Application of wheat TaLSY1-A gene in improving wheat immature embryo regeneration efficiency

Overexpression of the TaLSY1-A gene in wheat immature embryos increased the regeneration frequency and seedling rate of wheat, solved the problem of weak wheat regeneration ability, improved the efficiency of wheat genetic transformation, and promoted research on wheat functional genomics and transgenic breeding.

CN121109486APending Publication Date: 2025-12-12SHANDONG AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511589747.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2025-06-12
Filing Date
2025-11-03
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

Among existing genetic transformation methods, wheat has a relatively weak regeneration capacity, resulting in a low proportion of exogenous genes being introduced into wheat and achieving stable transformation. This increases workload and cost, and limits wheat functional research and breeding applications.

Method used

By employing wheat TaLSY1-A gene overexpression technology, constructing a recombinant plant expression vector, and using Agrobacterium-mediated infection of wheat embryos, a technological breakthrough was achieved. This breakthrough addresses the shortcomings of existing technologies, which rely on wheat TaLSY1-A gene overexpression technology. By constructing and using Agrobacterium-mediated infection of wheat embryos, the regeneration frequency and seedling rate of wheat embryos were increased, thereby improving the efficiency of genetic transformation.

Benefits of technology

This study improved the regeneration efficiency of wheat immature embryos, enhanced wheat regeneration capacity, and improved genetic transformation efficiency. It demonstrated that by overexpressing the TaLSY1-A gene in wheat immature embryos, the regeneration frequency and seedling rate of wheat immature embryos were significantly increased, thereby improving the genetic transformation efficiency of wheat.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121109486A_ABST
    Figure CN121109486A_ABST
Patent Text Reader

Abstract

The invention discloses application of a wheat TaLSY1-A gene to improvement of wheat immature embryo regeneration efficiency, and belongs to the technical field of plant genetic engineering. A new wheat regeneration related gene TaLSY1-A is found, and the regeneration efficiency of wheat immature embryos can be improved by over-expressing the TaLSY1-A gene, so that over-expressing the gene and applying the gene to backbone germplasm difficult to regenerate has important economic values and social benefits for improving the genetic transformation efficiency of wheat and further improving the yield and quality of wheat.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of plant genetic engineering, and in particular to a wheat TaLSY1-A gene in improving the regeneration efficiency of wheat immature embryos. BACKGROUND

[0002] Wheat is a staple crop widely planted and consumed around the world, providing a large amount of energy and nutrients for humans. At the same time, the wheat industry occupies an important position in the global economy. In recent years, with the rapid development of genome sequencing technology, a large number of wheat gene function research work needs to be carried out quickly, and efficient, stable and large-scale genetic transformation system needs to be established.

[0003] Through genetic transformation technology, specific excellent genes can be introduced into wheat plants, thereby creating new wheat varieties with more excellent traits. This helps to improve the yield and quality of wheat, meet the growing demand for food of the population and the requirements of consumers for high-quality wheat products. However, the existing genetic transformation method greatly depends on the regeneration ability of wheat, and most of the cultivated varieties have weak regeneration ability, resulting in a low proportion of exogenous gene introduction into wheat and stable transformation, which not only increases the workload and cost, but also limits the functional research and breeding application. Due to the large and complex genome of wheat, the research process of genetic engineering has always lagged behind major crops such as rice and corn. Therefore, it is necessary to excavate the regeneration-related genes in wheat and apply them to improve the regeneration efficiency and transformation efficiency of wheat, and promote the functional genomics and transgenic breeding research of wheat. SUMMARY

[0004] In view of the above prior art, the purpose of the present application is to provide a wheat TaLSY1-A gene in improving the regeneration efficiency of wheat immature embryos. The present application finds a new wheat regeneration-related gene TaLSY1-A , overexpression TaLSY1-A of which can improve the regeneration efficiency of wheat immature embryos and promote the functional genomics and transgenic breeding research of wheat.

[0005] To achieve the above purpose, the technical scheme adopted by the present application is as follows: In the first aspect of the present application, a wheat TaLSY1-A gene in improving the regeneration efficiency of wheat immature embryos is provided; the wheat TaLSY1-A gene is a DNA molecule as shown in i) or ii) or iii) below: i) the nucleotide sequence is a DNA molecule as shown in SEQ ID NO. 1; ii) a DNA molecule encoding the amino acid sequence as shown in SEQ ID NO. 2 other than i); iii) A DNA molecule that has 90% or more identity with the DNA fragment defined in i) or ii) and encodes a protein that is functionally equivalent to the protein shown in SEQ ID NO.2.

[0006] The term "identity" used here refers to sequence similarity to native nucleic acid sequences. Identity can be evaluated using computer software, such as the BLAST algorithm (Altschul). et al. 1990. Journal of Molecular Biology 215:403-410; Karlin and Altschul. 1993. Proceedings of the National Academy of Sciences 90:5873-5877).

[0007] In the aforementioned nucleic acid molecules, the 90% or more identity can be at least 90%, 92%, 93%, 95%, 96%, 98%, or 99% identity.

[0008] A second aspect of the present invention provides the application of wheat TaLSY1-A protein in improving the regeneration efficiency of wheat immature embryos.

[0009] In the above applications, the wheat TaLSY1-A protein is the protein shown in (A1) or (A2) below: (A1) A protein consisting of the amino acid sequence shown in SEQ ID NO.2 of the sequence listing; (A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

[0010] A third aspect of the invention provides a way to promote TaLSY1-A Application of substances that enhance gene expression or increase the activity and / or content of TaLSY1-A protein in improving the regeneration efficiency of wheat embryos.

[0011] In some preferred embodiments of the invention, promoting TaLSY1-A The substance that expresses the gene or increases the activity and / or content of TaLSY1-A protein is any one of the following: C1) contains TaLSY1-A Gene expression cassettes; C2) contains TaLSY1-A Recombinant vectors of genes, or recombinant vectors containing the expression cassette described in C1); C3) contains TaLSY1-A Recombinant microorganisms containing genes, or recombinant microorganisms containing the expression cassette described in C1), or recombinant microorganisms containing the recombinant vector described in C2); C4) contains TaLSY1-A Transgenic plant cell lines containing the gene, or transgenic plant cell lines containing the expression cassette described in C1); C5) contains TaLSY1-A Transgenic plant tissue containing the gene, or transgenic plant tissue containing the expression cassette described in C1); C6) contains TaLSY1-A Transgenic plant organs containing genes, or transgenic plant organs containing the expression cassette described in C1).

[0012] Existing plant expression vectors can be used to construct structures containing... TaLSY1-A Recombinant gene vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of a foreign gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmid genes (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0013] use TaLSY1-A When constructing recombinant plant expression vectors, any type of enhancing promoter or constitutive promoter can be added before the transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing plant expression vectors using the genes of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0014] A fourth aspect of the present invention provides a method for improving the regeneration efficiency of wheat embryos, comprising the following steps: wheat TaLSY1-A Genes are linked into expression vectors to construct recombinant expression vectors. These recombinant expression vectors are then transformed into Agrobacterium competent cells to obtain Agrobacterium strains for transformation. By infecting wheat embryos with Agrobacterium strains, transgenic wheat plants with improved regeneration efficiency were obtained.

[0015] Preferably, the expression vector is the pC186 vector.

[0016] Preferably, the Agrobacterium competent cells are Agrobacterium EHA105.

[0017] The beneficial effects of this invention are: This invention has discovered a new wheat regeneration-related gene. TaLSY1-A Overexpression in wheat embryos TaLSY1-A Genes can significantly increase the regeneration frequency and seedling rate of wheat immature embryos, thereby improving the regeneration efficiency of wheat immature embryos. TaLSY1-A Analysis of gene cellular localization and expression patterns revealed: TaLSY1-A The gene is located in the cell nucleus and acts as a transcription factor to regulate the expression of downstream genes, thereby promoting wheat regeneration.

[0018] Therefore, by overexpressing it in backbone germplasm that is difficult to regenerate... TaLSY1-A Genes can improve the efficiency of wheat genetic transformation and are of great significance for wheat variety improvement and the establishment of genetic transformation systems. Attached Figure Description

[0019] Figure 1 : TaLSY1-A Amino acid sequence comparison diagram with Arabidopsis thaliana AtWUS.

[0020] Figure 2 : TaLSY1-A Homologous protein phylogenetic analysis.

[0021] Figure 3 Wheat overexpression vector pUbi:: TaLSY1-A Schematic diagram of the carrier structure.

[0022] Figure 4 : pUbi:: TaLSY1-A Comparison of the pC186 empty vector transformation process with the control pC186 empty vector transformation process of Fielder wheat embryos; Figures A-D show the tissue culture process of pC186 empty vector transformation of Fielder wheat embryos; CIM: callus induction culture; SIM: differentiation culture.

[0023] Figure 5 Overexpression TaLSY1-A Transformation and statistical analysis of “Shannong 28” data (data is the mean of three replicates).

[0024] Figure 6 : TaLSY1-A The results of the organization expression pattern detection.

[0025] Figure 7 Subcellular localization results of TaLSY1-A. Detailed Implementation

[0026] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0027] As mentioned above, as a heterologous hexaploid, wheat has a large genome and many repetitive sequences, which makes the research process of wheat genetic engineering always lag behind major crops such as rice and corn. At present, the number of isolated and identified wheat regeneration genes is still small.

[0028] The WOX (WUSCHEL-related homeobox) family is a plant-specific transcription factor family, which has many members and diverse functions, such as regulating the growth and development of plant roots, stems, leaves, flowers, fruits and seeds, and regulating plant drought response, cold stress response, etc. It is an important functional gene library of plants. Therefore, it has important research value to mine new wheat regeneration genes from the WOX family.

[0029] The present application has carried out in-depth research on the gene capable of regulating the regeneration efficiency of wheat immature embryo, and the present application has found that the gene TraesCS1A03G0127900 (http: / / wheatomics.sdau.edu.cn / genes / ; version number: genome IWGSC v2.0) has a high expression level in the regeneration process of wheat immature embryo. The inventors name the gene as TraesCS1A03G0127900, the nucleotide sequence of which is shown as SED ID NO. 1, the coding sequence of which is 792 bp in total length, and the amino acid sequence of which is shown as SED ID NO. 2, which encodes 263 amino acids. TaLSY1-A

[0030] The present application amplifies the gene TraesCS1A03G0127900 from the cDNA of Chinese spring wheat shoot tip, and uses the DNA sequence of the CDS full-length fragment of the gene to construct an overexpression vector. TaLSY1-A TaLSY1-A The present application amplifies the gene TraesCS1A03G0127900 from the cDNA of Chinese spring wheat shoot tip, and uses the DNA sequence of the CDS full-length fragment of the gene to construct an overexpression vector. TaLSY1-A The present application amplifies the gene TraesCS1A03G0127900 from the cDNA of Chinese spring wheat shoot tip, and uses the DNA sequence of the CDS full-length fragment of the gene to construct an overexpression vector.

[0031] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific embodiments.

[0032] ​​The experimental materials used in the embodiments of the present application which are not specifically described are conventional experimental materials in the art and can be purchased through commercial channels. In the embodiments of the present application, the specific experimental conditions and methods not specified are generally in accordance with conventional conditions, such as J. Sambrook et al. (eds.), Science Press, 2002, Molecular Cloning Experiments Guide (3rd Edition); D. L. Specter et al. (eds.), Science Press, 2001, Cell Experiment Guide; or in accordance with the conditions recommended by the manufacturer.

[0033] Example 1: TaLSY1-A Construction of gene cloning and plant overexpression vector 1. Extraction and purification of total RNA of wheat: The gene was amplified from Chinese spring wheat TaLSY1-A In this experiment, the RNA extraction kit was provided by Beijing Kangwei Reagent Biotechnology Co., Ltd. The specific experimental steps were carried out according to the instructions of the extraction kit.

[0034] In order to ensure that the quality of RNA meets the requirements, the purity and concentration of the purified RNA sample were detected by spectrophotometer and agarose gel electrophoresis, respectively. The purity and concentration standards are as follows: the purity of RNA is OD 260 / 280 and OD 260 / 230 are both in the range of 1.8-2.0, and the concentration of RNA is in the range of 1.0-2.0 μg / μL.

[0035] 2. Synthesis of cDNA first strand: In this experiment, the synthesis kit of the first strand of cDNA was completed by FastQuant RT Kit (with gDNase) of Tiangen Biotech Co., Ltd.

[0036] 3. TaLSY1-A Cloning of the gene: Using the reverse-transcribed cDNA as a template, the following primer pairs were used for PCR amplification: Upstream primer: 5'-ATGGCGGCGACGGCGACT-3'; Downstream primer: 5'-CTAGGCGACGTCGCGCTG-3'.

[0037] The PCR amplification system is 1 μL of upstream primer (10 pmol / μL), 1 μL of downstream primer (10 pmol / μL), 12.5 μL of 2×Phanta Max Master Mix, 1 μL of cDNA template, and DEPC·H2O to make up the total volume to 25 μL.

[0038] The amplification conditions are: 95 °C pre-denaturation 5 min; 95 °C denaturation 30 s, 60 °C annealing 30 s, 72 °C extension 1 min, cycle 34 times; 72 °C extension 5 min.

[0039] 4. Construction of plant expression vector pUbi::TaLSY1-A (1) 4 μL of PCR product was connected with pENTR TM / D-TOPO Vector carrier, and the operation steps were carried out according to the pENTR TM / D-TOPO Vector product manual.

[0040] (2) The ligation product was transformed into E. coli Top10, and cultured overnight on LB solid medium containing kanamycin (100 mg / L).

[0041] (3) A single colony was picked and cultured overnight in LB liquid medium containing kanamycin (100 mg / L). Plasmid DNA was extracted by alkaline method, and sequence determination was carried out.

[0042] (4) The sequence of the amplified product was analyzed by sequencing, which was shown in SEQ ID NO. 1, indicating that TaLSY1-A the gene has been connected to pENTR TM / D-TOPO Vector carrier, and the cloning vector construction was completed.

[0043] (5) The cloning vector was digested with restriction enzymes ApaI and EcoR V , and the target fragment was detected by electrophoresis and recovered.

[0044] (6) The digested cloning vector was connected with pC186 vector by LR reaction, and the operation steps were carried out according to the LR manual of lifetechnologies company.

[0045] (7) The ligation product was transformed into E. coli Top10, and cultured overnight on LB solid medium containing kanamycin (50 mg / L).

[0046] (8) A single colony was picked and cultured overnight in LB liquid medium containing kanamycin (50 mg / L). Plasmid DNA was extracted by alkaline method, and sequence determination was carried out, and the correct expression vector pUbi::TaLSY1-A ( Figure 3 ) was constructed.

[0047] Example 2: Agrobacterium-mediated transformation of wheat young embryos 1. Wheat genetic transformation: ​The wheat genetic transformation adopts the Agrobacterium-mediated method, and the wheat varieties used for genetic transformation are "Fielder" and "Shannong 28". The specific transformation steps are as follows: (1) Agrobacterium infection: The expression vector constructed in Example 1 pUbi::TaLSY1-A The Agrobacterium EHA105 was transformed to obtain Agrobacterium infection solution for transformation. The prepared Agrobacterium infection solution was sucked into 2 mL centrifuge tubes containing "Fielder" and "Shannong 28" wheat immature embryos, respectively, and mixed gently for 45 s. The immature embryos were immersed in the bacterial solution, and if the immature embryos could not be immersed in the bacterial solution, they could be centrifuged for a short time. After standing for 5 min, the bacterial solution and the immature embryos were poured into a sterile disposable culture dish, and half of the bacterial solution was sucked off.

[0048] (2) Co-culture: The immature embryos were picked up with a sterile and cooled scalpel and placed on the co-culture medium (MS powder 2.12 g, sucrose 10 g, 2,4-D 2 mg, glutamine 5 mg, hydrolyzed casein 0.5 g, silver nitrate 4 mg, agar 8 g, distilled water to 1 L; pH = 5.8). The scalpel was sterilized several times during the operation to prevent contamination and affect subsequent experiments.

[0049] The culture dish was sealed with sealing film and placed in a 23°C dark incubator for co-culture.

[0050] (3) Callus induction culture: After 2 days of co-culture, the hypocotyls of the immature embryos were cut off and placed on the recovery medium (MS powder 2.12 g, sucrose 10 g, 2,4-D 2 mg, glycine 2 mg, silver nitrate 4 mg, vitamin B5 0.5 mg, agar 8 g, distilled water to 1 L; pH = 5.8), and cultured in the dark at 25°C.

[0051] After 5 days, the immature embryo callus began to swell, and the callus began to produce. The swollen callus was transferred to screening medium A (MS powder 2.12 g, sucrose 10 g, zeatin 5 mg, IAA 0.5 mg, glycine 2 mg, hygromycin 15 mg, silver nitrate 4 mg, vitamin B5 0.5 mg, agar 8 g, distilled water to 1 L; pH = 5.8), and the brown and dead immature embryo tissues were discarded. Continue to culture in the dark at 25°C.

[0052] After 14 days, larger callus was formed, and the callus was cut into two halves, with the cut surface touching the medium and being transferred to screening medium B (MS powder 2.12 g, sucrose 10 g, 6-BA 5 mg, IAA 0.5 mg, glycine 2 mg, hygromycin 30 mg, silver nitrate 4 mg, vitamin B5 0.5 mg, agar 8 g, distilled water to 1 L; pH = 5.8), and continue to culture in the dark at 25°C.

[0053] (4) Differentiation culture: After 21 days, the callus tissue was transferred into differentiation medium (MS powder 2.12g, sucrose 10g, zeatin 5mg, IAA 0.5mg, glycine 2mg, hygromycin 15mg, vitamin B5 0.5mg, asparagine 5mg, glutamine 5mg, silver nitrate 4mg, agar 8g, distilled water to a final volume of 1L; pH=5.8). The callus tissue began to differentiate into shoots and was placed in a light incubator at 25℃ and 2000 lx for cultivation.

[0054] After the callus tissue differentiates into green seedlings, they are transferred to rooting medium (MS powder 2.12g, sucrose 10g, IAA 0.5mg, paclobutrazol 0.5mg, glycine 1mg, hygromycin 15mg, vitamin B5 0.5mg, asparagine 5mg, glutamine 5mg, silver nitrate 4mg, agar 8g, distilled water to a final volume of 1L; pH=5.8) until the seedlings have grown 4-5 leaves, then transplanted to a greenhouse or artificial climate chamber for robust seedling cultivation.

[0055] The pC186 empty vector was used as a control, and the transformation conditions were kept consistent.

[0056] 2. Statistical analysis of conversion data To ensure the reliability of the experimental data, we repeated the transformation three times and collected the experimental data three times.

[0057] Number of callus tissue in regenerated buds: The callus has ≥1 bud (bud length ≥2cm); Number of regenerated seedlings: The number of seedlings that can be developed from regenerated buds; Regeneration frequency = (Number of callus tissue in regenerated buds / Number of inoculated embryos) × 100%; Regeneration rate = Number of regenerated seedlings / Number of inoculated embryos × 100%.

[0058] The conversion process of “Fielder” is as follows: Figure 4 As shown. The statistical results for "Shannong 28" are shown below. Figure 5 , transformation TaLSY1- A The regeneration frequency and seedling rate of the transformed vector were significantly higher than those of the transformed control vector pC186; this proves that the transformation... TaLSY1-A It can significantly improve regeneration and the rate of regenerated seedlings.

[0059] Example 3: TaLSY1-A Tissue expression patterns and subcellular localization of proteins 1. TaLSY1-A Organizational expression pattern detection The steps for real-time PCR are as follows: (1) The DNA sequence of the target gene was found using the wheat website WheatOmics 1.0, and its quantitative primers were designed; TaLSY1-A upstream primer: TCGCCTAGCTATATACTACCTCCAA; TaLSY1-A downstream primer: TGGGAATTACAAAGATACGTACTCCT.

[0060] TaLSY1-B upstream primer: ACGTCGCCTAGCTATATACTACCTC; TaLSY1-B downstream primer: ATCGATGGGAATTACAAAGATACGT.

[0061] TaLSY1-D upstream primer: CAACCTATAGCTAGCCACCAGTAG; TaLSY1-D downstream primer: CGATGGGAATTACAAAGATACGTACT.

[0062] (2) Prepare the large system according to the required components and dispense it into quantitative eight-tube strips. The components are shown below: (3) Mix well and centrifuge to remove air bubbles; (4) Place the eight-tube strips sequentially into the real-time PCR instrument. The procedure is as follows: Based on overexpression TaLSY1-A We used qRT-PCR technology to detect its effect on increasing wheat regeneration frequency and seedling rate. TaLSY1-A Based on the tissue expression patterns of homologous genes of this gene in genomes B and D, we extracted roots, stems, leaves, and post-fertilized embryos from Fielder wheat 7 days after germination, as well as young spikelets at different developmental stages (including two-ridge stage - DR, floral primordium differentiation stage - FM, terminal spikelet stage - TS, and heading stage). TaLSY1 All three copies of the gene are expressed in various tissues, with the highest expression in the embryo. Figure 6 A). To further explore TaLSY1-A To investigate its role in increasing wheat regeneration frequency and seedling rate, we also examined the expression pattern of this gene during wheat regeneration and found... TaLSY1 The three copies of the gene were expressed at high levels mainly during the SIM culture stage, indicating that this gene may primarily promote wheat regeneration by promoting shoot formation. We also found... TaLSY1 The three copies of the gene showed very similar expression patterns, suggesting that they may all have the function of promoting wheat regeneration. Figure 6B)。

[0063] 2. Subcellular localization of TaLSY1-A Tobacco transient transformation method (1) Transfer the vector to be transformed into EHA105 Agrobacterium, and screen positive clones; (2) The better growing Agrobacterium is inoculated into 5 mL YEP medium and placed in a 28°C shaker for 12 h; (3) Take 1 mL of bacterial solution and inoculate it into 15 mL of YEP medium and place it in a 28°C shaker for overnight culture; (4) Measure the OD600 value of the bacterial solution and calculate the required volume of the bacterial solution; (5) Take the corresponding volume of bacterial solution and add it to a 2 mL centrifuge tube according to different combinations; (6) Centrifuge at 8000 rpm at room temperature for 2 min; (7) Discard the culture medium and precipitate the bacterial cells with transformation Buffer; (8) Place in a 28°C incubator for dark treatment for 3 h; (9) Inject tobacco according to experimental requirements.

[0064] Based on previous research that WOX family functions as transcription factors to regulate, we used tobacco leaf transient expression of TaLSY1-A fusion GFP protein to detect the subcellular localization of TaLSY1-A, and found that TaLSY1-A is indeed localized in the nucleus, indicating that TaLSY1-A still regulates the expression of downstream genes as a transcription factor to promote wheat regeneration. Figure 7 ).

[0065] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Those skilled in the art can make various modifications and changes to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included within the scope of protection of the present application.

Claims

1. Wheat TaLSY1-A application of the gene in improving the efficiency of wheat young embryo regeneration; characterized in that, The wheat TaLSY1-A The gene is a DNA molecule as shown in i) or ii) or iii): i) the nucleotide sequence is a DNA molecule as shown in SEQ ID NO. 1; ii) a DNA molecule encoding the amino acid sequence as shown in SEQ ID NO. 2 except i); iii) a DNA molecule having 90% or more identity with the DNA fragment defined in i) or ii) and encoding a protein functionally equivalent to the protein as shown in SEQ ID NO.

2.

2. Application of wheat TaLSY1-A protein in improving the efficiency of wheat immature embryo regeneration; the wheat TaLSY1-A protein is the protein as shown in (A1) or (A2) below: (A1) a protein consisting of the amino acid sequence as shown in SEQ ID NO. 2 in the sequence listing; (A2) a fusion protein obtained by connecting a protein tag to the N-terminus and / or C-terminus of the protein defined in (A1).

3. promote TaLSY1-A The use of a substance that promotes gene expression or a substance that increases the activity and / or content of TaLSY1-A protein in increasing the efficiency of wheat young embryo regeneration.

4. Use according to claim 3, characterized in that, promote TaLSY1-A The substance that promotes gene expression or increases the activity and / or content of TaLSY1-A protein is any one of the following: C1) contains TaLSY1-A expression cassette of a gene; C2) comprises TaLSY1-A a recombinant vector of a gene, or a recombinant vector comprising the expression cassette of C1). C3) a recombinant microorganism comprising TaLSY1-A a recombinant microorganism comprising the expression cassette of C1), or a recombinant microorganism comprising the recombinant vector of C2). C4) a transgenic plant cell line comprising TaLSY1-A a transgenic plant cell line of a gene, or a transgenic plant cell line comprising C1) the expression cassette; C5) a transgenic plant tissue comprising TaLSY1-A a transgenic plant tissue of a gene, or a transgenic plant tissue comprising C1) the expression cassette; C6) a transgenic plant organ comprising TaLSY1-A a transgenic plant organ of a gene, or a transgenic plant organ comprising C1) the expression cassette.

5. A method of improving the efficiency of wheat young embryo regeneration, characterized in that, The method comprises the following steps: Wheat TaLSY1-A The gene is ligated into an expression vector to construct a recombinant expression vector, the recombinant expression vector is transformed into competent cells of Agrobacterium, and an Agrobacterium strain for transformation is obtained. The method comprises the following steps:

6. The method of claim 5, wherein, The method comprises the following steps:

7. The method of claim 5, wherein, The expression vector is a pC186 vector. The Agrobacterium competent cell is Agrobacterium EHA105.