Related lncRNAPB.235.1 for regulating pollen development and application of related lncRNAPB.235.1
By introducing lncRNA PB.235.1 from the wheat photoperiod-temperature-sensitive male sterile line BS366 into plants, constructing a recombinant expression vector, and transforming the plants, the problem of pollen development regulation was solved, achieving specific regulation of pollen development and improving the fertility and harvest period of crop varieties.
Patent Information
- Application Number
- CN202511081368.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-04
- Publication Date
- 2025-12-12
AI Technical Summary
Existing technologies lack effective methods for regulating pollen development, which affects crop fertility and harvest time, and makes it difficult to achieve specific regulation of pollen development through gene regulation.
A recombinant expression vector, PB.235.1, derived from the wheat photoperiod-temperature-sensitive male sterile line BS366, was constructed and introduced into plant cells. Plants were transformed using methods such as Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, or electrocoagulation to screen transgenic plants that regulate pollen development.
Successful regulation of pollen development significantly affects crop fertility and harvest time, providing theoretical and practical significance for crop variety improvement. Observation and identification showed that abnormal pollen development reduced the fertility of Arabidopsis thaliana.
Smart Images

Figure CN121109388A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of agricultural biotechnology, specifically to lncRNA PB.235.1, which regulates pollen development and its applications. Background Technology
[0002] Long non-coding RNAs (lncRNAs) are a class of RNA molecules longer than 200 nucleotides that do not encode proteins or encode only short peptides. Plant lncRNAs, as key regulatory factors, participate in growth and development, stress responses, and fertility regulation through diverse mechanisms. In-depth analysis of their functions and mechanisms not only helps to reveal the molecular network of plant fertility regulation but also provides a theoretical basis and genetic resources for crop hybridization breeding, such as using lncRNAs to create male-sterile lines.
[0003] Studies have shown that the biological functions of lncRNAs are not achieved independently, but are manifested through direct or indirect regulation of the expression, activity, or localization of their target genes. Target genes are the "carriers" of lncRNA function, meaning that lncRNAs mediate changes in the expression or function of target genes by specifically acting on them, ultimately participating in specific biological processes; while the functional characteristics of target genes determine the type of biological process in which lncRNAs participate. Summary of the Invention
[0004] The purpose of this invention is to provide lncRNAs that regulate pollen development.
[0005] Another object of the present invention is to provide the application of the above-mentioned lncRNAs that regulate pollen development.
[0006] Another object of the present invention is to provide a recombinant expression vector comprising the above-described lncRNAs that regulate pollen development.
[0007] Another objective of this case is to provide recombinant strains containing the aforementioned lncRNAs that regulate pollen development.
[0008] The pollen development-related lncRNA PB.235.1 provided in this invention is derived from the wheat photoperiod-sensitive male sterile line BS366, and its nucleotide sequence is shown in SEQ ID NO:1:
[0009] GAGCAGACCACCAACAAAGCCGCCGCGTTCTCCTCTGCGACACGCAACCTTTTCCCCTCCCCCTATAGACTAGACCAGATCCTTGATATAGAGAAGAACACGCCTCTTCCTCCCAACCACAACTACCTCCATCTCGGCAAGGTGAGCCCGTGACTCTCTGTCTACCATGATTTTTTCCTCCTCGAAACCCCCGTGCGCTCTCTGGTTCGCAGGTTCCTCGTCGATCGGCGGGCTGGGCTTGCGGCGATCTTGGAGCGAGACGCGAGGCGGCTGCATCTTCCGATCTGCCCGTCCGGCGACTCAGATCTGTTACCTATCTGATGGCCCGCGGCGGATCTGGGGGTTCCCGGCGGTCTAGAGTTGACTCTGCGGCGATGAAGGCTTCTTCTCCGACGTGCACGTGTGGATCCCGGCTTCCCCGCTTCGCGCGACGACGGCTCTTGTATTGATAATTATCCGATGATATCTCGATAATTATTAGATCTAAGAGATCAGAGGTAAGAGCGTGTAACAAGCGAGGTGATCGTGCCGAGAGGGGAGAAAGGAGTGAAAAAAGAGAGATGTGACACCTAGAGGCCTTTGCCATGTTGGGTGCGCTCGCATGGCAGGCCGCCACCGTAATAAAGATGGTTCTTGTGTCCGGGGGGAGATCGCACGGGGGTTATTCTGTTTAGCCCCGGGGTCTCCCCCCACCGTGTCCTGGTGTGCTCCTTTGTCTGCACCTCTCGTCCGATCCGATCTTCCTGGCACAACGTTCTACCGTCGCGAATCGATCAAGGTGCTACAAACCAAAGGTACAATCGATAATCTACAGCTGAAGCATACATAAACTTGAGACGAATTTCCGCTCTCGTAAATTGTATTCTGTTCTGAGCTTGTTTACACGAGGAATTCGTAATCACTCGAACCCATTTAAGTTATAGTGAAATCGTTGTTC。
[0010] According to specific embodiments of this application, a recombinant expression vector containing the above-mentioned lncRNA is constructed using existing plant expression vectors. The plant expression vector includes binary expression vector systems and vectors suitable for plant microbombardment methods, etc.
[0011] The recombinant expression vectors containing long non-coding RNAs were introduced into plant cells. Expression vectors carrying lncRNAs can be used to transform plant cells or tissues using conventional biological methods such as Ti plasmids, Ri plasmids, plant virus vectors, direct DNA transformation, microinjection, electrocoagulation, and Agrobacterium-mediated transformation, and the transformed plant tissues can be cultured into plants. The transformed plant hosts can be either monocotyledonous or dicotyledonous plants, such as tobacco, wheat, *Thalassiopeia longiflora*, *Arabidopsis thaliana*, rice, corn, cucumber, tomato, poplar, turfgrass, and alfalfa.
[0012] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), or antibiotic resistance markers (hygromycin markers, kanamycin markers, etc.). From a safety perspective, for transgenic plants, no selective marker genes may be added, and transformed plants can be directly selected based on stress.
[0013] This invention used the wheat photoperiod-temperature-sensitive male sterile line BS366 as experimental material to obtain the lncRNA PB.235.1, which regulates anther development. This lncRNA was introduced into Arabidopsis thaliana, and the results showed abnormal anther development. The long non-coding RNA regulating anther development described in this invention has significant theoretical and practical implications for plant variety improvement and for shortening the crop harvest period. Attached Figure Description
[0014] Figure 1 The results of PCR amplification of the flowering-related lncRNA PB.235.1 are shown.
[0015] Figure 2 The experiment demonstrated the use of Agrobacterium tumefaciens to infect Arabidopsis thaliana inflorescences and transform them to obtain transgenic Arabidopsis thaliana T1 generation seeds;
[0016] Figure 3 The results show the expression levels of transgenic Arabidopsis T2 generation lines, where WT is wild-type Arabidopsis;
[0017] Figure 4 The pollen of transgenic Arabidopsis thaliana shows Alexandrite staining, where WT is wild-type Arabidopsis thaliana;
[0018] Figure 5 The image shows a scanning electron microscope image of pollen from transgenic Arabidopsis thaliana, where WT is wild-type Arabidopsis thaliana;
[0019] Figure 6 Microscopic observation of the flowering phenotype of transgenic Arabidopsis thaliana, where WT is wild-type Arabidopsis thaliana;
[0020] Figure 7 The images show the phenotypes of transgenic Arabidopsis plants and pods, where WT is wild-type Arabidopsis.
[0021] Figure 8 The survey shows the seed setting rate of transgenic Arabidopsis thaliana plants, where WT is wild-type Arabidopsis thaliana. Detailed Implementation
[0022] Unless otherwise specified in the following examples, the molecular biology experimental methods were performed in accordance with the specific methods listed in J. Sambrook's "Molecular Cloning: A Laboratory Manual" (3rd Edition), or according to the kit and product instructions.
[0023] The following examples are provided to help better understand the present invention, but are not intended to limit the invention.
[0024] Example 1: Cloning and Sequence Motif Analysis of PB.235.1
[0025] Total RNA was extracted from the anthers of wheat photoperiod-sensitive male sterile line BS366 using the Trizol method. cDNA was obtained by reverse transcription using superscript II reverse transcriptase. Primer 1 was designed based on the PB.235.1 sequence. PCR amplification was performed using primer 1 with the reverse-transcribed cDNA as a template. The sequence of primer 1 is as follows:
[0026] Primer 1:
[0027] 5'-GAGCAGACCACCAACAAAGCCGC-3',
[0028] 5'-GAACAACGATTTCACTATAACTTAA-3'.
[0029] The PCR product was analyzed by 1% agarose gel electrophoresis, yielding a band with a molecular weight of approximately 937 bp, consistent with the expected result. This fragment was recovered using an agarose gel extraction kit. The recovered fragment was then compared with PCR... TM -Blunt ligation, transforming the ligation product into E. coli DH5α competent cells, according to pCR TMPositive clones were selected using the hygromycin resistance marker on the Blunt vector, yielding a recombinant plasmid containing the recovered fragment. The nucleotide sequence of this recombinant plasmid was determined using the T7 and SP6 promoter sequences as primers. Sequencing results showed that the open reading frame (ORF) of the amplified long non-coding RNA was SEQ ID NO:1. The recombinant vector containing the long non-coding RNA sequence shown in SEQ ID NO:1 was named Blunt-LncRNA, and its cloning results are as follows. Figure 1 As shown.
[0030] Example 2: PB.235.1 regulates anther development
[0031] 1. Construction of recombinant expression vectors
[0032] Construction of pBWA(V)HS-Dicotyledonous plant recombinant expression vector
[0033] cDNA obtained by reverse transcription of total RNA from leaves of wheat photoperiod-sensitive male sterile line BS366 was used as a template for PCR amplification using specific primers containing the BsaI / Eco31I adapter sequence. The PCR product was then digested with BsaI / Eco31I, recovered, and inserted into the vector pBWA(V)HS-ccdbGLosgfp in the forward direction to obtain the recombinant vector pBWA(V)HS-PB235.1.
[0034] The primer sequences are as follows:
[0035] 5'-GAGAGAACACGGGGGACTTTGCAACATGAGCATGTACGGGAGGGACC-3', 5'-CACTCCCTGAAGCGGCCGCTGTACATGGCTTCCATGGTGCTGGAGGC-3'.
[0036] 2. Acquisition and identification of transgenic Arabidopsis thaliana
[0037] Obtaining transgenic Arabidopsis
[0038] (1) The recombinant expression vector constructed above was transformed into Agrobacterium tumefaciens GV3101 by electroporation. In a clean bench, 1 mL of the above bacterial culture was added to 200 mL of LYEP medium (containing 100 μg mL-1 Kan and 50 μg mL-1 Rif antibiotics), and cultured overnight at 28°C with shaking at 220 rpm until OD600 = 1.0. The cells were collected by centrifugation at 4000 rpm for 15 min, and diluted in a large open dish with flower immersion medium [1 / 2 MS + 5% sucrose + 0.03% surfactant (Silwet L-77, pH 5.8] to adjust its OD600. 600 =Approximately 0.8, pending use.
[0039] (2) Select robust Arabidopsis plants in full bloom, remove the pods and open flowers, lay the plants flat, and immerse the flower buds completely in the Agrobacterium suspension for 1 minute. Then, remove the culture pot and place it on its side in a large dish to drain excess liquid. Cover the treated Arabidopsis with a plastic lid and incubate in the dark for 24 hours. Then, place it under light conditions of 23-25℃ to allow it to grow normally. It can be inoculated again after 1 week. After 3-4 weeks, when the Arabidopsis pods begin to turn yellow, cut them off and place them in a culture dish to dry. When most of the Arabidopsis pods have turned yellow, collect all the seeds and store them in 1.5mL centrifuge tubes (you can put appropriate silica gel in the tubes to facilitate drying). After the seeds are completely dry, store them in a new 1.5mL centrifuge tube at 4℃ for short-term storage. If necessary, they can be stored in a -20℃ refrigerator for long-term storage.
[0040] (3) Take a portion of Arabidopsis thaliana seeds (200-300 seeds) on a clean bench and place them in a sterile 1.5 mL centrifuge tube. First, treat the seeds with 70% alcohol twice, 30 seconds each time; then suspend the seeds in anhydrous ethanol and pour them onto a sterile filter paper; after the anhydrous ethanol has evaporated, sow the seeds evenly on the seed germination medium (1 / 2 MS + 30 g L). -1 Sucrose + 5-6 g / L -1 Agar + 100 μg mL -1 On a Kan (pH 5.8) medium, the culture dishes were sealed with Parafilm and treated at 4°C for 24 hours. Then, they were cultured under 16 hours of light / 8 hours of darkness for 7–10 days before being transplanted into nutrient pots and cultured in a culture room for 3–4 weeks for further identification. Two rounds of screening were performed using MS medium containing 50 mg / L hygromycin, with each round lasting 10–15 days, to obtain positive transgenic plants.
[0041] The positive transgenic plants obtained from the screening were further identified and screened using PCR with the hygromycin gene sequence. The primers used for PCR are as follows:
[0042] F:5'GAGCATATACGCCCGGAGTC3',
[0043] R:5'CAAGACCTGCCTGAAACCGA3'.
[0044] PCR identification of OE3-PB.235.1 transgenic Arabidopsis thaliana was performed, and positive transgenic plants yielded a 501bp band upon PCR amplification.
[0045] like Figure 2 As shown, the empty pBWA(V)HS vector was simultaneously introduced into Arabidopsis thaliana WT using the same method as above. As a control, three transgenic Arabidopsis thaliana lines were obtained (the transgenic Arabidopsis thaliana obtained through screening is represented by T0 generation).
[0046] 3. Identification of pollen development phenotypes in the PB.235.1 strain.
[0047] The overexpression line PB.235.1 showed higher expression levels than the wild type. Figure 3 Furthermore, the anther viability is weaker than that of the wild type, and pollen release is almost invisible. Figure 4 The pollen morphology of the overexpression lines appeared abnormal under scanning electron microscopy. Figure 5 The floret morphology of the overexpressing line PB.235.1 was not significantly different from that of wild-type Arabidopsis thaliana. Figure 6 The overexpression lines had significantly shorter siliques and fewer siliques than the wild type. Figure 7 Wild-type siliques contain more seeds, while overexpression lines have significantly fewer seeds due to the smaller size of the siliques. Figure 8 This severely reduces the fertility of Arabidopsis thaliana.
[0048] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention.
Claims
1. A lncRNA PB.235.1 that regulates pollen development, characterized by: The nucleotide sequence of the pollen development-related lncRNA PB.235.1 is shown in SEQ ID NO:
1.
2. A recombinant expression vector comprising the pollen development-related lncRNA PB.235.1 as described in claim 1.
3. A recombinant strain containing the pollen development-related lncRNA PB.235.1 as described in claim 1.
4. The application of the lncRNA PB.235.1 for regulating pollen development as described in claim 1.
5. The application according to claim 4, characterized in that, The pollen development-related lncRNA PB.235.1 is used to regulate pollen development.
6. The application according to claim 5, characterized in that, Overexpression of the pollen development-related lncRNA PB.235.1 affected pollen activity and seed setting ability.