Genetic engineering photosynthetic microorganism and application thereof in synthesis of L-lactic acid by using CO2

Abstract

The invention discloses a genetic engineering photosynthetic microorganism and application thereof in synthesis of L-lactic acid by using CO2, and belongs to the field of production of lactic acid by microorganisms. The gene engineering photosynthetic microorganism is synechococcus longisporus and is preserved in the China Center for Type Culture Collection (CCTCC), and the preservation number is CCTCC NO: M 2025896; a process for synthesizing L-lactic acid by using the gene engineering photosynthetic microorganism comprises the following steps: inoculating the gene engineering photosynthetic microorganism into a solid culture medium for culturing; the method comprises the following steps: inoculating genetic engineering photosynthetic microorganisms cultured in a solid culture medium into a liquid culture medium, and activating bacterial strains to prepare seeds; and inoculating the seeds into a flat plate type illumination reactor, and introducing CO2 gas in a liquid culture medium under an illumination condition for fermentation culture to prepare the L-lactic acid.

Description

Technical Field

[0001] This invention belongs to the field of microbial lactic acid production, specifically relating to genetically engineered photosynthetic microorganisms and their application in the synthesis of L-lactic acid using CO2. Background Technology

[0002] L-lactic acid (LLA) is an important organic acid and a key platform compound with wide applications in the food, pharmaceutical, cosmetic, and chemical industries. In particular, LLA is the main monomer for synthesizing polylactic acid (PLA), a biodegradable plastic. With increasing environmental awareness and growing demand for sustainable materials, the market demand for PLA, as a substitute for traditional petroleum-based plastics, continues to expand, driving rapid growth in the demand for LLA. Currently, industrial production of LLA mainly relies on the heterotrophic fermentation of carbohydrate raw materials (such as corn starch and sucrose) by microorganisms (e.g., lactobacillus, rhizopus). However, this traditional production method not only consumes large amounts of food resources, raising ethical concerns about competition with human resources for food, but also requires strict aseptic control during fermentation and may involve complex substrate pretreatment and product purification steps, resulting in high production costs and a certain environmental burden.

[0003] In recent years, utilizing photosynthetic microorganisms to directly convert carbon dioxide (CO2) into chemicals has been considered a highly promising sustainable biomanufacturing pathway. Algae, such as cyanobacteria and green algae, are a type of microorganism capable of oxygen-producing photosynthesis. They can directly utilize solar energy and atmospheric CO2 as carbon sources for autotrophic growth, eliminating the need for organic carbon sources and avoiding dependence on food crops. Furthermore, algae possess advantages such as relatively rapid growth, simple cultivation conditions, and ease of genetic modification, making them one of the ideal substrate organisms for constructing "light-driven cell factories." Modifying the metabolic network of algae through genetic engineering to guide the carbon fixed by photosynthesis to the synthetic pathway of target products has become a research hotspot in synthetic biology and metabolic engineering, aiming to achieve low-cost, environmentally friendly chemical production.

[0004] Introducing the biosynthetic pathway of L-lactic acid into photosynthetic microorganisms to directly fix CO2 during photosynthesis is considered a promising alternative to traditional fermentation. Researchers have attempted to achieve photosynthetic production of L-lactic acid by introducing a heterologous lactate dehydrogenase (LDH) gene and expressing it in photosynthetic microorganisms. However, existing reports show that the yield and efficiency of L-lactic acid production by engineered photosynthetic microorganisms are often low, failing to meet the demands of industrial-scale production. This may be attributed to various factors, including an imbalance in carbon flux distribution between endogenous metabolic pathways and the introduced pathway, insufficient activity of key enzymes, cellular toxicity or feedback inhibition from product accumulation, and poor coupling between CO2 fixation efficiency and downstream synthetic pathways. Therefore, developing novel genetic engineering strategies to optimize metabolic pathways and significantly improve the efficiency and yield of L-lactic acid production from CO2 in photosynthetic microorganisms remains a significant challenge in this field. Summary of the Invention

[0005] To address the shortcomings of existing technologies, the present invention aims to provide genetically engineered photosynthetic microorganisms and their application in the synthesis of L-lactic acid using CO2, thereby solving the problems in existing technologies.

[0006] The objective of this invention can be achieved through the following technical solutions:

[0007] The genetically engineered photosynthetic microorganism, *Synechococcus longiconicus*, is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M 2025896.

[0008] Furthermore, the genetically engineered photosynthetic microorganisms are obtained by introducing the genome of Synechococcus into a plasmid through the tandem combination of exogenous genes.

[0009] Furthermore, the exogenous genes include: the gene encoding L-lactate dehydrogenase, the gene encoding phosphite dehydrogenase, the gene encoding sodium / hydrogen ion reverse transporter, and the gene encoding carboxylic acid transporter.

[0010] The above-mentioned genetically engineered photosynthetic microorganisms are used in the synthesis of L-lactic acid from CO2.

[0011] A method for synthesizing L-lactic acid using CO2, employing the genetically engineered photosynthetic microorganisms described above, includes the following steps:

[0012] S1, genetically engineered photosynthetic microorganisms are inoculated into solid culture medium and cultured;

[0013] S2 involves inoculating genetically engineered photosynthetic microorganisms cultured in solid culture medium into liquid culture medium to activate the strains and obtain seeds;

[0014] S3. Seeds are inoculated into a flat-plate photoreactor, and fermented in a liquid culture medium under light conditions by introducing CO2 gas to prepare L-lactic acid.

[0015] Further, the solid culture medium is BG11 solid culture medium containing 20 μg / mL spectinomycin; the liquid culture medium in S2 is 5xBG liquid culture medium containing 20 μg / mL spectinomycin; the liquid culture medium in S3 is 5xBG liquid culture medium containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphate.

[0016] Furthermore, during the fermentation process, the seeds are inoculated into a flat-plate photoreactor at a volume ratio of 1%.

[0017] Furthermore, in S1, the culture temperature was 32℃ and the culture light intensity was 100 μE·s. -1 ·m -2 .

[0018] Furthermore, in S2, the culture temperature was 30℃ and the culture light intensity was 100 μE·s. -1 ·m -2 .

[0019] Furthermore, the fermentation conditions included: a culture temperature of 32°C, continuous introduction of 3% CO2 gas by volume, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 Increased to 400 μE·s after 2 days -1 ·m -2 Incubate for 5-8 days.

[0020] The beneficial effects of this invention are:

[0021] 1. This invention genetically modifies algae to modularly assemble the synthesis, transport, and tolerance pathways of lactic acid. The resulting genetically engineered algal strains can directly and efficiently convert inexhaustible solar energy and greenhouse gas CO2 into high-purity L-lactic acid, avoiding the consumption of carbohydrates and compounds as well as the use of expensive precursors.

[0022] 2. After cultivation, genetically engineered photosynthetic microorganisms can produce 1.26 g / L L-lactic acid, which can be used to further produce bio-based degradable materials such as polylactic acid, or applied to food additives, pharmaceutical preparations, cosmetic ingredients, and as chiral platform compounds for the synthesis of other high-value chemicals, showing broad industrial application prospects.

[0023] 3. The application method provided by this invention reduces substrate costs and can also absorb the greenhouse gas CO2, providing a promising technical approach to replace the traditional production method that relies on grain fermentation. It has important practical significance and industrial application value. Attached Figure Description

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, for those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0025] Figure 1 This is a schematic diagram of exogenous gene integration in Embodiment 5 of the present invention;

[0026] Figure 2 This is a schematic diagram illustrating how the exogenous genes Ldh, Ptdh, Napa, and Jen1 in the genetically engineered photosynthetic microorganism S-LLA4 in Example 9 of the present invention jointly promote the synthesis and secretion of L-lactic acid.

[0027] Figure 3 This is the HPLC optical purity analysis of L-lactic acid in Example 9 of the present invention. Detailed Implementation

[0028] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0029] The strains and growth conditions used in this invention are as follows:

[0030] The cloning host DH5α was purchased from Invitrogen. All E. coli were cultured in LB medium containing 100 mg / L spectinomycin at 37°C.

[0031] Synechococcus elongatus PCC7942 was purchased from the American Type Culture Collection. During the construction phase, Synechococcus was grown in BG11 liquid medium with 1.3% agar powder added to the solid medium. Culture conditions were: 32℃, light intensity 100 μE·s. -1 ·m -2The transformed genetically engineered algae were cultured in 5xBG medium with 20 mg / L spectinomycin added. Culture conditions included: 32°C, continuous purging of 3% CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 .

[0032] The LB medium formulation is as follows: peptone 10 g / L; yeast extract 5 g / L; NaCl 5 g / L; pH 7.0;

[0033] The formula for the BG11 liquid culture medium is as follows: 10 ml of BG11 stock solution; 1 ml of ferric ammonium citrate solution (6 g / L); 1 ml of Na2CO3 solution (20 g / L); 1 ml of K2HPO4 solution (30.5 g / L); and distilled water to a final volume of 1 L.

[0034] The formula for the above BG11 mother liquor is as follows: NaNO3 149.6g; MgSO4·7H2O 7.5g; CaCl2·2H2O 3.6g; citric acid 0.6g; EDTA-2Na solution (pH 8.0, concentration 0.25M) 1.12ml; 100ml trace element solution; distilled water to a final volume of 1L.

[0035] The formula for the above trace element solution is as follows: H3BO3 2.86g; MnCl2·7H2O 1.81g; ZnSO4·7H2O 0.22g; Na2MoO4·2H2O 0.39g; CuSO4·5H2O 0.079g; Co(NO3)2·6H2O 0.049g; distilled water to a final volume of 1L.

[0036] The formulation of the 5xBG liquid culture medium is as follows: 50 ml of BG11 stock solution; 5 ml of ferric ammonium citrate solution (6 g / L); 5 ml of Na2CO3 solution (20 g / L); 5 ml of K2HPO4 solution (30.5 g / L); and distilled water to a final volume of 1 L.

[0037] All plasmids were pSyn_6 (purchased from Invitrogen) derived plasmids, used to express the target gene by homologous recombination integration into the genome of Synechococcus.

[0038] Example 1

[0039] In this embodiment, the expression plasmid pSyn_ldh is constructed;

[0040] (1) Extraction of pAM2991 plasmid:

[0041] Escherichia coli DH5α containing pAM2991 plasmid was inoculated at a 1% inoculum into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.), following the plasmid mini-extraction procedure described in the kit's instructions.

[0042] (2) Synthesize the L-lactate dehydrogenase gene (ldh) fragment:

[0043] Using the online software JCat, the coding gene ldh for Ldh in *Weizmannia coagulans* was optimized based on codon preferences. The optimized nucleotide sequence of ldh is shown in SEQ ID NO.1.

[0044] atggaattca tgaaaaaggt caatcgtatt gcagtggttg gaacgggtgc agttggtacaagttactgct acgccatgat taatcagggt gttgcagaag agcttgtttt aatcgatatt aacgaagcaaaagcagaagg ggaagccatg gacctgaacc acggcctgcc atttgcgcct acgccgaccc gcgtttggaaaggcgattat tccgattgcg gcactgccga tcttgttgtc attacggcag gttccccgca aaaaccgggcgaaacaaggc ttgatcttgt tgccaaaaac gcaaaaattt ttaaaggcat gattaagagc atcatggacagcggctttaa cgggattttt cttgttgcca gcaacccggt tgacattttg acatatgtaa cttggaaagagtccggcctg ccgaaagaac atgttatcgg ttcgggcaca gtgcttgact ccgcgcgtct ccgcaactctttaagcgccc acttcggaat tgacccgcgc aatgtccatg ccgcaattat cggcgaacac ggcgacacggaacttccggt ttggagccat acaacgatcg gttatgacac cattgaaagc tatctgcaaa agggaaccattgaccaaaaa acattagatg atatttttgt caacacgaga gatgcggctt accatatcat tgaacgaaaaggggccacat tttacggcat cgggatgtct ctgacccgga tcacaagagc gatcctgaac aatgaaaacagtgttttgac agtctctgcc tttttggaag gccagtacgg aaacagcgat gtgtacattg gtgttcctgccgttattaac cgccaaggcg tccgtgaagt ggttgaaatc gagctgaacg acaaagaaca ggaacaatttagccattctg ttaaagtattaaaagaaacg atggcacctg tattgtaa

[0045] The sequence was sent to Genewiz for gene synthesis.

[0046] (3) Amplify the ldh gene fragment:

[0047] Using the ldh gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. PCR primers:

[0048] Upstream primer ldh.F (SEQ ID NO.5):

[0049] aggaaacagaccatggaattcatgaaaaaggtcaatcgtattgcagtggt;

[0050] Downstream primer ldh.R (SEQ ID NO.6):

[0051] ggatcctttaccagactcgagttacaatacaggtgccatcgtttcttttaatactt.

[0052] (4) The pSyn_6 plasmid extracted in step (1) was double-digested with NEB restriction endonucleases EcoRI and XhoI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the agarose gel DNA recovery method described in the kit instructions. The ldh gene fragment obtained in step (3) and the recovered pSyn_6 plasmid were then seamlessly cloned using the ClonExpress Ultra One Step Cloning Kit from Vazyme, following the single-fragment homologous recombination method described in the kit instructions, to obtain the recombinant plasmid pSyn_ldh.

[0053] Example 2

[0054] In this embodiment, the expression plasmid pSyn_ldh_ptdh is constructed.

[0055] (1) Extraction of pSyn_ldh plasmid:

[0056] Escherichia coli DH5α containing the pSyn_ldh plasmid was inoculated at a rate of 1% into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.), following the plasmid mini-extraction procedure described in the kit's instructions.

[0057] (2) Synthesis of phosphite dehydrogenase gene (ptdh) fragment:

[0058] Using the online software JCat, the coding gene ptdh for Ptdh in *Stutzerimonasstutzeri* was optimized based on codon preferences of *Synechococcus*. The optimized nucleotide sequence of ptdh is shown in SEQ ID NO. 2.

[0059] atgctgccga aactggttat cactcaccgt gtgcacgatg agatcctgca actgctggcgccgcattgcg agctgatgac caaccagacc gacagcaccc tgacccgcga ggaaattctg cgccgctgccgcgatgctca ggcgatgatg gcgttcatgc cggatcgtgt tgatgcagac tttctgcaag cctgcccggagctgcgtgtg gttggctgcg cgctgaaggg cttcgacaac ttcgatgtgg acgcctgtac tgcccgcggcgtttggctga ccttcgtgcc ggatctgctg accgttccga ctgccgagct ggcgattggc ctggcggtgggcctgggccg tcatctgcgc gcagcagatg cgttcgttcg ctctggcgag ttccagggct ggcaaccgcagttctacggc accggcctgg ataacgctac cgttggcatc ctgggcatgg gcgccatcgg cctggcgatggctgagcgcc tgcagggctg gggcgcgacc ctgcagtacc acgaggcgaa ggctctggat acccaaaccgagcaacgtct gggcctgcgc caggtggcgt gcagcgaact gttcgccagc tctgacttca tcctgctggcgctgccgctg aacgccgata cccagcatct ggttaacgcc gagctgctgg ccctggtgcg tccgggcgctctgctggtga acccgtgtcg tggttctgtg gtggatgaag ccgccgtgct ggcggcgctg gagcgcggccagctgggcgg ctatgcggcg gatgtgttcg aaatggaaga ctgggctcgc gcggaccgtc cgcgtctgatcgatccggcg ctgctggcgc atccgaacac cctgttcact ccgcacatcg gctctgcagt gcgcgcggtgcgcctggaga ttgaacgttgtgcagcgcag aacatcatcc aggtgctggc aggtgcgcgc ccgatcaacgctgcgaaccg tctgccgaag gccgagccgg ccgcatgtta a

[0060] An SD sequence (SEQ ID NO.7): 5'-aactattctaaaggaggtaaact-3' was added to the 5' end, and a linker sequence (SEQ ID NO.8): 5'-ctcgagtctggtaaa-3' was added to the 3' end. The sequences were then sent to Genewiz for gene synthesis.

[0061] (3) Amplify the ptdh gene fragment:

[0062] Using the ptdh gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. PCR primers:

[0063] Upstream primer ptdh.F (SEQ ID NO.9):

[0064] gcacctgtattgtaactcgaaactattctaaaggaggtaaactatgctgccg;

[0065] Downstream primer ptdh.R (SEQ ID NO.10):

[0066] caggtcgactctagaggatcctttaccagactcgagttaacatgcgg.

[0067] (4) The pSyn_ldh plasmid extracted in step (1) was double-digested with NEB restriction endonucleases XhoI and BamHI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the agarose gel DNA recovery method described in the kit instructions. The ptdh gene fragment obtained in step (3) and the recovered pSyn_ldh plasmid were then seamlessly cloned using the ClonExpress Ultra One Step Cloning Kit from Vazyme, following the single-fragment homologous recombination method described in the kit instructions, to obtain the recombinant plasmid pSyn_ldh_ptdh.

[0068] Example 3

[0069] In this embodiment, the expression plasmid pSyn_ldh_ptdh_napa is constructed:

[0070] (1) Extracting the pSyn_ldh_ptdh plasmid:

[0071] Escherichia coli DH5α containing the pSyn_ldh_ptdh plasmid was inoculated at a 1% inoculum into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.), following the plasmid mini-extraction procedure described in the kit's instructions.

[0072] (2) Synthesize the sodium / hydrogen ion reverse transporter gene (napa) fragment:

[0073] Using the online software JCat, the coding gene napa of Napa in *Aphanothecehalophytica* was optimized based on codon bias. The optimized nucleotide sequence of napa is shown in SEQ ID NO. 3.

[0074] atgatttttg atcaactgat ttctcgttct gtgatcaccg atatcattcc attctctctgctggcaaccg cagaagaaga aaccgcgcaa gcggatggct ctctgattct ggcgtctgtt ctgctgagcctggttgccat ctatattgcc tctaaaattg gcggtgaact gtgttctcgc attaacctgc cgccggtgctgggtgaactg gttggtggcg ttgttattgg tgtttccgtt ctgggcctgc tggtgtttcc agaaaccggtgcgaccgctg aagactccct gattatgacc tttctggaaa aaaccaccga tctggaacca ggtactgccgaagccgtatt tgaagcgcaa ggtgaagtga tcaccatcct gtctgaactg ggtgtggtga ttctgctgtttgagattggc ctggaatctg acctgaaaga gctgctgcgt gttggtccac aagcagcagc agtggcggttactggtgtta tagccccgtt cgtgggaggt actgcaggtc tgtattatgg ttttggtgtt ccggcgataccagctgtgtt cgccggtgca gccctgaccg cgacctctat tggtattact gcgaaagtgc tggccgagctgggtcgtctg aactccaaag aaggtcaaat tattattggt gcagcagtga ttgatgatgt gctgggcatcattgttctgg cggttgttgc ctctctgatc aaaaccggta acattgaagt tagcaacatt atctatctggttgtttctgc aggtgcgttt ctggtgggta ctattctggt tggtcgtttc atttctccgt ttctggtgggcatggttaac gaaatgaaaa cccgcggtga actgctgctg acctctctgg tgtttgcgtt tgctctggcttatattgcaa ccgcgattaacctggaagcc attctcggcg cattcgccgc tggtctggtt ctggcagaaaccgaaaaacg taaagagctg gaagaacaag tggttccagt tgccgatatc ctggtgccag tgttctttgtttgtgttggt gcacgtaccg atctgggtgt tctgaacccg actgttccgt ctaaccgcga aggtctgattctggcagcgt ttctgattgt ggttgccatt atcggcaaga tcatagctgg cttcaccatc ttcggccgccggatattaa caaactggcc attggtgtt gtatgattcc gcgtggtgaa gttggtctgg tgtttgcaggcgtgggctct gcatctggtg cactgtctcc ggcaaccgaa gcagcgatta ttgttatggt tatactcaccaccttcgtgg ctccgccgtt cctgcgcgtg gttctgccgg aggcagcaga aaccgaagct gagacctctaaacaggaagg ttaa

[0075] An upstream terminator and downstream promoter sequence (SEQ ID NO.11): 5'--3' was added to the 5' end, and a linker sequence (SEQ ID NO.12): 5'-ctcgagtctggtaaa-3' was added to the 3' end. The sequence was then sent to Genewiz for gene synthesis.

[0076] (3) Amplify the napa gene fragment:

[0077] Using the napa gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. PCR primers:

[0078] Upstream primer napa.F (SEQ ID NO.13):

[0079] ccggccgcatgttaactcgatctagagtcgacctgcaggcatg;

[0080] Downstream primer napa.R (SEQ ID NO.14):

[0081] caggtcgactctagaggatcctttaccagactcgagttaaccttcctgtt.

[0082] (4) The pSyn_ldh_ptdh plasmid extracted in step (1) was double-digested with NEB restriction endonucleases XhoI and BamHI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the agarose gel DNA recovery method described in the kit instructions. The napa gene fragment obtained in step (3) and the recovered pSyn_ldh_ptdh plasmid were then seamlessly cloned using the ClonExpress Ultra One Step Cloning Kit from Vazyme, following the single-fragment homologous recombination method described in the kit instructions, to obtain the recombinant plasmid pSyn_ldh_ptdh_napa.

[0083] Example 4

[0084] In this embodiment, the expression plasmid pSyn_ldh_ptdh_napa_jen1 is constructed:

[0085] (1) Extracting the pSyn_ldh_ptdh plasmid:

[0086] Escherichia coli DH5α containing the pSyn_ldh_ptdh plasmid was inoculated at a 1% inoculum into 5 mL of LB liquid medium containing 100 mg / L spectinomycin and incubated at 37°C for 12 h. Plasmids were then extracted from the cultured bacterial cells using a standard plasmid mini-extraction kit (Tiangen Biotech Co., Ltd.), following the plasmid mini-extraction procedure described in the kit's instructions.

[0087] (2) Synthesize the carboxylic acid transporter gene (jen1) fragment:

[0088] Using the online software JCat, the codons of the encoding gene jen1 in Saccharomyces cerevisiae were optimized based on the codon preference of Synechococcus. The optimized nucleotide sequence of jen1 is shown in SEQ ID NO. 4.

[0089] atgagtagtt caattacaga tgagaaaatt tctggtgaac agcaacaacc tgctggccgcaaactatact ataacacaag tacatttgca gagcctcctc tagtggacgg cgaaggtaac cctattaattatgagccgga agtttacaac ccggatcacg aaaagctata ccataacccc tcactgcctg cacaatcaattcaggataca cgcgatgatg aattgctgga acgcgtttat agccaggatc aaggtgtgga gtatgaggaagatgaagagg ataagcccaa cctaagcgct gcgtccatta aaagttatgc tctgacgcgc tttacgtccctgctgcacat ccacgagttt tcttgggaga atgtcaatcc cattcccgaa ctgcgcaaaa tgacatggcagaattggaac tattttttta tgggttattt tgcgtggttg tctgcggctt gggccttctt ttgcgtttcagtgtcagtcg ctcccttggc tgaactatat gaccgcccca ccaaggacat cacctggggg ttgggcctcgtgctgttcgt gcgttcagca ggcgcggtca tattcggtct gtggacagat aagtcttccc gcaagtggccgtacattaca tgtttgttcc tgtttgtcat tgcacaactc tgtactccct ggtgtgacac ttacgagaaattcctgggag tgcgctggat taccggtatt gctatgggcg gcatttacgg ctgtgcttct gcaacagcgattgaagatgc acctgtgaaa gcacgtagtt tcctatcagg tctatttttt tctgcttacg ctatggggttcatttttgct atcatttttt accgcgcctt tggctacttt cgcgatgatg gctggaaaat tttgttttggtttagtattt ttctacccattctactaatt ttctggcgct tgctgtggcc tgaaacgaaa tacttcaccaaggttttgaa agcccgtaaa ctgattttga gtgacgcagt gaaagctaat ggtggcgagc ctctacccaaagccaacttt aaacaaaaga tggtgtccat gaagcgcaca gttcaaagt actggtgtt gttcgcatatttggttgttc tgttggtggg tcccaattac ttgactcatg cttctcaaga cttgttgccc accatgctgcgtgcccaact gggcctatcc aggatgctg tcactgtcat tgtggtggtt accaacatcg gtgctatttgtgggggtatg attttggcc agttcatgga agttactggc cgccgcctgg gcctattgat tgcatgcacaatgggtggtt gcttcacata ccctgcattc atgctccgca gcgaaaaggc tattctgggcgggcttcatgctgtattt ttgtgtcttt ggtgtctggg gtatcctgcc cattcacctt gcagagttgg cccctgctgatgcgcgtgcg ttggttgccg gtctctctta ccagctaggt aatctagctt ctgcagcgg ttccacgattgagacacagc tggctgatcg ctaccccctg gaacgcgatg cctctggtgc tgtgattaaa gaagattatgccaaagttat ggctatcttg actggttctg tttcatctt cacttttgcg tgtgtttcg tcggccatgagaaattccat cgtgatttgt cctctcctgt tatgaagaaa tatattaacc aagtggagaa atacgaagccgatggtctta gtattagtga cattgttgaa caaaagacgg aatgtgcttc agtgaagatg attgatagtaacgtctcaaa gacatacgag gagcatattgagaccgttta a

[0090] An SD sequence (SEQ ID NO.15): 5'-aactattctaaaggaggtaaact-3' was added to the 5' end, and the sequence was sent to Genewiz for gene synthesis.

[0091] (3) Amplify the jen1 gene fragment:

[0092] Using the jen1 gene synthesized in step (2) as a template, recombinant PCR amplification was performed according to the method described in *Molecular Cloning: A Laboratory Manual (Third Edition)*. PCR primers:

[0093] Upstream primer jen1.F (SEQ ID NO.16):

[0094] aaacaggaaggttaactcgagaactattctaaaggaggtaaactatgagtagttcaattacagat;

[0095] Downstream primer jen1.R (SEQ ID NO.17):

[0096] caggtcgactctagaggatccttaaacggtctcaatatgctcctcgtatgt.

[0097] (4) The pSyn_ldh_ptdh_napa plasmid extracted in step (1) was double-digested with NEB restriction endonucleases XhoI and EcoRI. The digested plasmid was then recovered using the AxyPrep DNA Gel Extraction Kit from Axygen, following the agarose gel DNA recovery method described in the kit instructions. The napa gene fragment obtained in step (3) and the recovered pSyn_ldh_ptdh_napa plasmid were then seamlessly cloned using the ClonExpress Ultra OneStep Cloning Kit from Vazyme, following the single-fragment homologous recombination method described in the kit instructions, to obtain the recombinant plasmid pSyn_ldh_ptdh_napa_jen1.

[0098] Example 5

[0099] This embodiment describes the transformation of algal strains and the acquisition of genetically engineered photosynthetic microorganisms;

[0100] (1) Transformation of photosynthetic microbial strains:

[0101] Take the logarithmic growth phase (OD) 730Collect 10 ml of photosynthetic microbial cells (0.4-0.8 g / mL), centrifuge at 5000 rpm for 5 minutes, wash once with sterile 10 mM NaCl, and resuspend the cells in 5 ml of fresh BG11 medium. Transfer 500 μL of the bacterial culture to an EP tube, add recombinant plasmids pSyn_ldh, pSyn_ldh_ptdh, pSyn_ldh_ptdh_napa, and pSyn_ldh_ptdh_napa_jen1 to a final concentration of 100 ng / mL, mix well, and incubate at 30°C in the dark for 12-18 hours. Spread the mixture of photosynthetic microbial cells and recombinant plasmid DNA onto BG11 solid medium (containing 20 μg / mL spectinomycin) and incubate at 32°C, 100 μE·s. -1 ·m -2 Cultured under continuous light intensity for 10-14 days until single colonies appear on solid culture medium.

[0102] (2) Obtaining genetically engineered photosynthetic microorganisms:

[0103] Transformants were picked from the solid culture medium after transformation as described in step (1) and inoculated into 5 ml of fresh BG11 liquid culture medium (containing 20 μg / mL spectinomycin). The medium was then incubated at 32°C and 100 μE·s. -1 ·m -2 The microorganisms were cultured under continuous light intensity for 7-10 days. Genomic DNA of the genetically engineered photosynthetic microorganisms was prepared using conventional methods, which can be found in the small-scale preparation methods of biological genomes in the "Concise Guide to Molecular Biology" published by Science Press. Using the genome of the genetically engineered photosynthetic microorganisms as a template, PCR amplification was performed using primers for the amplification of exogenous genes on the recombinant plasmid, according to the method described in "Molecular Cloning: A Laboratory Manual (Third Edition)".

[0104] The exogenous genes on the recombinant plasmids pSyn_ldh, pSyn_ldh_ptdh, pSyn_ldh_ptdh_napa, and pSyn_ldh_ptdh_napa_jen1 were integrated into the neutral site 1 (NSI) of the Synechococcus genome via homologous recombination, as follows: Figure 1 As shown, four genetically engineered Synechococcus strains, S-LLA1, S-LLA2, S-LLA3, and S-LLA4, capable of synthesizing L-lactic acid were obtained.

[0105] (3) Preservation of genetically engineered photosynthetic microorganisms:

[0106] The genetically engineered photosynthetic microorganisms obtained in step (2) were inoculated into BG11 liquid medium containing 20 μg / mL spectinomycin and placed at 32°C and 100 μE·s. -1 ·m -2Under continuous light intensity, culture for 7-10 days. Under aseptic conditions, add 1 mL of the overnight culture to a sterile 1.5 mL centrifuge tube and centrifuge at 5000 rpm for 3 min. Discard the supernatant, resuspend the bacterial pellet in sterile 15% glycerol solution to prepare glycerol stock tubes, which can be stored at -20℃ for 6 months to 1 year. Every 6 months, remove the genetically engineered photosynthetic microorganisms stored in the glycerol stock tubes for activation and re-store the glycerol stock tubes.

[0107] Example 6

[0108] In this embodiment, L-lactic acid is produced using the genetically engineered photosynthetic microorganism S-LLA1:

[0109] (1) Solid culture: The genetically engineered photosynthetic microorganism S-LLA1 was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32℃ and 100 μE·s. -1 ·m -2 Cultured under continuous light intensity for 10-15 days.

[0110] (2) Seed culture: The photosynthetic microorganism S-LLA1 cultured in step (1) was inoculated into 50 mL of 5xBG liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30℃ and 100 μE·s. -1 ·m -2 Seeds were obtained by culturing the seeds under continuous light intensity for 7-10 days.

[0111] (3) Fermentation culture: The seeds obtained in step (2) were inoculated into a plate-type photoreactor at an inoculation rate of 1% (volume ratio), and cultured in 5xBG liquid medium (containing 20 μg / mL spectinomycin). The culture conditions were: 32℃, continuous introduction of 3% (volume ratio) CO2 gas, and initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 Incubate for 5-8 days.

[0112] (4) Sample processing and detection: After the culture was completed, the supernatant of the culture medium was taken and the yield and optical purity were analyzed by HPLC. The final L-lactic acid concentration was 0.31 g / L, and D-lactic acid was not detected.

[0113] Example 7

[0114] In this embodiment, L-lactic acid is produced using the genetically engineered photosynthetic microorganism S-LLA2:

[0115] (1) Solid culture: The genetically engineered photosynthetic microorganism S-LLA2 was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32℃ and 100 μE·s. -1 ·m -2 Cultured under continuous light intensity for 10-15 days.

[0116] (2) Seed culture: The photosynthetic microorganism S-LLA2 cultured in step (1) was inoculated into 50 mL of 5xBG liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30℃ and 100 μE·s. -1 ·m -2 Seeds were obtained by culturing the seeds under continuous light intensity for 7-10 days.

[0117] (3) Fermentation culture: The seeds obtained in step (2) were inoculated into a plate-type photoreactor at an inoculation rate of 1% (volume ratio). The fermentation culture was carried out in 5xBG liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphate). The culture conditions were: 32℃, continuous introduction of 3% (volume ratio) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 Incubate for 5-8 days.

[0118] (4) Sample processing and detection: After the culture was completed, the supernatant of the culture medium was taken and the yield and optical purity were analyzed by HPLC. The final L-lactic acid concentration was 0.66 g / L, and D-lactic acid was not detected.

[0119] Example 8

[0120] In this embodiment, L-lactic acid is produced using the genetically engineered photosynthetic microorganism S-LLA3:

[0121] (1) Solid culture: The genetically engineered photosynthetic microorganism S-LLA3 was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32℃ and 100 μE·s. -1 ·m -2 Cultured under continuous light intensity for 10-15 days.

[0122] (2) Seed culture: The photosynthetic microorganism S-LLA3 cultured in step (1) was inoculated into 50 mL of 5xBG liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30℃ and 100 μE·s -1 ·m -2 Seeds were obtained by culturing the seeds under continuous light intensity for 7-10 days.

[0123] (3) Fermentation culture: The seeds obtained in step (2) were inoculated into a plate-type photoreactor at an inoculation rate of 1% (volume ratio). The fermentation culture was carried out in 5xBG liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphate). The culture conditions were: 32℃, continuous introduction of 3% (volume ratio) CO2 gas, and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 Incubate for 5-8 days.

[0124] (4) Sample processing and detection: After the culture was completed, the supernatant of the culture medium was taken and the yield and optical purity were analyzed by HPLC. The final L-lactic acid concentration was 0.91 g / L, and D-lactic acid was not detected.

[0125] Example 9

[0126] In this embodiment, as Figure 2 As shown, L-lactic acid was produced using the genetically engineered photosynthetic microorganism S-LLA4. The genetically engineered photosynthetic microorganism S-LLA4 is Synechococcus elongatus Pliith011#00, which is deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: M2025896.

[0127] (1) Solid culture: The genetically engineered photosynthetic microorganism S-LLA4 was inoculated onto BG11 solid medium containing 20 μg / mL spectinomycin and cultured at 32℃ and 100 μE·s. -1 ·m -2 Cultured under continuous light intensity for 10-15 days.

[0128] (2) Seed culture: The photosynthetic microorganism S-LLA4 cultured in step (1) was inoculated into 50 mL of 5xBG liquid medium (containing 20 μg / mL spectinomycin) for strain activation, and cultured at 30℃ and 100 μE·s. -1 ·m -2 Seeds were obtained by culturing the seeds under continuous light intensity for 7-10 days.

[0129] (3) Fermentation culture: The seeds obtained in step (2) were inoculated into a plate-type photoreactor at an inoculation rate of 1% (volume ratio). The fermentation culture was carried out in 5xBG liquid medium (containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphate). The culture conditions were: 32℃, continuous introduction of 3% (volume ratio) CO2 gas, and an initial light intensity of 80 μE·s.-1 ·m -2 150 μE·s after 1 day -1 ·m -2 It increased to 400 μE·s after 2 days. -1 ·m -2 Incubate for 5-8 days.

[0130] (4) Sample processing and detection: After the culture was completed, the supernatant of the culture medium was taken and analyzed by HPLC to determine the yield and optical purity. The final L-lactic acid concentration was 1.26 g / L, and D-lactic acid was not detected. The detection chromatogram is shown below. Figure 3 As shown, the elution time of L-lactic acid was 10.96 minutes.

[0131] In the description of this specification, references to terms such as "an embodiment," "example," "specific example," etc., indicate that a specific feature, structure, material, or characteristic described in connection with that embodiment or example is included in at least one embodiment or example of the invention. In this specification, illustrative expressions of the above terms do not necessarily refer to the same embodiment or example. Furthermore, the specific features, structures, materials, or characteristics described may be combined in any suitable manner in one or more embodiments or examples.

[0132] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the claimed invention.

Claims

1. Genetically engineered photosynthetic microorganisms, characterized in that, It is a long-celled polycystic spirococcosis, deposited at the China Center for Type Culture Collection, accession number CCTCC NO: M 2025896.

2. The genetically engineered photosynthetic microorganism according to claim 1, characterized in that, The genetically engineered photosynthetic microorganisms were obtained by introducing the genome of Synechococcus into a plasmid through the tandem combination of exogenous genes.

3. The genetically engineered photosynthetic microorganism according to claim 1, characterized in that, The exogenous genes include: the gene encoding L-lactate dehydrogenase, the gene encoding phosphite dehydrogenase, the gene encoding sodium / hydrogen ion reverse transporter, and the gene encoding carboxylic acid transporter.

4. The application of the genetically engineered photosynthetic microorganisms according to any one of claims 1-3 in the synthesis of L-lactic acid using CO2.

5. A method for synthesizing L-lactic acid using CO2, employing the genetically engineered photosynthetic microorganisms according to any one of claims 1-3, characterized in that, Includes the following steps: S1, genetically engineered photosynthetic microorganisms are inoculated into solid culture medium and cultured; S2 involves inoculating genetically engineered photosynthetic microorganisms cultured in solid culture medium into liquid culture medium to activate the strains and obtain seeds; S3. Seeds are inoculated into a flat-plate photoreactor, and fermented in a liquid culture medium under light conditions by introducing CO2 gas to prepare L-lactic acid.

6. The method for synthesizing L-lactic acid using CO2 according to claim 5, characterized in that, The solid culture medium is BG11 solid culture medium containing 20 μg / mL spectinomycin; the liquid culture medium in S2 is 5xBG liquid culture medium containing 20 μg / mL spectinomycin; the liquid culture medium in S3 is 5xBG liquid culture medium containing 20 μg / mL spectinomycin and 0.6 g / L potassium dihydrogen phosphate.

7. The method for synthesizing L-lactic acid using CO2 according to claim 5, characterized in that, During the fermentation process, the seeds were inoculated into a flat-plate photoreactor at a volume ratio of 1%.

8. The method for synthesizing L-lactic acid using CO2 according to claim 5, characterized in that, In S1, the culture temperature was 32℃ and the light intensity was 100 μE·s. -1 ·m -2 .

9. A method for synthesizing L-lactic acid using CO2 according to claim 5, characterized in that, In S2, the culture temperature was 30℃ and the culture light intensity was 100 μE·s. -1 ·m -2 .

10. A method for synthesizing L-lactic acid using CO2 according to claim 5, characterized in that, The fermentation conditions included: a culture temperature of 32℃, continuous introduction of 3% CO2 gas (by volume), and an initial light intensity of 80 μE·s. -1 ·m -2 150 μE·s after 1 day -1 ·m -2 Increased to 400 μE·s after 2 days -1 ·m -2 Incubate for 5-8 days.

Images