Application of corn phospholipase gene Zm00001eb229100 in control of corn yield

Abstract

The invention belongs to the technical field of plant genetic engineering, and discloses application of a corn phospholipase gene Zm00001eb229100 in control of corn yield, the protein encoded by the Zm00001eb229100 is shown in SEQ ID NO.2, and the gene is located in the fifth chromosome of corn and used for controlling the ear length and the row grain number of the corn. The gene is knocked out by using a CRISPR / Cas9 technology, gene expression is inhibited, and the ear row number of corn can be increased.

Description

Technical Field

[0001] This invention belongs to the field of plant genetic engineering technology. Specifically, it relates to the application of the maize phospholipase gene Zm00001eb229100 in controlling maize yield. The gene of this invention is located on chromosome 5 of maize and controls important yield traits such as ear length and number of kernels per row. Background Technology

[0002] Theoretical and practical studies in maize breeding have demonstrated a significant positive correlation between the yield of maize hybrids and the yield of inbred lines (Richey, 1946). Under the same planting conditions, the yield growth trends of hybrids and inbred lines are similar. Therefore, increasing the yield of inbred lines is of great significance for improving the yield of hybrids.

[0003] Maize yield is an extremely complex quantitative trait. Maize grain yield is determined by the yield per ear and the number of ears. Ear yield can be further analyzed into: number of rows per ear, number of kernels per row, and weight per 100 kernels. Deconstructing maize yield traits into different yield factors and performing genetic analysis on each is the preferred and optimal strategy for ultimately elucidating the genetic mechanisms underlying yield trait formation. Ear length is one of the most important components of maize yield traits, showing a significant positive correlation with ear yield. Analyzing the genetic basis of ear length is crucial for understanding the mechanisms underlying maize yield trait formation.

[0004] Therefore, this study used genetic methods to isolate a gene, Zm00001eb229100, located on chromosome 5 of maize, that controls ear length and kernel number per row. This gene encodes a phosphatidylinositol-specific phospholipase C, which participates in the phosphatidylinositol signaling pathway in plants. Based on the genetic phenotype and related molecular biological analysis of transgenic materials, the biological function of this gene in controlling ear length and kernel number per row was confirmed. The genetic transformation study of Zm00001eb229100 can provide genetic resources and theoretical support for maize breeding. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the maize gene Zm00001eb229100 in controlling maize yield, wherein the protein encoded by the gene is shown in SEQ ID NO.2.

[0006] To achieve the above objectives, the present invention adopts the following technical measures:

[0007] Application of maize gene Zm00001eb229100 in controlling maize yield, wherein the protein encoded by the gene is shown in SEQ ID NO.2;

[0008] The applications described above, specifically:

[0009] Application of reducing the expression of the maize gene Zm00001eb229100 in improving maize yield;

[0010] Application of increasing the expression of the maize gene Zm00001eb229100 in reducing maize yield;

[0011] The above-mentioned applications specifically involve increasing maize yield by knocking out, suppressing, or silencing the expression of the maize gene Zm00001eb229070.

[0012] In the above applications, preferably, the knockout is performed using the CRISPR / Cas9 system. The knocked-out gene translates into a protein that has no original function or cannot be translated into a protein, thus achieving the effect of increasing maize yield.

[0013] Preferably, the target sites of gRNA in the CRISPR / Cas9 system are GAGAATATCGCAGTGGCAGCGG, GTGTGTATCCAAAGGGCACGAGG, and GGGTTTTTCAGAGCCAATGGGGG.

[0014] In the applications described above, the corn with increased yield after editing by the CRISPR / Cas9 system has the polynucleotide shown in SEQ ID NO.4 or SEQ ID NO.5.

[0015] The application of the maize gene Zm00001eb229100 in the creation of high-yield maize varieties is specifically described by introducing a substance that reduces the expression level of the Zm00001eb229100 gene into maize. The protein encoded by the gene is shown in SEQ ID NO.2.

[0016] In the above-described applications, preferably, the substance is a nucleic acid molecule containing the knockout, inhibition, or silencing of the Zm00001eb229100 gene, or an expression cassette of the nucleic acid molecule, a recombinant vector, or a recombinant microorganism;

[0017] The Zm00001eb229100 gene is shown in SEQ ID NO.1 or SEQ ID NO.6.

[0018] In the above-described applications, the control of corn yield is achieved by controlling ear length and / or the number of kernels per row.

[0019] Compared with the prior art, the present invention has the following advantages:

[0020] This invention cloned and confirmed the gene Zm00001eb229100, which controls ear row number and ear weight, in maize. It also confirmed the relationship between ear length and the expression level of Zm00001eb229100, showing that reducing its expression level increases ear length. The difference in ear length between transgenic and wild-type materials is attributed to a decrease in the protein level encoded by the gene due to editing of its coding region. Mechanistically, this gene is believed to participate in plant phosphatidylinositol signaling, increasing the phosphatidylinositol signaling response, thereby regulating the expression of downstream genes and ultimately controlling the differentiation activity of maize inflorescence meristems, affecting ear length and yield traits. Therefore, this invention provides a new genetic resource for maize yield improvement. Attached Figure Description

[0021] Figure 1 A schematic diagram of maize Zm00001eb229100 gene knockout material;

[0022] Where: A is a schematic diagram of the editing of the maize Zm00001eb229100 gene, in which 1041bp is deleted in plc4-1 and 801bp is deleted in plc4-2. The insertion and deletion of these bases both lead to premature termination of protein translation.

[0023] B is a schematic diagram of the protein structure of the maize Zm00001eb229100 gene knockout material. From top to bottom, they are: the wild-type family (WT4) isolated from the transgenic heterozygous plant, and two gene-edited families plc4-1 and plc4-2.

[0024] C is a schematic diagram of the maize Zm00001eb229100 gene knockout material. From left to right, the photos show the wild-type family (WT4), the Zm00001eb229100 gene-edited family plc4-1, the plant, the male and female ears, respectively.

[0025] D is a schematic diagram of ear traits of maize Zm00001eb229100 gene knockout materials. The bars from left to right are ear length and number of kernels per row for the wild-type family (WT4) and the Zm00001eb229100 gene-edited family plc4-1.

[0026] Figure 2 A schematic diagram of the expression pattern of the maize Zm00001eb229100 gene;

[0027] Among them: A: Zm00001eb229100 is highly expressed in maize meristems; B: In situ hybridization results show that Zm00001eb229100 is expressed in IM (inflorescence meristem), SPM (spikelet pairmeristem), SM (spikelet meristem) and FM (floral meristem) of 2mm young ears. Detailed Implementation

[0028] The following embodiments further define the present invention. Based on the following description and examples, those skilled in the art can determine the basic features of the present invention, and can make appropriate improvements and modifications to the present invention without departing from its spirit and scope, so as to make it suitable for various uses and conditions. Unless otherwise specified, the technical solutions described in this invention are conventional solutions in the art; the reagents or materials described, unless otherwise specified, are all derived from commercial channels or publicly disclosed materials.

[0029] Example 1: Cloning of Zm00001eb229100

[0030] Total DNA was extracted from leaves of the inbred line KN5585 (Liu, et al. High-throughput CRISPR / Cas9 mutagenesis streamlines trait gene identification in maize. The Plant Cell, 2020, 32:1397–1413). Primers PLC4-F and PLC4-R were designed based on the reference sequence of the maize B73 genome (National Crop Germplasm Center) (https: / / chinese.maizegdb.org / genome / assembly / Zm-B73-REFERENCE-GRAMENE-4.0). The Zm00001eb229100 gene was amplified by PCR and resequencing in KN5585 material, and the CDS sequence of the Zm00001eb229100 gene was obtained, as shown in SEQ ID NO.1. The protein encoded by this gene is shown in SEQ ID NO.2, and the complete gene sequence is shown in SEQ ID NO.6.

[0031] Total DNA was extracted from plant leaves using the CTAB method. The PCR amplification program was as follows: pre-denaturation at 94℃ for 5 min, followed by 34 cycles of denaturation at 94℃ for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 60 s, and finally extension at 72℃ for 5 min.

[0032] Table 1. Primers and their sequences used in this invention

[0033]

[0034]

[0035] Example 2: Genetic transformation of Zm00001eb229100 in maize

[0036] Genetic transformation to knock out the Zm00001eb229100 gene was performed using Zm00001eb229100 from the transgenic recipient material KN5585 as the applied gene, with the sequence shown in SEQ ID NO.1. The transformation was performed using the CRISPR-P website (…). http: / / cbi.hzau.edu.cn / crispr / Gene target design was performed to obtain Guide RNA (Target: GAGAATATCGCAGTGGCAG CGG, GTGTGTATCCAAAGGGCACGAGG, and GGGTTTTTCAGAGCCAATGGGGG). Based on the above Guide RNA, the ZmU6-Target-sgRNA fragment (sequence shown in SEQ ID NO.3) was synthesized using gene synthesis and constructed into the commercial pEASY-T1 vector.

[0037] The fragment was amplified by PCR using primers pU6F1 and gRR1 (primer sequences are shown in Table 1, primer ID 2). The CPB-ZmUbi-hspCas9 vector was linearized by HindIII digestion, and the fragments were recovered by electrophoresis gel extraction and detected. Guide RNA was ligated into the target vector CPB-ZmUbi-hspCas9 (CN113004383A) using homologous recombination. Finally, the clone was sequenced using CR ISPR vector detection primers (primer sequences are shown in Table 1, primer ID 3) to confirm that the target fragment had been ligated into the vector.

[0038] The correctly cloned plasmid was transformed into the maize inbred line KN5585 via Agrobacterium-mediated transformation (genetic transformation was performed by the Life Science and Technology Center of China Seed Group Co., Ltd.). Using primers specific to the Zm00001eb229100 gene (primer sequences are shown in Table 1, primer ID 4), two maize transformation events with KN5585 as the background were screened and obtained. Figure 1 In the protein translation, plc4-1 and plc4-2 are involved. plc4-1 has a 1041bp deletion (plc4-1 contains the sequence shown in SEQ ID NO.4), and plc4-2 has an 801bp deletion (plc4-2 contains the sequence shown in SEQ ID NO.5). These base deletions lead to premature termination of protein translation. Figure 1(B). Furthermore, in 2023, the phenotypic values ​​of ear length and row kernel number in maize from Zm00001eb229100 gene knockout families were investigated in Gansu. Figure 1 The results showed that, compared to WT, loss of function of the Zm00001eb229100 gene increased the spike length and number of grains per row in plc4-1. Figure 1 Compared to the wild-type WT, the mutant plc4-1 had an increased ear length of 0.38 cm and an increased number of kernels per row of 2.18. Based on the above results, it is demonstrated that the expression of the Zm00001eb229100 gene can improve the ear length and number of kernels per row of maize.

[0039] Example 3: Expression analysis of Zm00001eb229100

[0040] Based on the maize B73 expression database, the expression pattern of the Zm00001eb229100 gene was analyzed. The Zm00001eb229100 gene showed high expression levels in maize meristems (FPKM). Figure 2 (A); Simultaneously, we used RNA in situ hybridization to verify the specific expression pattern of Zm00001eb229100 in ~5mm young spikelets. Figure 2 The primer sequence is shown in Table 1 (primer ID5). This gene is mainly highly expressed in the early IM, SPM, SM and FM of maize young ears; therefore, Zm00001eb229100 affects traits such as ear length and number of kernels per row in maize.

Claims

1. Maize genes Zm00001eb229100 In its application to controlling maize yield, the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The application according to claim 1, characterized in that: The control mentioned is to improve the corn Zm00001eb229100 The expression level of genes can be reduced to decrease corn yield.

3. The application according to claim 1, characterized in that: The control mentioned is achieved by reducing maize genes. Zm00001eb229100 Increased expression levels improve maize yield.

4. The application according to claim 1, characterized in that: The control mentioned above is achieved by knocking out, suppressing, or silencing maize genes. Zm00001eb229100 The expression increases corn yield.

5. The application according to claim 4, characterized in that: The knockout process uses the CRISPR / Cas9 system, and the knocked-out gene translates into a protein that has no original function or cannot be translated into a protein.

6. The application according to claim 5, characterized in that: The target sites of gRNA in the CRISPR / Cas9 system are GAGAATATCGCAGTGGCAGCGG, GTGTGTATCCAAAGGGCACGAGG, and GGGTTTTTCAGAGCCAATGGGGG.

7. The application according to claim 6, characterized in that: The CRISPR / Cas9 system-edited maize with increased yield has the polynucleotide shown in SEQ ID NO.4 or SEQ ID NO.

5.

8. Maize genes Zm00001eb229100 Its application in creating high-yield maize specifically involves reducing the content of certain nutrients in maize. Zm00001eb229100 A substance for gene expression was introduced into maize, wherein the gene encodes the protein shown in SEQ ID NO.2, and the substance contains knockout, inhibition, or silencing agents. Zm00001eb229100 The nucleic acid molecule of a gene, or the expression cassette of that nucleic acid molecule, recombinant vector, recombinant microorganism.

9. The application according to claim 1 or 8, characterized in that: The aforementioned Zm00001eb229100 The gene is shown in SEQ ID NO.1 or SEQ ID NO.

6.

10. The application according to claim 1, characterized in that: The control of maize yield is achieved by controlling ear length and / or the number of kernels per row.

Images