 40%, and the solvent is water.

[0012] Preferably, the fermentation culture temperature in the liquid seed culture medium is 40-50°C. Further preferably, it is 48-50°C.

[0013] Preferably, the OD 620 of the strain in the late logarithmic growth phase in S1 is 1.5-1.7.

[0014] Illustratively, the strain is fermented and cultured in the liquid seed culture medium for 18-24 h to reach the late logarithmic growth phase of the strain.

[0015] Preferably, the judgment standard for the late logarithmic growth phase of the strain in S2 is that the OD 620 is 1.5-1.7, or the glucose concentration of the fermentation system is reduced to 5-8%.

[0016] Preferably, the components of the fermentation medium in S3 are: yeast powder 0.5-1%, potassium phosphate dibasic 0.5%, ammonium sulfate 0.5%, magnesium sulfate 0.05%, and glucose 22-23%, and the solvent is water. Preferably, the pH of the fermentation system is controlled to be 5.2-6.5 during the fermentation culture, and further preferably, it is 5.6-5.8.

[0017] Optionally, the pH regulator for controlling the pH includes but is not limited to one or more of calcium hydroxide, sodium bicarbonate, sodium carbonate, ammonia water, and calcium carbonate.

[0018] Preferably, the inoculation amount of the secondary fermentation seed liquid into the fermentation medium is 10-20%.

[0019] Preferably, the method for separating and extracting L-lactic acid from the fermentation broth obtained by fermentation is as follows: the fermentation broth is heated to 88-92 DEG C, then calcium oxide is added to adjust the pH to 10.5-11.0; filtration is performed, and the filtrate is concentrated to a calcium content of 42%-45% by weight, then dilute sulfuric acid is added for acidolysis, and after the acidolysis is completed (i.e., no free calcium ions are present in the solution), the solution is placed in an oven at 60-70 DEG C for 50-70 min; the solution is taken out and filtered, and the clear solution is obtained, then powdered activated carbon is added, and the solution is placed in an oven at 60-70 DEG C for 110-130 min, and then the solution is taken out and filtered; and the filtrate is deionized by passing through an anion-cation exchange column.

[0020] Further preferably, the concentration of the dilute sulfuric acid is 50% v / v.

[0021] Optionally, the determination method for the end point of acidolysis is as follows: after barium chloride is added, the solution is slightly turbid (indicating that there is excess sulfate), and after ammonium oxalate is added, the solution is not turbid.

[0022] Further preferably, the amount of the powdered activated carbon is 30 g / L.

[0023] The Bacillus coagulans JDKJ1.2406-2505 provided by the present application can produce high-purity L-lactic acid, and has a short fermentation cycle and a high sugar-acid conversion rate, and can be used for large-scale production of high-optical-purity L-lactic acid. The method for producing L-lactic acid by fermentation provided by the present application takes the Bacillus coagulans JDKJ1.2406-2505 as the core and adopts a three-stage fermentation technology, and the yield of L-lactic acid can reach 225.5 g / L; the optical purity of the L-lactic acid product can reach 99.91%, and the chemical purity can reach 98.1%, reaching the standard of polymerization-grade lactic acid and being able to be used as a raw material for PLA production; the filtration rate in the downstream processing of the fermentation broth is increased by 100% compared with the starting strain, the fermentation cycle is shortened by about 50% compared with the starting strain, the production efficiency is improved, and the sugar-acid conversion rate can reach 98.1%, improving the utilization rate of raw materials. The Bacillus coagulans JDKJ1.2406-2505 and the method for producing L-lactic acid by fermentation provided by the present application provide technical support for high-yield and high-purity lactic acid production. DETAILED DESCRIPTION

[0024] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and should not be used to limit the present application. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0025] The synthesis of PLA requires high-optical-purity L-lactic acid as a precursor. Most homofermentative lactic acid producing strains produce D-lactic acid during the production of L-lactic acid, and produce some other acid secondary metabolites with the extension of the fermentation cycle. The optical purity of L-lactic acid can be achieved by downstream separation and purification, which increases the production cost.

[0026] The present application provides a Bacillus coagulans JDKJ1.2406-2505 for producing high-optical-purity L-lactic acid. The mutant strain has the advantages of short fermentation cycle, high sugar-acid conversion rate and high optical purity of L-lactic acid. In addition, the strain also has excellent growth and metabolic stability, and can still produce high-optical-purity L-lactic acid after being passed to the 10th generation, which is suitable for industrial production of high-purity L-lactic acid.

[0027] The present application also provides the application of the above-mentioned Bacillus coagulans JDKJ1.2406-2505 in the fermentation production of L-lactic acid, and a method for producing L-lactic acid by fermentation using the above-mentioned Bacillus coagulans JDKJ1.2406-2505.

[0028] The scheme of the present application is described below through specific examples.

[0029] The components of the culture medium used in the following examples are as follows: Solid seed culture medium: yeast powder 1%, peptone 0.5%, potassium phosphate dibasic 0.5%, ammonium sulfate 0.5%, magnesium sulfate 0.05%, manganese sulfate 0.1%, glucose 5%, calcium carbonate 20%, agar powder 2%; Liquid seed culture medium: yeast powder 1%, peptone 0.5%, potassium phosphate dibasic 0.5%, ammonium sulfate 0.5%, magnesium sulfate 0.05%, manganese sulfate 0.1%, glucose 16%, calcium carbonate 40%; Fermentation medium one: yeast powder 1%, potassium phosphate dibasic 0.5%, ammonium sulfate 0.5%, magnesium sulfate 0.05%, glucose 22%; Fermentation medium two: yeast powder 0.5%, potassium phosphate dibasic 0.5%, ammonium sulfate 0.5%, magnesium sulfate 0.05%, glucose 23%.

[0030] The technical means used in the following examples are conventional means known to those skilled in the art unless otherwise specified; the materials, reagents and the like used in the following examples are obtained from commercial channels unless otherwise specified.

[0031] Example 1 The present application provides the obtaining process and identification results of the Bacillus coagulans JDKJ1.2406-2505 strain.

[0032] 1. Mutagenesis of lactic acid producing bacterial strains 1.1 Determination of optimal mutagenic conditions for UV mutagenesis JDJZ-01 was taken from the laboratory, eluted with sterilized 0.9% saline, and centrifuged at 5000 r / min for 2 min at 4°C, washed twice. Resuspend with 200 ml of liquid seed medium to prepare a bacterial suspension; dilute to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 times, perform plate (solid seed medium) coating to determine the dilution gradient of 10 7 CFU / ml. Take 10 μl of the bacterial suspension diluted to 10 7 CFU / ml, evenly coat the surface of a sterile slide, place the slide in a sterile petri dish, and irradiate the slide with a UV lamp in a dark room for mutagenesis. Set the sample irradiation treatment time to 30 s, 45 s, 60 s, 75 s, 90 s, 105 s, 120 s, 135 s, and 150 s, respectively. After mutagenesis, move the slide to 990 μl of sterile saline, shake for 10 min, then dilute and coat on a solid seed medium, incubate at 48-50°C for 48 h, count the colonies, calculate the treatment time with a mortality rate of 70-80%, and determine the optimal irradiation treatment time as 120 s.

[0033] 1.2 Determination of optimal mutagenic conditions for normal temperature and pressure plasma JDJZ-01 was taken from the laboratory, eluted with sterilized 0.9% saline, and diluted to 10 7 CFU / ml. Take 10 μl and evenly coat the surface of a sterile slide, place the slide on the sample stage of a normal temperature and pressure plasma mutagenesis instrument, and perform irradiation treatment. Set the sample irradiation treatment time to 30 s, 35 s, 40 s, 45 s, 50 s, 55 s, 60 s, 65 s, and 70 s, respectively. After mutagenesis, move the slide to 990 μl of sterile saline, shake for 10 min, then dilute and coat on a solid seed medium, incubate at 48-50°C for 48 h, count the colonies, calculate the treatment time with a mortality rate of 70-80%, and determine the optimal irradiation treatment time as 50 s.

[0034] 1.3 Mutagenesis of JDJZ-01 under optimal mutagenic conditions The laboratory preserved Bacillus coagulans JDJZ-01 was eluted with sterilized 0.9% normal saline, centrifuged at 5000 r / min for 2 min at 4°C, and washed twice. Resuspended with 200 ml of liquid seed medium to prepare a bacterial suspension, and diluted to 10 7 CFU / ml according to a gradient. Take 10 μl of the bacterial suspension diluted to 10 7 CFU / ml, evenly spread on the surface of sterilized slides, and place the slides in a sterile culture dish. Irradiate the slides with a UV lamp in a dark room for 120 s. After mutagenesis, move the slides to 990 μl of sterile normal saline, shake for 10 min, and dilute to 10 7 CFU / ml. Take 10 μl and evenly spread on the surface of sterilized slides, and place the slides on the sample stage of the atmospheric pressure plasma mutagenesis instrument for irradiation treatment for 50 s. After mutagenesis, move the slides to 990 μl of sterile normal saline, shake for 10 min, and obtain the bacterial suspension of the mutant strain.

[0035] 2. Screening of mutant strains with high lactic acid yield 2.1 Preliminary screening Screen the mutant strains: spread the mutant strains obtained in Section 1.3 on bromocresol green screening plates, and incubate at 48-50°C for 1-2 days. Select single colonies with larger color change rings, spread on slopes, and then elute the slopes with 100 ml of liquid seed medium. Place the obtained bacterial suspension in a 250 ml flask, and incubate at 48-50°C and 120 r / min for 18 h. Detect the OD 620 value and L-lactic acid content of the fermentation broth. Select the strain corresponding to the fermentation broth with higher OD 620 value and L-lactic acid content (numbered as JDKJ1.2406-2505), and store in a glycerol tube.

[0036] 2.2 Performance verification 2.2.1 Verify the fermentation performance and genetic stability of the mutant strain in a fermenter scale using fermentation medium Take the mutant strain JDKJ1.2406-2505 stored in a glycerol tube, and pick a ring with an inoculation needle. Draw a line on a solid seed medium plate, and incubate at 48-50°C for 48 h. Pick a single colony on the plate, and expand on a solid seed medium slope at 48-50°C. When the strain grows to the logarithmic growth phase, elute the bacterial lawn of the slope with 100 ml of liquid seed medium. Place the obtained bacterial suspension in a 250 ml flask, and incubate at 48-50°C and 120 r / min until the logarithmic growth phase. Take the bacterial suspension of the three parallel samples, and detect the OD 620After the inoculum was 1.5~1.7, it was transferred at a 10% inoculum volume to 400 ml of liquid seed culture medium and cultured in 1 L Erlenmeyer flasks at 48~50℃ and 120 r / min until the late logarithmic growth phase of the strain (OD of the bacterial suspension was measured in three parallel samples). 620 The culture medium was 1.5-1.7 μg / mL (all values ​​were 1.5-1.7 μg / mL) and used as the primary fermentation seed culture. This seed culture was then inoculated at a rate of 10% into a 10L fermenter containing 5.4L of liquid seed culture medium and cultured at 48-50℃ and 100 rpm until the late logarithmic growth phase of the strain was reached (OD values ​​of the bacterial suspension were measured in three parallel samples). 620 When the concentration is >1.5%, it is used as the seed culture for secondary fermentation. The seed culture is inoculated at a rate of 10% into a 50L fermenter containing 27L of fermentation medium. Fermentation is carried out at 48-50℃, and the pH of the fermentation system is controlled at 5.6-5.8 by adding ammonia water during fermentation. Fermentation is terminated when the glucose concentration is below 0.5%, and mature material is obtained.

[0037] Take the mature material after fermentation, heat it to 88-92℃, add calcium oxide to adjust the pH to 10.5-11.0; filter, take the clear liquid, heat and concentrate it to a calcium content of 42.5%wt, then pour it into a 5L beaker, slowly add 50%v / v dilute sulfuric acid for acid hydrolysis (the criteria for determining the endpoint of acid hydrolysis are: slight turbidity after adding barium chloride, and no turbidity after adding ammonium oxalate). After acid hydrolysis, place it in a 65℃ oven for 60min; remove and filter, take the clear liquid, add 30g / L powdered activated carbon, place it in a 65℃ oven for 120min (stirring 10s every 15min), remove and filter, pass the filtrate through an anion and cation exchange column to deionize, and concentrate it to a concentration of 82.5% L-lactic acid by mass (determined according to national standard GB1886.173-2016). Detect the yield, optical purity and chemical purity of L-lactic acid. The yield, optical purity, chemical purity, filtration rate, maturation period (i.e., the time required for the glucose concentration to be below 0.5% after the secondary fermentation seed liquid is inoculated into the fermenter), and sugar-acid conversion rate of L-lactic acid produced by the strains before and after mutagenesis are shown in Table 1.

[0038] Table 1

[0039] The secondary fermentation seed culture was transferred at an inoculum volume of 10% to a 10L fermenter containing 5.4L of liquid seed culture medium, and cultured again until the late logarithmic growth phase of the strain (OD of the bacterial suspension was measured in three parallel samples). 620 >1.5), inoculate 10% of the culture medium into fermentation medium 1, and ferment until the glucose concentration is below 0.5%. Repeat this step 10 times. The L-lactic acid yield, optical purity, chemical purity, filtration rate, maturation cycle, and sugar-acid conversion rate of the first, fifth, and tenth generation fermentation maturation tanks during subculturing are shown in Table 2.

[0040] Table 2

[0041] 2.2.2 The fermentation performance and genetic stability of the mutant strain on a fermenter scale were verified using fermentation medium. The preparation methods for the primary and secondary fermentation seed cultures are the same as in 2.2.1. The secondary fermentation seed culture was inoculated at a rate of 10% into a 50L fermenter containing 27L of fermentation medium II for maturation verification. Fermentation continued until the glucose concentration was below 0.5%. L-lactic acid was then isolated and extracted from the mature material according to the method in 2.2.1. The yield, optical purity, and chemical purity of L-lactic acid were detected and calculated. The yield, optical purity, chemical purity, filtration rate, maturation period, and sugar-acid conversion rate of the strains before and after mutagenesis are shown in Table 3.

[0042] Table 3

[0043] The secondary fermentation seed culture was then transferred at a 10% inoculum to a 10L fermenter containing 5.4L of seed culture medium, and cultured again until the late logarithmic growth phase of the strain (OD of the bacterial suspension was measured in three parallel samples). 620 >1.5), inoculate 10% of the culture medium into fermentation medium II, and repeat this step 10 times. The L-lactic acid yield, optical purity, chemical purity, filtration rate, maturation cycle, and sugar-acid conversion rate of the first, fifth, and tenth generation fermentation maturation tanks during subculturing are shown in Table 4.

[0044] Table 4

[0045] The results above show that the mutant strain JDKJ1.2406-2505 can produce high-purity L-lactic acid with high sugar conversion rate and good genetic stability.

[0046] 3. 16S rDNA sequence sequencing Design universal primers BcoF and BcoR for Bacillus coagulans to perform 16S rDNA sequencing.

[0047] BcoF: 5'-gatcattttcttccatggtatg-3'; BcoR: 5'-gaaacgatggcgctggatac-3'.

[0048] The 16S rDNA sequence (as shown in SEQ ID No. 1) is as follows: AATCATTGTGCGGCTGAATTGCTTTTGAAATGTATGCATGGAGCAGTTCAGCTTTAGCTTTTGCTGGTTGGAAAAAGTCACATAAAGGCCGTCCGCTGTGGCGCTAAAGTCTACCACATTCGCAAGGAAAATGAACTGGCAGTCATACGATTTCGGGGATTTTGTCGGCGTTGCAATCAAACCATCCCCCAACACAACCGGTGCCTTATTAAAGTTAAAAATTTGTTTTGTGCCTTTGAGAATGCCTTCAAAATCGCACATCCGGTAATGAATGCAAGCTTCCCGCAACAATTCAAGCTTGCTCTTCCGTGAGTGAAAAACGCCGTCCTGATCATAAATGATTGTCTGATATTCCGGGTCAAATGCGGTATCCAGCGCCATCGTT.

[0049] According to NCBI gene alignment, the mutant strain is Bacillus coagulans (Bacillus coagulans) and the gene similarity is greater than 99.5%. Bacillus coagulans

[0050] The Bacillus coagulans JDKJ1.2406-2505 is preserved in the China General Microbiological Culture Collection Center (address: No. 1, Beichen West Road, Yard 3, Institute of Microbiology, Chinese Academy of Sciences, Beijing, 100101), and the preservation number is CGMCC No. 34537.

[0051] Example 2 The present embodiment provides a method for producing high-purity L-lactic acid by using Bacillus coagulans JDKJ1.2406-2505 strain, and the specific operation is as follows: ​(1) Bacillus coagulans JDKJ1.2406-2505 strain is inoculated on a solid seed culture medium plate and cultured at 48-50°C for 48h. A single colony is picked and expanded on a solid seed culture medium slope at 48-50°C. When the strain grows to the logarithmic growth phase, the slope bacteria are eluted with 100ml of liquid seed culture medium in a 250ml flask, and cultured at 48-50°C and 120r / min for 18h. Then, the first-stage fermentation seed liquid is obtained by inoculating the liquid seed culture medium in a 1L flask at a 10% inoculation amount, culturing at 48-50°C and 120r / min for 18h. The second-stage fermentation seed liquid is obtained by inoculating the second-stage fermentation seed liquid in a 10L fermenter containing 5.4L of liquid seed culture medium at a 10% inoculation amount, culturing at 48-50°C and 100r / min, and culturing until the glucose concentration is reduced to 5%.

[0052] (2) The mature material after fermentation is heated to 88-92°C, and then the pH is adjusted to 10.5-11.0 by adding calcium oxide. The clear liquid is obtained by filtration, concentrated to a calcium content of 42%wt, and then poured into a 5L beaker. 50%v / v dilute sulfuric acid is slowly added for acid hydrolysis (the end point of acid hydrolysis is determined by adding barium chloride to form a slight turbidity and adding ammonium oxalate to form no turbidity). After acid hydrolysis, the material is placed in a 60°C oven for 70min. The clear liquid is obtained by filtration, and then 30g / L of powdered activated carbon is added and placed in a 60°C oven for 130min (stirring for 10s every 15min). The filtrate is deionized by passing through an anion and cation exchange column, and then concentrated to a L-lactic acid content of 80% (determined according to the national standard GB1886.173-2016). Crystallization is performed to obtain L-lactic acid.

[0053] Example 3 The present embodiment provides a method for producing high-purity L-lactic acid by using Bacillus coagulans JDKJ1.2406-2505 strain, and the specific operation is as follows: (1) Bacillus coagulans JDKJ1.2406-2505 strain is inoculated on a solid seed culture medium plate and cultured at 48-50°C for 48h. A single colony is picked and expanded on a solid seed culture medium slope at 48-50°C. When the strain grows to the logarithmic growth phase, the slope bacteria are eluted with 100ml of liquid seed culture medium in a 250ml flask, and cultured at 40-42°C and 120r / min for 24h. Then, the first-stage fermentation seed liquid is obtained by inoculating the liquid seed culture medium in a 1L flask at a 10% inoculation amount, culturing at 40-42°C and 120r / min for 24h. The second-stage fermentation seed liquid is obtained by inoculating the second-stage fermentation seed liquid in a 10L fermenter containing 5.4L of liquid seed culture medium at a 10% inoculation amount, culturing at 40-42°C and 100r / min, and culturing until the glucose concentration is reduced to 8%. The third-stage fermentation seed liquid is obtained by inoculating the second-stage fermentation seed liquid in a 50L fermenter containing 27L of fermentation medium 1 at a 10% inoculation amount and culturing at 40-42°C until the glucose concentration is reduced to less than 0.5%.

[0054] (2) The mature material after fermentation is heated to 88-92°C, and then CaO is added to adjust the pH to 10.5-11.0. The mixture is filtered, and the clear liquid is heated and concentrated to a calcium content of 45%wt. Then, the mixture is poured into a 5L beaker, and 50%v / v dilute sulfuric acid is slowly added for acid hydrolysis (the end point of acid hydrolysis is determined by adding BaCl2 to form a slight turbidity and adding (NH4)2C2O4 to form no turbidity). After acid hydrolysis, the mixture is placed in a 70°C oven for 50min. The mixture is filtered, and the clear liquid is obtained. Then, 30g / L of powdered activated carbon is added, and the mixture is placed in a 70°C oven for 110min (stirring for 10s every 15min). The mixture is filtered, and the filtrate is deionized by passing through an anion and cation exchange column. Then, the deionized filtrate is concentrated to a L-lactic acid content of 85% (determined according to the national standard GB1886.173-2016), and crystallization is performed to obtain L-lactic acid.

[0055] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement or improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. A strain of Bacillus coagulans JDKJ1.2406-2505 for the production of high optical purity L-lactic acid, characterized in that, Its classification name is Bacillus coagulans ( Bacillus coagulans It was deposited on May 13, 2025, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 34537; the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing.

2. The application of Bacillus coagulans JDKJ1.2406-2505 as described in claim 1 in the fermentation production of L-lactic acid.

3. A method for producing L-lactic acid by fermentation using Bacillus coagulans strain JDKJ1.2406-2505 as described in claim 1, characterized in that, Specifically, the following steps are included: S1. The Bacillus coagulans strain JDKJ1.2406-2505 was expanded and cultured until it reached the logarithmic growth phase. The strain was then fermented in liquid seed culture medium until the late logarithmic growth phase, and then transferred to liquid seed culture medium for expansion, which was used as the primary fermentation seed liquid. S2. The primary fermentation seed liquid is inoculated into a fermentation container containing liquid seed culture medium for secondary fermentation culture until the late logarithmic growth stage of the strain, which is used as the secondary fermentation seed liquid. S3. The secondary fermentation seed liquid is inoculated into the fermentation medium for fermentation culture, and the fermentation endpoint is defined as the glucose concentration of the fermentation system dropping to below 0.5%; L-lactic acid is separated and extracted from the fermentation broth obtained from fermentation.

4. The method according to claim 3, characterized in that, The culture medium used for expansion in S1 consists of: 1% yeast extract, 0.5% peptone, 0.5% dipotassium hydrogen phosphate, 0.5% ammonium sulfate, 0.05% magnesium sulfate, 0.1% manganese sulfate, 5% glucose, 20% calcium carbonate, and 2% agar powder, with water as the substrate.

5. The method according to claim 3, characterized in that, OD during the late logarithmic growth phase of the strain described in S1 620 1.5~1.7; and / or The criterion for determining the late logarithmic growth stage of the strain described in S2 is: OD 620 The concentration should be 1.5-1.7, or the glucose concentration in the fermentation system should be reduced to 5%-8%.

6. The method according to claim 3, characterized in that, The liquid seed culture medium described in S1 and S2 consists of: 1% yeast extract, 0.5% peptone, 0.5% dipotassium hydrogen phosphate, 0.5% ammonium sulfate, 0.05% magnesium sulfate, 0.1% manganese sulfate, 16% glucose, and 40% calcium carbonate, with water as the solvent.

7. The method according to claim 6, characterized in that, The fermentation temperature in the liquid seed culture medium is 40℃~50℃.

8. The method according to claim 3, characterized in that, The fermentation medium described in S3 consists of: 0.5%~1% yeast extract, 0.5% dipotassium hydrogen phosphate, 0.5% ammonium sulfate, 0.05% magnesium sulfate, 22%~23% glucose, and water as the solvent.

9. The method according to claim 8, characterized in that, During the fermentation process, the pH of the fermentation system is controlled to be 5.2–6.5; and / or The inoculation amount of the secondary fermentation seed liquid into the fermentation medium is 10% to 20%.

10. The method according to any one of claims 3 to 9, characterized in that, The method for separating and extracting L-lactic acid from the fermentation broth is as follows: The fermentation broth is heated to 88-92℃, and calcium oxide is added to adjust the pH to 10.5-11.0; the broth is filtered, and the filtrate is concentrated to a calcium content of 42%-45%wt. Dilute sulfuric acid is added for acid hydrolysis until no free calcium ions remain in the solution. The solution is then placed in a 60-70℃ oven for 50-70 minutes; the filtrate is removed, filtered, and the clear liquid is collected. Powdered activated carbon is added, and the solution is placed in a 60-70℃ oven for 110-130 minutes. The filtrate is then filtered again; the filtrate is passed through an anion and cation exchange column to remove ions.

Citation Information

Cited By

  • Process for producing lactic acid through continuous fermentation

    CN121759531A