Method for constructing honeysuckle flower EVM0006705 gene VIGS silencing vector and application of honeysuckle flower EVM0006705 gene VIGS silencing vector

Abstract

The invention provides a method for constructing a honeysuckle flower EVM0006705 gene VIGS silencing vector and application of the honeysuckle flower EVM0006705 gene VIGS silencing vector. The gene has a nucleotide sequence as shown in SEQ ID NO: 1 or a nucleotide sequence complementary with the SEQ ID NO: 1. The gene provided by the invention can be used for constructing a virus silencing system, so that the honeysuckle EVM0006705 gene is silenced in a honeysuckle plant.

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to a method for constructing and applying a VIGS silencing vector for the Lonicera japonica EVM0006705 gene. Background Technology

[0002] *Lonicera maackii*, a deciduous shrub belonging to the genus *Lonicera* in the family Caprifoliaceae, is characterized by its unique dynamic color change in flowers. The flowers initially open white, gradually turning golden yellow, creating a striking contrast. After flowering, the branches produce dense clusters of red berries, greatly enhancing its ornamental value. Furthermore, *Lonicera maackii* is rich in various natural active ingredients, such as chlorogenic acid, flavonoids, and anthocyanins. These components endow the plant with significant antioxidant, anti-inflammatory, and antibacterial potential, indicating broad prospects for medicinal development. However, a mature genetic transformation system for *Lonicera maackii* has not yet been established, hindering in-depth research on the functions of related genes. Therefore, developing an efficient and rapid method for verifying gene function is of great significance for advancing molecular breeding and biosynthesis research of the medicinal components of *Lonicera maackii*.

[0003] Virus-induced gene silencing (VIGS) is a technique based on post-transcriptional gene silencing mechanisms. It offers advantages such as ease of operation, short cycle time, and no need for stable genetic transformation, and has been widely used in various plants including tobacco, Arabidopsis thaliana, pepper, and camellia oleifera, becoming an important tool in reverse genetics research. Phytochrome dehydrogenase (PDS) is a key enzyme in the carotenoid biosynthesis pathway. Its silencing leads to inhibited carotenoid synthesis and chlorophyll degradation, resulting in an albinism phenotype that is easily observed and is therefore often used as a reporter gene for establishing VIGS systems. Currently, gene function research in *Lonicera japonica* is relatively lagging, and its PDS gene and coding sequence are not fully understood, limiting the application and development of VIGS technology in this species. Summary of the Invention

[0004] The purpose of this invention is to provide a method and application for constructing a VIGS silencing vector for the EVM0006705 gene of *Lonicera japonica*. The gene provided by this invention can be used to construct a virus silencing system, silencing the *Lonicera japonica* phytocyanin dehydrogenase EVM0006705 gene in *Lonicera japonica* plants. The LmPDS gene-silenced plants constructed by this invention show a significantly reduced expression level of the LmPDS gene in their leaves, with a marked decrease in chlorophyll a, chlorophyll b, and total chlorophyll content, accompanied by leaf whitening. This can be used for subsequent verification of the function of the target gene in *Lonicera japonica*, effectively overcoming the difficulties in genetic transformation of *Lonicera japonica* and providing important technical support for the functional analysis of its key genes.

[0005] Specifically, the present invention provides the following technical solution:

[0006] The first aspect of the present invention provides a honeysuckle phytoene dehydrogenase EVM0006705 gene, the gene having the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence complementary to SEQ ID NO:1.

[0007] A second aspect of the present invention provides a honeysuckle phytoene dehydrogenase EVM0006705 protein having the amino acid sequence shown in SEQ ID NO:2.

[0008] A third aspect of the present invention provides a target sequence of the phytoene dehydrogenase gene EVM0006705 of Lonicera japonica, having the nucleotide sequence shown in SEQ ID NO:3.

[0009] A fourth aspect of the present invention provides a recombinant vector comprising the Lonicera japonica phytorepigenin dehydrogenase EVM0006705 gene described in the first aspect, or the target sequence described in the third aspect.

[0010] A fifth aspect of the present invention provides a recombinant cell comprising the recombinant vector described in the fourth aspect.

[0011] A sixth aspect of the present invention provides a recombinant engineered bacterium, comprising the recombinant vector described in the fourth aspect. The recombinant engineered bacterium may be Agrobacterium.

[0012] The seventh aspect of the present invention provides an infection solution that silences the phytoene dehydrogenase EVM0006705 gene of *Lonicera japonica* described in the first aspect, the infection solution comprising the recombinant engineered bacteria described in the sixth aspect.

[0013] The eighth aspect of the present invention provides a method for constructing a VIGS silencing vector for the phytoene dehydrogenase EVM0006705 gene of Lonicera japonica, comprising the following steps:

[0014] (1) Design homologous amplification primers with specific restriction enzyme sites based on the target sequence of the third aspect, and amplify the PCR product using the primers;

[0015] (2) The PCR product is homologously recombinated with the vector digested by the restriction enzyme to obtain the VIGS silencing vector of the honeysuckle EVM0006705 gene.

[0016] According to embodiments of the present invention, the vector is selected from at least one of RNA viral vectors and DNA viral vectors. Available RNA viral vectors include, but are not limited to, tobacco brittle virus (TRV) vector, barley stripe mosaic virus (BSMV, for monocotyledonous plants), and apple latent spherical virus (ALSV, for Rosaceae fruit trees). Available DNA viral vectors include, but are not limited to, geminitroviral vectors (such as tomato leaf curl virus ToLCV and yellow leaf curl virus TYLCV): suitable for Solanaceae and Cruciferae crops (such as Chinese cabbage). Among them, the tobacco brittle virus (TRV) vector is the most commonly used VIGS vector, containing a binary system (pTRV1 and pTRV2). pTRV1 encodes a viral replicase, and pTRV2 carries the target gene fragment; the two are used together.

[0017] The first aspect of the present invention provides a method for silencing the phytoene dehydrogenase EVM0006705 gene of *Lonicera japonica* described in the first aspect, comprising:

[0018] The infection solution described in the seventh aspect was injected into the leaves of Lonicera japonica using a needleless syringe. After being cultured in the dark, the culture was switched to a light / dark cycle.

[0019] Observe the phenotypic changes of the plants and / or detect the expression level of the EVM0006705 gene in the plants by PCR; if the leaves of the plants turn significantly yellow or the expression level of the EVM0006705 gene in the plants is significantly reduced, it indicates that the EVM0006705 gene-silenced honeysuckle plants have been obtained. Attached Figure Description

[0020] Figure 1 This is a cloned gel electrophoresis image of a specific fragment of the Lonicera japonica phytorepigenin dehydrogenase EVM0006705 gene provided in an embodiment of the present invention.

[0021] Figure 2 This is a leaf phenotype diagram of the VIGS silent strain of honeysuckle provided according to an embodiment of the present invention.

[0022] Figure 3 The image shows the results of PCR detection of the pTRV vector and pTRV-EMV0006705 successfully introduced into honeysuckle leaves according to an embodiment of the present invention.

[0023] Figure 4 This is a graph showing the verification results of the relative expression level of the EVM0006705 gene in the leaves of the VIGS silent strain of Lonicera japonica provided in an embodiment of the present invention.

[0024] Figure 5 This is a graph showing the chlorophyll a, chlorophyll b, and total chlorophyll content of leaves of the VIGS silent strain of Lonicera japonica provided in an embodiment of the present invention. Detailed Implementation

[0025] The embodiments of the present invention are described in detail below. Examples of the embodiments are shown in the accompanying drawings. The embodiments described below with reference to the accompanying drawings are exemplary and intended to explain the present invention, but should not be construed as limiting the present invention.

[0026] The present invention provides a nucleotide sequence encoding the protein of phytoene dehydrogenase EVM0006705 from honeysuckle, having the nucleotide sequence shown in SEQ ID NO:1.

[0027] The nucleotide sequence of the Lonicera japonica phytoene dehydrogenase EVM0006705 gene is shown in SEQ ID NO: 1.

[0028]

[0029] The present invention also provides a honeysuckle phytoene dehydrogenase EVM0006705 protein, having the amino acid sequence shown in SEQ ID NO:2.

[0030] The amino acid sequence of the Lonicera japonica phytoene dehydrogenase EVM0006705 protein is shown in SEQ ID NO.2.

[0031] (SEQ ID NO: 2).

[0032] This invention also provides a target sequence for the *Lonicera japonica* phytorepinephrine dehydrogenase gene EVM0006705, having the nucleotide sequence shown in SEQ ID NO:3. The target sequence is a specific segment carefully selected from the complete *Lonicera japonica* EVM0006705 gene sequence for constructing the silencing vector. For VIGS technology, it is not necessary to insert the entire gene into the viral vector. Inserting a highly specific fragment (typically 200-500 base pairs) is sufficient for the plant's RNAi mechanism to recognize and silence the entire gene. This sequence is a carefully selected unique sequence, existing only in the *EVM0006705* gene and not similar to any other gene in the *Lonicera japonica* genome, thus avoiding off-target effects. This ensures that the viral vector only guides the cell to silence the target gene *EVM0006705*, and does not mistakenly silence other unrelated genes (a phenomenon known as the "off-target effect"). Moreover, this sequence should be the part of the gene that is stably expressed in the cell, so that it can be effectively recognized and utilized by the cell's gene silencing mechanism, ensuring silencing efficiency.

[0033] ATGTCTCAATTTGGACATGTCTCAGTAGTTAACCTGACCGGCCAAAGTAATATAATAAACCTTTGGAACCCACAATCTACTTGGAGACGTGGTTCAGGACAAACACATGTGCTATCATTTAGAGATGGTGATTATATGGGTCCTAGATTGGA ATTTCGAACCACACAAGCTACTAATACAAGATCCAGGAAGGGTGTCTCCCCTTTGAAGGTGGTTTGCATTGATTATCCAAGACCAGAACTGGACAACACTGTCAATTATTTAGAAGCTGCTTACTTCTCGTCGTCCTTCCAAACTGCT (SEQ ID NO: 3).

[0034] This invention also provides a method for constructing a VIGS silencing vector for the phytoene dehydrogenase EVM0006705 gene of Lonicera japonica, comprising the following steps:

[0035] (1) Design homologous amplification primers with specific Xba I and Kpn I restriction enzyme sites based on the above target sequence; then use the primers to amplify and obtain PCR products; according to the specific implementation method, the restriction enzyme sites mentioned can be Xba I and Kpn I restriction enzyme sites;

[0036] (2) The PCR product is homologously recombinated with a vector containing the same restriction enzyme sites to obtain the VIGS silencing vector of the Lonicera japonica phytoene dehydrogenase EVM0006705 gene.

[0037] The present invention also provides a VIGS vector and / or engineered bacteria containing the EVM0006705 gene fragment described above.

[0038] The present invention also provides an infection solution for silencing the above-described EVM0006705 gene, wherein the infection solution comprises the engineered bacteria described above.

[0039] This invention also provides a method for silencing the phytoene dehydrogenase EVM0006705 gene of *Lonicera japonica*, comprising the following steps:

[0040] The above-mentioned infection solution was injected into the back of the honeysuckle leaves using a needleless syringe. After being cultured in the dark for a predetermined time, the culture was switched to a 16h light / 8h dark cycle. According to the specific implementation method, the light / dark cycle mentioned can be 16h light / 8h dark.

[0041] Observe the phenotypic changes of the plants and / or detect the expression level of the EVM0006705 gene in the plants by PCR. If the leaves of the plants turn significantly yellow or the expression level of the EVM0006705 gene in the plants is significantly reduced, it indicates that the EVM0006705 gene-silenced honeysuckle plants have been obtained.

[0042] The technical solution of the present invention will be described below through specific embodiments. It should be noted that these embodiments are only for the convenience of those skilled in the art and should not be regarded as a limitation on the scope of protection of the present invention. Unless otherwise specified, the reagents or materials used in the embodiments can be obtained commercially.

[0043] Example 1

[0044] Example 1 describes the construction of the Lonicera japonica VIGS silencing expression vector pTRV2-EVM0006705. First, the nucleotide sequence SEQ ID NO.1 encoding the Lonicera japonica phytoene dehydrogenase EVM0006705 gene was obtained through analysis. Then, a target sequence was designed based on the Arabidopsis thaliana database, using the website https: / / vigs.solgenomics.net / as a reference. The nucleotide sequence of the target sequence is shown in SEQ ID NO: 3. The specific steps are as follows:

[0045] (1) Extraction of RNA from honeysuckle and honeysuckle

[0046] Roots, stems, leaves, flowers, and fruits of *Lonicera japonica* were collected and ground in liquid nitrogen for later use. RNA was then extracted, following the instructions of the RNeasy Plant miniKit, manufactured by Tiangen Biotech (Beijing) Co., Ltd.

[0047] (2) cDNA synthesis

[0048] First, prepare the reverse transcription mixture according to the following system and place it in a 200µL RNase-free PCR tube; the system is shown in Table 1 below:

[0049] Table 1: Reverse Transcription System

[0050]

[0051] The above reverse transcription system was thoroughly mixed and then incubated at 42°C for 30 min; followed by heating at 85°C for 5 s to inactivate TransScript RT / RI and gDNA Remover, thereby obtaining cDNA. The obtained cDNA was stored at -20°C. All reagents used in the reaction were purchased from Beijing TransGen Biotech Co., Ltd.

[0052] (3) Constructing the vector pTRV2-EVM0006705

[0053] 1) Based on SEQ ID NO: 3, design specific primers for the EVM0006705 gene containing Xba I and Kpn I restriction enzyme sites, as shown below:

[0054] Upstream primer EVM0006705-F: 5'-GGTTACCGAATTCTCTAGAATGTCTCAATTTGGACATGT-3' (SEQ ID NO:4);

[0055] Downstream primer EVM0006705-R: 5'-AGACGCGTGAGCTCGGTACCAGCAGTTTGGAAGGACGACG-3' (SEQ ID NO:5).

[0056] Then, using the *Lonicera japonica* cDNA sequence as a template, the *Lonicera japonica* phytoene dehydrogenase sequence EVM0006705 with restriction enzyme sites was amplified using the following PCR reaction system. The results are as follows: Figure 1 The reagents and dosages used are shown in the table below:

[0057] Table 2: PCR amplification system

[0058]

[0059] The PCR reaction procedure is as follows:

[0060] Pre-denaturation: 98℃ for 2 min; (denaturation: 98℃ for 30 s, annealing: 58℃ for 30 s, extension: 72℃ for 1.5 min) × 35 cycles; extension: 72℃ for 5 min; hold at 4℃.

[0061] 2) The pTRV2 vector was digested with Xba I and Kpn I at 37°C for 4 hours. The amplification product and digestion product were purified using a recovery kit (Takara, China).

[0062] 3) The two fragments from steps 1) and 2) were mixed and reacted at 50°C for 15 min under the action of homologous recombinase to obtain the ligation product. The ligation product was then transformed into trans1-T1 yeast competent cells (purchased from Beijing TransGen Biotech Co., Ltd.; specific operation methods and dosages are as per the instruction manual). The transformed bacterial culture was plated on LB solid medium containing 50 μL / mL kanamycin. After colonies grew, single colonies were picked and grown in 700 μL LB liquid medium containing 50 µg / mL kanamycin at 37°C for 6 h. Positive clones were screened and sequenced to obtain the recombinant expression vector pTRV2-EVM0006705.

[0063] The LB liquid culture medium used was prepared as follows: Weigh 5 g tryptone, 5 g NaCl, and 2.5 g yeast extract, add ddH2O, and bring the total volume to 500 mL. Then autoclave at 121℃ for 20 min and cool to room temperature.

[0064] The preparation method for LB solid medium is the same as that for LB liquid medium. Before making up to volume, add 5g of agar powder, autoclave at 121℃ for 20 min, and cool to room temperature.

[0065] Example 2

[0066] Example 2: An Agrobacterium infection solution was prepared according to the following method, comprising:

[0067] 1) Transform Agrobacterium GV3101 with the recombinant expression vectors pTRV2-EMV0006705, pTRV2 (empty control), and pTRV1 (helper vector) respectively (purchased from Shanghai Weidi Biotechnology Co., Ltd., refer to the instruction manual for specific operation steps).

[0068] 2) The three Agrobacterium species obtained in step 1) containing plant expression vectors pTRV2-EVM0006705, pTRV2, and pTRV1 were inoculated into LB liquid medium containing 50 mg / L kanamycin and 25 mg / L rifampin and cultured overnight at 28°C and 200 rpm until the OD600 value of the three Agrobacterium species was 0.8.

[0069] 3) Collect the three Agrobacterium bacterial suspensions from step 2) into 50 mL centrifuge tubes, centrifuge at 5000 rpm for 10 min, discard the supernatant, and resuspend the bacterial cells with infection solutions to obtain pTRV1 infection solution (OD600 = 0.8), pTRV2 infection solution (OD600 = 0.8), and pTRV2-EMV0006705 infection solution (OD600 = 0.8).

[0070] The infection solution was LB liquid medium (5 g tryptone, 5 g NaCl, 2.5 g yeast extract, ddH2O added to bring the total volume to 500 mL, autoclaved at 121°C for 20 min), containing only 10 mM magnesium chloride, 10 mM 2-morpholinoethanesulfonic acid and 200 µM acetylsyl syringone.

[0071] 4) Mix the pTRV1 infection solution (OD600 = 0.8) from step 3) with the pTRV2 infection solution (OD600 = 0.8) and the pTRV2-EMV0006705 infection solution (OD600 = 0.8) at a volume ratio of 1:1. Let it stand in the dark for 3-4 hours to obtain the pTRV infection solution and the pTRV-EMV0006705 infection solution, respectively, for later use.

[0072] Example 3

[0073] Example 3 involved injecting Agrobacterium tumefaciens into honeysuckle leaves, followed by phenotypic identification and silencing efficiency testing. Specifically, this included:

[0074] 1) Soak the harvested honeysuckle seeds in clean water and place them in a refrigerator at 4°C for one week; then transfer them to a mixed substrate of nutrient soil and vermiculite in a volume ratio of 3:1 for cultivation. When the seedlings have grown to 8–10 leaves, Agrobacterium-mediated leaf infection experiments can be carried out.

[0075] 2) Seedlings were randomly selected from plants that were growing well, developing uniformly, and free from obvious pests and diseases. They were divided into a control group (pTRV), an experimental group (pTRV-EMV0006705), and an untreated group (no treatment). Using a sterile, needle-free syringe, the infection solution prepared in step 4) of Example 2 was drawn and injected onto the underside of the leaves of both groups (control and experimental groups). Each group had 20 biological replicates (i.e., 20 plants). After injection, the plants were first cultured in darkness for 12 hours, and then transferred to a 25°C environment with a photoperiod of 16 hours light / 8 hours dark for further culture.

[0076] 3) After 15 days of cultivation, the phenotypic characteristics of the honeysuckle leaves in the experimental and control groups were identified, and the results were as follows: Figure 2 As shown (the experimental group shows three lines, designated as pTRV-EVM0006705-41, pTRV-EVM0006705-42, and pTRV-EVM0006705-31), compared with the control group and the untreated group, the leaves of the honeysuckle in the experimental group showed yellowing, indicating that the EVM0006705 gene was successfully silenced.

[0077] 4) Selected yellowed leaves from the control group, untreated group, and experimental group, and extracted genomic DNA using the CTAB method. PCR detection of TRV1 and TRV2 in the leaves of *Lonicera japonica* from the control group, untreated group, and experimental group was performed using the following primers:

[0078] pTRV1-F: 5'-CGTGTTGCATTTCGATGAAGCT-3' (SEQ ID NO: 6);

[0079] pTRV1-R: 5'-GCGACAACGCCACGATTAAGT-3' (SEQ ID NO:7);

[0080] pTRV2-F: 5'- TGTCAACAAAGATGGACATTGTTAC-3' (SEQ ID NO: 8);

[0081] pTRV2-R: 5'-AACCTAAAACAACAGACACGG-3' (SEQ ID NO: 9).

[0082] The results are as follows Figure 3 As shown. Among them. Figure 3 The left image in the figure shows the amplified TRV1 vector fragment. Compared with the untreated group, both the positive control group and the experimental group were able to amplify the TRV1 fragment, which was 527bp in size. Figure 3The middle right figure shows the fragment on the amplified TRV2 vector. Since the silent fragment was inserted into the pTRV2 vector, the PCR products of the control group and the experimental group were 213bp and 513bp, respectively, indicating that the pTRV1 vector and pTRV2-EVM0006705 were successfully introduced into the leaves of Lonicera japonica.

[0083] 5) Total RNA was extracted from leaves of the untreated group, control group, and experimental group, and reverse transcribed into cDNA. The relative expression level of the EVM0006705 gene was detected by qRT-PCR, with 18S as the internal reference gene. The primers used are as follows:

[0084] 18S-F: 5'-CAACCATAAACGATGCCGA-3' (SEQ ID NO: 10);

[0085] 18S-R: 5'-AGCCTTGCGACCATACTCC-3' (SEQ ID NO: 11);

[0086] qPCR-EVM0006705-F: 5'-GGAACCCACAATCTACTTGGAG-3' (SEQ ID NO: 12);

[0087] qPCR-EVM0006705-R: 5'-TGTTGTCCAGTTCTGGTCTTGG-3' (SEQ ID NO: 13).

[0088] The results are as follows Figure 4 As shown, compared with the untreated group, the relative expression levels of EVM0006705 in the leaves of Lonicera japonica from the three lines in the experimental group were significantly reduced, by 57%, 85%, and 59%, respectively. This indicates that the pTRV2 plant expression vector played a role in Lonicera japonica leaves, achieving the silencing effect of the EVM0006705 gene.

[0089] 6) Weigh approximately 0.15 g of *Lonicera japonica* leaves from the untreated group, experimental group, and control group, respectively. Grind them rapidly and thoroughly using a high-throughput grinder. Add an acetone-anhydrous ethanol mixed extraction solution (acetone to anhydrous ethanol volume ratio of 1:2) and extract in the dark for 3 h. When the tissue residue is nearly white, the extraction is complete. Preheat the spectrophotometer for at least 30 min, adjust the wavelength to 645 nm and 663 nm, and zero the meter with the extract. Take 700 µL of the upper extract into a 1 mL glass cuvette and measure the absorbance at 645 nm and 663 nm, respectively, and record them as A663 and A645. Calculate the contents of chlorophyll a, chlorophyll b, and total chlorophyll using the following formulas.

[0090] Chlorophyll a content (mg / g) = 0.01 × (12.7 × A) 663 -2.69×A 645 ) × dilution factor ÷ sample mass (g);

[0091] Chlorophyll b content (mg / g) = 0.01 × (22.9 × A) 645 -4.68×A 663 ) × dilution factor ÷ sample mass (g);

[0092] Total chlorophyll content (mg / g) = 0.01 × (20.21 × A) 645 +8.02×A 663 ) × dilution factor ÷ sample mass (g).

[0093] The results are as follows Figure 5 As shown (**** and *** indicate P < 0.0001), compared with the untreated group, the chlorophyll a, chlorophyll b, and total chlorophyll contents of the three experimental groups (pTRV-EVM0006705-41, pTRV-EVM0006705-42, and pTRV-EVM0006705-31) were significantly reduced. Specifically, chlorophyll a decreased by 47%, 42%, and 49%, respectively; chlorophyll b decreased by 40.6%, 40%, and 45.6%, respectively; and total chlorophyll content decreased by 45%, 41.8%, and 48.6%, respectively.

[0094] In summary, this invention successfully constructed a silencing system for the phytoene dehydrogenase EVM0006705 gene in Lonicera japonica, with a short experimental cycle, no need for genetic transformation, and overcoming the difficulties of genetic transformation of Lonicera japonica.

[0095] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A gene for phytoene dehydrogenase EVM0006705 from honeysuckle, characterized in that, The gene has the nucleotide sequence shown in SEQ ID NO:1 or a nucleotide sequence complementary to SEQ ID NO:

1.

2. A phytoene dehydrogenase EVM0006705 protein from honeysuckle, characterized in that, It has the amino acid sequence shown in SEQ ID NO:

2.

3. A target sequence of the phytoene dehydrogenase EVM0006705 gene from Lonicera japonica, characterized in that, It has the nucleotide sequence shown in SEQ ID NO:

3.

4. A recombinant vector, characterized in that, The recombinant vector includes the Lonicera japonica phytoene dehydrogenase EVM0006705 gene as described in claim 1, or the target sequence as described in claim 3.

5. A recombinant cell, characterized in that, Includes the recombinant vector as described in claim 4.

6. A recombinant engineered bacterium, characterized in that, Includes the recombinant vector as described in claim 4.

7. An infection solution for silencing the phytoene dehydrogenase EVM0006705 gene of *Lonicera japonica* as described in claim 1, characterized in that, Includes the recombinant engineered bacteria as described in claim 6.

8. A method for constructing a VIGS silencing vector for the phytoene dehydrogenase EVM0006705 gene of Lonicera japonica, characterized in that, Includes the following steps: (1) Design homologous amplification primers with specific restriction enzyme sites according to the target sequence described in claim 3, and amplify the PCR product using the primers; (2) The PCR product is homologously recombinated with a vector containing the same restriction enzyme sites to obtain the VIGS silencing vector of the Lonicera japonica phytoene dehydrogenase EVM0006705 gene.

9. The method according to claim 8, characterized in that, The vector is selected from at least one of RNA viral vectors and DNA viral vectors.

10. A method for silencing the phytoene dehydrogenase EVM0006705 gene of *Lonicera japonica* as described in claim 1, characterized in that, include: The infection solution described in claim 7 was injected onto the underside of honeysuckle leaves, and after being cultured in the dark, it was cultured under a light / dark cycle. Observe the phenotypic changes of the plants and / or detect the expression level of the EVM0006705 gene in the plants by PCR; if the leaves of the plants turn significantly yellow or the expression level of the EVM0006705 gene in the plants is significantly reduced, it indicates that the EVM0006705 gene-silenced honeysuckle plants have been obtained.

Images