Application of BnaWLT8 gene in improving the waterlogging tolerance of Brassica napus

Abstract

The application belongs to the technical field of molecular biology breeding, and particularly relates to application of BnaWLT8 gene in improving waterlogging stress tolerance of Brassica napus. The nucleotide sequence of the BnaWLT8 gene is shown as SEQ ID NO. 1. The oilseed rape waterlogging tolerance related gene BnaWLT8 provided by the application provides excellent gene resources and a new effective way for improving waterlogging stress tolerance of Brassica napus and cultivating new waterlogging-tolerant Brassica napus varieties. Through transgenic genetic breeding, the expression level of the BnaWLT8 gene can be enhanced, so that the waterlogging tolerance and waterlogging and flood resistance of the Brassica napus at the germination stage and seedling stage can be significantly enhanced, and the application prospect is wide and the social benefit is good in the improvement of the Brassica napus resistance.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology breeding, and particularly relates to application of BnaWLT8 gene in improving waterlogging stress tolerance of Brassica napus. BACKGROUND

[0002] Brassica napus belongs to Brassica of Cruciferae, is one of the four major oil crops in the world, and is also the main source of edible vegetable oil in China. In addition to being used for extracting edible oil and feed, Brassica napus can also be used to make artificial butter and artificial protein in the food industry, and has important economic value. The Yangtze River Basin is the main production area of Brassica napus in China, and the planting area and yield of Brassica napus in this region account for more than 90% of the total in China. However, the soil in this region is heavy and poorly ventilated, the groundwater level is high, drainage is difficult, and the plum rain season lasts for a long time, and the root system of Brassica napus lacks aeration tissue, so Brassica napus is prone to suffer from waterlogging stress and flooding stress (collectively referred to as waterlogging stress), which is one of the main stress conditions faced by Brassica napus. Under certain duration of waterlogging conditions, the oxygen content in the rhizosphere of the plant will rapidly decrease, thereby causing a low-oxygen or anoxic state in the root system and / or leaf tissue of the plant, and low oxygen is also often used as a signal factor to affect the metabolism and development process of the plant in organs or tissues with high oxygen consumption such as seeds, fruits, root tips and stem tip meristems, and poses a serious threat to the survival of the plant. Brassica napus suffering from waterlogging has a decreased emergence rate at the germination stage, reduced biomass at the seedling stage, poor fertilization at the flowering stage, increased shriveled grains at the silique stage, and also causes early senescence and lodging of Brassica napus and aggravates the occurrence and spread of diseases such as sclerotinia, resulting in a 20%-30% yield loss and hundreds of millions of economic losses, so waterlogging has become one of the key factors restricting the production of Brassica napus. Therefore, enhancing the stress resistance of Brassica napus under waterlogging and ensuring the stable yield of crops after waterlogging disaster is an important factor for the sustainable development of the Brassica napus industry.

[0003] With the development of molecular biology, it has broad development prospects to use genetic engineering technology to cultivate new germplasm of crops resistant to waterlogging stress. Analyzing the regulation and adaptation mechanisms of Brassica napus to waterlogging stress and mining waterlogging-resistant genes are important prerequisites for breeding stress-resistant varieties. At present, there are few studies on the waterlogging resistance of Brassica napus, especially Brassica napus, and few available genetic resources. Therefore, mining of excellent waterlogging-resistant genes of Brassica napus, analysis of the regulation mechanism and establishment of transgenic genetic breeding technology are of great significance for improving the waterlogging and flooding resistance of Brassica napus, improving Brassica napus varieties and expanding the planting area of Brassica napus. SUMMARY

[0004] In view of the above technical problems in the prior art, the application excavates a gene BnaWLT8 related to waterlogging tolerance from oilseed rape, the gene has a positive regulation effect on improving the waterlogging stress resistance of oilseed rape, and provides an excellent gene resource for improving the waterlogging stress resistance of oilseed rape and cultivating new waterlogging-tolerant varieties of oilseed rape, and provides a new effective way for cultivating new waterlogging-tolerant varieties of oilseed rape.

[0005] The application provides the application of the BnaWLT8 gene in improving the waterlogging stress resistance of oilseed rape, and the nucleotide sequence of the BnaWLT8 gene is shown as SEQ ID NO. 1.

[0006] Further, the application comprises: increasing the expression amount of the BnaWLT8 gene to enhance the waterlogging stress resistance of oilseed rape.

[0007] Further, the reagent for increasing the expression amount of the BnaWLT8 gene is selected from one of (A)-(C):

[0008] (A), a nucleic acid molecule comprising the full-length coding region of the BnaWLT8 gene;

[0009] (B), a recombinant plant expression vector comprising the nucleic acid molecule in (A);

[0010] (C), a recombinant microorganism comprising the recombinant plant expression vector in (B).

[0011] Further, the recombinant plant expression vector is pCambia1302, and the recombinant microorganism is Agrobacterium.

[0012] Further, the method for increasing the expression amount of the BnaWLT8 gene comprises:

[0013] constructing a BnaWLT8 gene overexpression vector, wherein the BnaWLT8 gene overexpression vector contains the full-length coding region of the BnaWLT8 gene;

[0014] transforming the BnaWLT8 gene overexpression vector into wild-type oilseed rape, and culturing to obtain the oilseed rape plant with increased expression level of the BnaWLT8 gene.

[0015] Further, the construction of the BnaWLT8 gene overexpression vector comprises:

[0016] using oilseed rape cDNA as a template, and performing PCR amplification by using primers shown as SEQ ID NO. 6-7 to obtain the full-length coding region of the BnaWLT8 gene;

[0017] linearized pCambia1302 expression vector is obtained by using SpeI and PstI restriction endonuclease to cut pCambia1302 expression vector;

[0018] The full-length coding region of the BnaWLT8 gene is connected with the linearized pCambia1302 expression vector, so that the BnaWLT8 gene gene overexpression vector is obtained.

[0019] Further, the improvement of the waterlogging stress tolerance of the oilseed rape is to improve the growth performance of the oilseed rape under the waterlogging stress, and the growth performance includes at least one of the following (1)-(2):

[0020] (1) the root length in the germination stage under the waterlogging stress;

[0021] (2) at least one of the fresh weight of the shoot, the fresh weight of the root, the number of lateral roots and the root surface area in the seedling stage under the waterlogging stress.

[0022] Further, the oilseed rape is Brassica napus.

[0023] The second aspect of the present application provides application of a reagent for improving the expression amount of the BnaWLT8 gene in improving the waterlogging stress tolerance of the oilseed rape, and the reagent for improving the expression amount of the BnaWLT8 gene is selected from one of the following (A)-(C):

[0024] (A) a nucleic acid molecule containing the full-length coding region of the BnaWLT8 gene;

[0025] (B) a recombinant plant expression vector containing the nucleic acid molecule in (A);

[0026] (C) a recombinant microorganism containing the recombinant plant expression vector in (B).

[0027] The third aspect of the present application provides a breeding method of the waterlogging stress tolerant oilseed rape, including the following steps:

[0028] The expression amount of the BnaWLT8 gene in the oilseed rape plant is improved, and the nucleotide sequence of the BnaWLT8 gene is shown in SEQ ID NO. 1.

[0029] The advantages and positive effects of the present application are:

[0030] The oilseed rape waterlogging tolerance related gene BnaWLT8 provided by the present application provides excellent gene resources and a new effective way for improving the waterlogging stress tolerance of the oilseed rape and cultivating new varieties of the waterlogging stress tolerant Brassica napus. BRIEF DESCRIPTION OF DRAWINGS

[0031] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings used in the embodiment description are briefly introduced as follows.

[0032] Figure 1 A Manhattan plot for identifying the chromosome segment related to the seedling stage waterlogging tolerance of rapeseed by whole genome association analysis in the embodiments of the present application;

[0033] Figure 2 A linkage disequilibrium analysis result plot of the peak SNP about 0.1 Mb segment of the A08 chromosome of rapeseed in the embodiments of the present application;

[0034] Figure 3 Relative expression levels of the BnaWLT8 gene of rapeseed under normal and waterlogging treatment at different times in the embodiments of the present application;

[0035] Figure 4 Relative expression levels of the BnaWLT8 gene of rapeseed under normal and waterlogging treatment in waterlogging sensitive and waterlogging resistant rapeseed materials in the embodiments of the present application;

[0036] Figure 5 Relative expression levels of the BnaWLT8 gene in the BnaWLT8 gene overexpression material and the BnaWLT8 gene in the double 11 material in the embodiments of the present application;

[0037] Figure 6 Waterlogging phenotype analysis plots of the BnaWLT8 gene overexpression material and the wild type and the double 11 material at the germination stage in the embodiments of the present application, wherein Fig. A is a root system actual object plot of the germinating seeds, and Fig. B is a relative root length statistical value;

[0038] Figure 7 Waterlogging phenotype analysis plots of the BnaWLT8 gene overexpression material and the wild type and the double 11 material at the seedling stage in the embodiments of the present application. DETAILED DESCRIPTION

[0039] In order to make the objects, technical solutions and advantages of the present application clearer, the present application is further described in detail below in combination with embodiments. The embodiments described herein are only used to explain the present application, and are not used to limit the present application.

[0040] In light of the information contained in this disclosure, changes can be readily made to the precise description of the application according to the disclosure and such changes are deemed to be encompassed within the spirit and scope of the appended claims. It is also understood that the scope of the application is not limited to the particular processes, compositions, or components described, as such processes, compositions, and components can vary. It is also noted that the specific drug dosages and time periods for treatment can vary and depend upon the particular subject undergoing treatment, the particular agent being administered, and the particular indication being treated. It is intended, therefore, to cover all such changes and modifications of the application, within the scope of the appended claims, and all such changes and modifications are considered to be within the scope of the application.

[0041] In order that the application herein described can be more fully understood, and so that further objects and advantages thereof can be appreciated, the following detailed description of the application will be rendered by reference to a certain embodiments thereof, which are illustrated in the accompanying drawings.

[0042] Further, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0043] It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. The use of the terms "including," "comprising," "having," "containing," and variations thereof, in this disclosure, is meant to encompass the items listed thereafter, and equivalents thereof, as well as additional items. The use of the terms "consisting of," "consisting essentially of," and variations thereof, in this disclosure, is meant to encompass only the items listed thereafter, and equivalents thereof.

[0044] The term "and / or" should be understood to mean either one or both of the items so conjoined, i.e., conjunctive language such as the phrase "and / or" unless such context requires otherwise. It is further noted that the use of certain terms in various places in the specification is for the purpose of more clearly and concisely conveying the meaning intended and should not be taken as limiting of the term so used in others.

[0045] To make the purpose, features of the present application more obvious and easy to understand, the technical principles and specific embodiments of the present application are described in detail below.

[0046] Water is an important non-biological factor affecting the growth and development of crops, and excessive or insufficient water will cause different degrees of harm to crops, and is one of the main abiotic stresses suffered by plants. Waterlogging stress refers to the phenomenon that plants are subjected to excessive water, insufficient oxygen supply and other pressures during growth due to excessive soil water or long-term waterlogging environment, resulting in physiological function disorder and growth and development inhibition. Excessive water in soil generally has two states: one is that the soil water exceeds the maximum water holding capacity and is in a saturated state, and the soil gas phase is completely replaced by the liquid phase, i.e. "waterlogging", also known as waterlogging or wet damage; the other is that the water not only fills the soil but also covers the ground, submerging part or the whole plant, which is usually called "flood damage".

[0047] The present application takes 418 Brassica napus germplasm resource groups as research materials, carries out waterlogging stress treatment, counts the aboveground fresh weight of each material as the phenotype data, carries out whole genome association analysis (GWAS) combined with the sequencing data of 418 Brassica napus germplasm resources, digs out the single nucleotide polymorphism (SNP) site significantly associated with the phenotype trait, carries out linkage disequilibrium (LD) analysis on the genes in the segment near the SNP site, and screens out a candidate gene BnaA08G0205900ZS (nucleotide sequence as shown in SEQ ID NO. 1) responding to waterlogging stress, and according to the function, is named as BnaWLT8. Further analysis of the expression level change of BnaWLT8 gene in Brassica napus under normal conditions and waterlogging stress conditions shows that BnaWLT8 is induced to express in the waterlogging environment, and the expression difference is obvious in the waterlogging-resistant germplasm and the sensitive germplasm, and it is speculated that the gene may play an important role in the process of resisting waterlogging stress of Brassica napus.

[0048] In the present application, BnaWLT8 gene is cloned from Brassica napus, and an overexpression vector thereof is constructed, and wild type rapeseed (Zhongshuang No. 11) is transformed, and the growth and development phenotypes of the transgenic lines and wild type rapeseed plants under normal conditions and waterlogging stress conditions are evaluated, and it is found that the relative root length in the germination stage, the aboveground fresh weight in the seedling stage, the root fresh weight and the lateral root number and the lateral root number and the root surface area and other important indexes of the overexpression BnaWLT8 gene lines under waterlogging stress are higher than those of the wild type plants, and it is indicated that BnaWLT8 has an important role in regulating the waterlogging stress resistance of Brassica napus. The biological function of BnaWLT8 in enhancing the waterlogging resistance of Brassica napus is identified, and it has certain theoretical guiding significance for studying the response and waterlogging resistance regulation molecular mechanism of plants in response to waterlogging stress, and has very important practical significance for revealing the waterlogging resistance mechanism of Brassica napus and cultivating new waterlogging-resistant varieties.

[0049] Based on this, an embodiment of the present application provides application of BnaWLT8 gene in improving waterlogging stress resistance of rapeseed, and the nucleotide sequence of the BnaWLT8 gene is shown in SEQ ID NO. 1.

[0050] The application utilizes a method of whole genome association analysis combined with gene expression and transgenic verification, discovers a rapier tolerance related gene BnaWLT8 of rape, provides excellent gene resources and a new effective way for improving the waterlogging stress resistance performance of rape and cultivating new rapier varieties with waterlogging tolerance, and has a wide application prospect and good social benefits in the improvement of the waterlogging stress resistance of rape and the like through transgenic breeding and the enhancement of the expression level of the BnaWLT8 gene, which can significantly enhance the waterlogging stress resistance and waterlogging resistance of rape at the germination stage and seedling stage. Moreover, the rapier tolerance gene identified in the application is from a plant itself and has a smaller impact on the environment, so the use of the gene in the genetic improvement and molecular breeding of the waterlogging stress resistance of rape has important significance for cultivating new rapier varieties with strong waterlogging tolerance and flood resistance.

[0051] Optionally, the application comprises enhancing the waterlogging stress resistance of rape by increasing the expression amount of the BnaWLT8 gene.

[0052] Optionally, the reagent for increasing the expression amount of the BnaWLT8 gene is selected from one of the following (A)-(C):

[0053] (A), a nucleic acid molecule comprising the full-length coding region of the BnaWLT8 gene;

[0054] (B), a recombinant plant expression vector comprising the nucleic acid molecule in (A);

[0055] (C), a recombinant microorganism comprising the recombinant plant expression vector in (B).

[0056] The plant expression vector can be a commonly used binary expression vector pCambia1302, and the microorganism can be agrobacterium or other microorganisms that can mediate transformation or transfection, such as lentivirus, adenovirus, etc.

[0057] Optionally, the method for increasing the expression amount of the BnaWLT8 gene comprises constructing a BnaWLT8 gene overexpression vector, wherein the BnaWLT8 gene overexpression vector contains the full-length coding region of the BnaWLT8 gene; and transforming the BnaWLT8 gene overexpression vector into wild-type rape to obtain rape plants with an increased expression level of the BnaWLT8 gene.

[0058] Optionally, the construction of the BnaWLT8 gene overexpression vector comprises: using rape cDNA as a template, and performing PCR amplification by using primers as shown in SEQ ID NO. 6-7 to obtain a full-length coding region of the BnaWLT8 gene; using a SpeI and PstI restriction endonuclease to cut a pCambia1302 expression vector to obtain a linearized pCambia1302 expression vector; and connecting the full-length coding region of the BnaWLT8 gene and the linearized pCambia1302 expression vector to obtain the BnaWLT8 gene overexpression vector.

[0059] The transformation of the above-mentioned overexpression vector into cells or tissues of a wild-type rape plant can be performed by using conventional techniques well known to those skilled in the art, such as a calcium phosphate coprecipitation method, a Ti plasmid method, a Ri plasmid method, a viral vector method, a gene gun method, a microinjection method, an electroporation method, or an Agrobacterium-mediated method.

[0060] Optionally, the improvement of the waterlogging stress tolerance of the rape is to improve the growth performance of the rape under waterlogging stress, and the growth performance comprises at least one of the following (1)-(2):

[0061] (1) root length at a germination stage under waterlogging stress;

[0062] (2) at least one of the following: fresh weight of shoots, fresh weight of roots, number of lateral roots, and root surface area at a seedling stage under waterlogging stress.

[0063] The above-mentioned rape is Brassica napus.

[0064] The embodiment of the present application also provides application of a reagent for improving the expression amount of the BnaWLT8 gene in improving the waterlogging stress tolerance of the rape.

[0065] Based on the same inventive concept, the embodiment of the present application also provides a breeding method of a waterlogging stress-tolerant rape, comprising the following steps:

[0066] The expression amount of the BnaWLT8 gene in the rape plant is improved, and the nucleotide sequence of the BnaWLT8 gene is shown in SEQ ID NO. 1.

[0067] The method for improving the expression amount of the BnaWLT8 gene in the rape plant is the same as that in the above-mentioned embodiment, and the embodiment will not be described herein.

[0068] The present application will be further described in conjunction with specific examples. The experimental methods in the following examples, for which no specific conditions are indicated, are usually performed according to conventional conditions, for example, the conditions described in the Molecular Cloning: A Laboratory Manual (Fourth Edition) published by Cold Spring Harbor Laboratory, or the conditions recommended by the manufacturers. In addition, the materials and reagents used in the following examples, unless otherwise specified, can be obtained from commercial channels.

[0069] Embodiments

[0070] 1. Phenotyping of aboveground fresh weight of Brassica napus population resources under waterlogging stress

[0071] The test materials of this study are 418 Brassica napus L. diversity germplasm resources which can be divided into Asian resources (231), European resources (145), North American resources (23), and Oceanian resources (19) according to the source of germplasm. The materials are provided by the National Oil Crop Germplasm Resource Medium-term Bank (Wuhan), and the Brassica napus germplasm resources used in this invention can be obtained by signing the "Oilseed Rape Germplasm Resource Utilization Agreement" with the Chinese Academy of Agricultural Sciences and filling out the "Oilseed Rape Germplasm Resource Utilization Registration Form". The public can also obtain related germplasm resource materials from the applicant, but only for repeated use in the invention experiments, and not for other purposes.

[0072] The 418 Brassica napus germplasms were planted in seedling trays on October 8, 2023, with 6 replicates and 8 plants per replicate. Under outdoor field conditions, when they grew to the two-leaf-one-heart stage, 3 replicates were selected for waterlogging treatment, keeping the water surface about 1 cm higher than the soil surface, and the other 3 replicates were normally grown as the control group. After 2 weeks, the waterlogging stress group was restored to normal growth for 1 week, and then the aboveground fresh weight data of the control group (CK) and the waterlogging group (T) were collected for analysis to obtain the T / CK value.

[0073] 2. Discovery of candidate genes related to waterlogging tolerance in Brassica napus

[0074] (1) Genotype data collection and analysis

[0075] Genotype data of all accessions were obtained by whole-genome sequencing platform (Illumina HiSeq 4000 platform, sequencing depth of 17x). The information of 418 Brassica napus accessions and their sequencing data were recorded in the literature “Hu J, Chen B, Zhao J, Zhang F, Xie T, Xu K, Gao G, Yan G, Li H, Li L, Ji G, An H, Li H, Huang Q, Zhang M, Wu J, Song W, Zhang X, Luo Y, Chris Pires J, Batley J, Tian S, Wu X. Genomic selection and genetic architecture of agronomic traits during modern rapeseed breeding. Nat Genet. (2022); 54:694-704. doi: 10.1038 / s41588-022-01055-6.”. The original sequencing data was released in the SRA (Sequence Read Archive) resource library in NCBI, project number PRJNA416679, and in the GSA (Genome Sequence Archive) database of the BIG Data Center, project number CRA005979.

[0076] Single nucleotide polymorphism (SNP) genotype data were obtained with Zhongshuang 11 (ZS11.v0) as the reference genome (access link: https: / / yanglab.hzau.edu.cn / BnIR / germplasm_info?id=ZS11.v0, the reference genome data was published in the literature “Song, J.M. et al. Eight high-quality genomes reveal pan-genome architecture and ecotype differentiation of Brassica napus. Nat. Plants 6, 34-45 (2020).”).

[0077] (2) Genome-wide association analysis and candidate gene mining

[0078] The T / CK data of 418 materials and the SNP genotype data were combined for whole genome association analysis (GWAS) by using FaST-LMM software (version 0.4.6), and a mixed linear model (MLM) was used. The Manhattan plot was drawn by using the CMplot package of R software, the threshold of SNP sites significantly associated with phenotype data and resequencing data was set to be -log10(p)=5.0, and the candidate gene segment was located in the 200 kb before and after the significantly associated SNP site. As shown in FIG. 1 (the abscissa is the chromosome number, and the ordinate is the SNP site -log10(p) value), there is a significant association signal of the T / CK of the aboveground fresh weight on the A08 chromosome. The linkage disequilibrium (LD) analysis (see FIG. 2) was performed on the segment near the peak SNP, and the candidate gene BnaA08G0205900ZS (BnaJAZ8) was found in the LD segment linked to the peak SNP. Figure 1 Figure 2

[0079] According to the annotation information of the homologous genes of Arabidopsis thaliana, it was found that the gene is involved in non-biological stress response in Arabidopsis thaliana. Therefore, according to the functional analysis, the candidate gene BnaA08G0205900ZS was named Waterlogging Tolerant gene 8 (WLT8).

[0080] The nucleotide sequence of the Brassica napus WLT8 gene (BnaWLT8) is as follows:

[0081] ​​ATGGAGAAAAACTGCGACTTGGAACTTCGTCTCTTTCCAACATCTTCTTATGATGAATCAGATACCTCGTAAGTCTCTCTCTCTCTCTCTGGACTCAAATCTATGAAATTTAACTACATACATGAATCTAATAAAGTTTACATTTAACTGATTTGAAGTGTGGTAGAATCAAGAAGCTCTGGAAACTCACTACCAAAAGAGGAAGAATCTCAGAGGATAACAATTTTCTACAATGGAAAAATGTGTGTTTCTTCGAATGTTACCCATCTTCAGGTATGTACATATATAATTATATACACAGTCATTTATATGATTATATTTTATAAGCAATTAATGGATCTTATTAACCATTAATGTTTTTTATGAATGAATGCAGGCTAAATCTATAATATCGATCGCGAGTAGAGAGATGGAAGAGAGGTCATCCTCAAACGGGTCGGATCCTCGGAACAGGTTGACAAGATTACATCATCATCAGCTTCCAAATCCAAAGGCTTCTATGAAAAGATCTCTTCAAAGTTTTCTTCAGAAACGGAGGATTCGAATTCAAGCAGCTTCACCTTACCATCAGCATTCACGACGATAG (see SEQ ID NO. 1).

[0082] 3. Waterlogging response analysis of BnaWLT8 gene

[0083] To further analyze whether BnaWLT8 gene is involved in waterlogging response, full and uniform Brassica napus Zhongshuang 11 (ZS11) seeds were selected, germinated on filter paper to 1 mm, 30 normal growths were selected as control (CK), 30 were treated with waterlogging (WL), sampled at 0 h, 2 h, 4 h, 8 h, 12 h and 24 h, RNA was extracted by total RNA extraction kit (catalog number ET101-01-V2), and cDNA was reverse transcribed by Nuaidan RNA HiScript Q RT SuperMix for qPCR (+gDNAwiper) reverse transcription kit (catalog number R223-01), then fluorescence quantitative kit (catalog number Q711-03) was used, WLT8-F and WLT8-R primer pairs were used for fluorescence quantitative PCR (qPCR), and the reference gene was Actin. The primer sequences used are as follows:

[0084] q-Actin-F: TTCCTGTGTTTTATCCATGTAGCC (see SEQ ID NO. 2);

[0085] q-Actin-R: CAGTCACTCTCCTACGAACATGATAG (see SEQ ID NO. 3);

[0086] q-WLT8-F: TCGGAACAGGTTGACAAGATTA (see SEQ ID NO. 4);

[0087] q-WLT8-R: GAATTCGAATCCTCCGTTTCTG (see SEQ ID NO. 5).

[0088] Using 2 -△△Ct Method analysis of BnaWLT8 expression levels, results are shown in Figure 3 , wherein the abscissa is the grouping and flooding stress treatment time, the ordinate is the relative expression of the gene. It was found that BnaWLT8 gene expression was significantly up-regulated after waterlogging.

[0089] In addition, using the same qPCR method, from 418 population selected representative 2AF455 and sensitive 2AF453 each 1 copy of the waterlogging tolerance materials, in normal growth (CK) and waterlogging treatment 2 weeks (WL) each sample extraction RNA, reverse into cDNA after fluorescence quantitative PCR, analysis of BnaWLT8 expression levels, found that after waterlogging treatment, in waterlogging tolerance material 2AF455 BnaWLT8 expression strongly up-regulated and sensitive material 2AF453 no significant difference (see Figure 4 ), indicating that BnaWLT8 gene involved in waterlogging response of rape.

[0090] 4, BnaWLT8 gene overexpression plant resistance to waterlogging stress performance evaluation

[0091] In order to verify the function of BnaWLT8 gene under waterlogging stress, the overexpression vector of BnaWLT8 gene was constructed, which was transferred into Brassica napus ZS11, and the transgenic positive lines were screened.

[0092] Construction of BnaWLT8 gene overexpression vector: the plant binary expression vector pCambia1302 (purchased from Cambia organization: http: / / cambia.org) was double enzyme cut with Spe I and Pst I restriction endonuclease, then the cDNA of ZS11 was used as a template, the primer pair WLT8-F and WLT8-R was used to amplify the coding sequence (CDS) sequence of BnaWLT8 gene (BnaWLT8-CDS) using Vazyme high-fidelity enzyme (Vazyme #P526), and then the BnaWLT8-CDS fragment was connected to the vector pCambia1302 using Vazyme ClonExpress UltraOne Step Cloning Kit V3 kit (item number C117) to complete homologous recombination, and the BnaWLT8 gene overexpression vector pCambia1302-BnaWLT8 was obtained. The primer sequences are as follows:

[0093] WLT8-F: CTTGATATCGAATTCCTGCAGATGGAGAAAAACTGCGACTTGG (see SEQ ID NO. 6);

[0094] WLT8-R: GCCCTTGCTCACCATACTAGTTCGTCGTGAATGCTGATGGT (see SEQ ID NO. 7).

[0095] The expression vector pCambia1302-BnaWLT8 was transformed into rape by Agrobacterium-mediated method, and 3 overexpression positive (OE) lines OE-1, OE-3 and OE-8 were selected. The genetic transformation method of Brassica napus was referred to the transformation method of the State Key Laboratory of Crop Genetic Improvement of Huazhong Agricultural University (see the literature "Cheng Dai et al., An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus, Mol Breeding, 2020, 40:96") to introduce the foreign fragment into Brassica napus by Agrobacterium infection method using Brassica napus sterile seedling hypocotyl as explant; the positive lines were selected by detecting the expression amount of the target gene, and the primers were q-WLT8-F: TCGGAACAGGTTGACAAGATTA and q-WLT8-R: GAATTCGAATCCTCCGTTTCTG. The BnaWLT8 expression amount of the 3 overexpression lines was detected by qPCR, and it was found that the BnaWLT8 gene was up-regulated by 40-100 times compared with ZS11 (see Figure 5 ).

[0096] The seeds of the OE-1, OE-3 and OE-8 transgenic plants were collected for germination experiments. The seeds of ZS11, OE-1, OE-3 and OE-8 were germinated to about 1 mm of sprouting, and then a part of the seeds were treated with flooding for 12 h, and then placed in germination bags for normal growth for 6 days, and the phenotypes were photographed and the data were counted. The results are shown in Figure 6 Fig. A is a photograph of the root system of the germinated seeds, and Fig. B is the relative root length value (WL / CK) obtained according to Fig. A. As can be seen from the figures, the root length of the overexpression material is longer than that of ZS11, and the relative root length (WL / CK) data shows that the overexpression plants are significantly higher than ZS11, indicating that overexpression of the BnaWLT8 gene improves the waterlogging tolerance of the rape at the germination stage.

[0097] The germinated seedlings were cultured, and then seedling stage function verification was performed. ZS11 and OE-1, OE-3 and OE-8 plants were cultured under conventional culture conditions to the 2-3 leaf stage, and then waterlogging stress test was started. The materials with healthy growth, uniform seedling growth and basically uniform plant size were selected and randomly divided into two groups, one of which was normally cultured, and the other was subjected to waterlogging treatment, with the water surface being 1-2 cm higher than the soil surface. After 2 weeks of treatment, the roots were washed, the phenotypes of the seedlings under normal growth (CK) and waterlogging treatment (WL) were photographed, and the fresh weight of different parts and other indicators were measured. The results are shown in Figure 7 Fig. A is a photograph of the root system of the germinated seeds, and Fig. B is the relative root length value (WL / CK) obtained according to Fig. A. As can be seen from the figures, the root length of the overexpression material is longer than that of ZS11, and the relative root length (WL / CK) data shows that the overexpression plants are significantly higher than ZS11, indicating that overexpression of the BnaWLT8 gene improves the waterlogging tolerance of the rape at the germination stage. 2 It was found that under normal growth conditions, there was no obvious difference in the phenotype between the overexpression material and ZS11. After waterlogging treatment, the overexpression lines had no injury symptoms, and the number of lateral roots was significantly more than that of ZS11. It was found by statistics that the overground fresh weight of the overexpression lines was higher than that of the wild type, and the root fresh weight, lateral root number and root surface area of the overexpression lines were significantly better than those of ZS11, indicating that the expression of the BnaWLT8 gene can enhance the waterlogging tolerance and anti-waterlogging ability of the rape at the seedling stage.

[0098] The above results show that overexpression of the BnaWLT8 gene improves the tolerance of the rape to waterlogging treatment, and confirms that the BnaWLT8 gene has the function of regulating the waterlogging stress resistance of the rape. Utilization of the gene for molecular breeding of rape with waterlogging tolerance genetic improvement has very important significance for breeding new varieties of strong waterlogging-tolerant Brassica napus.

[0099] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modification, equivalent replacement and improvement made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. BnaWLT8 The application of genes in improving the tolerance of rapeseed to flooding stress is characterized by, By improving the BnaWLT8 The expression level of the gene enhances the flood stress tolerance of rapeseed, wherein the... BnaWLT8 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the rapeseed is Brassica napus.

2. As described in claim 1 BnaWLT8 The application of genes in improving the tolerance of rapeseed to flooding stress is characterized by, Improve the BnaWLT8 The reagent for gene expression levels is selected from one of the following (A)-(C): (A) Includes the above BnaWLT8 Nucleic acid molecules in the full-length coding region of a gene; (B) A recombinant plant expression vector containing the nucleic acid molecules described in (A); (C) Recombinant microorganisms containing the recombinant plant expression vector described in (B).

3. As described in claim 2 BnaWLT8 The application of genes in improving the tolerance of rapeseed to flooding stress is characterized by, The recombinant plant expression vector is pCambia1302, and the recombinant microorganism is Agrobacterium.

4. As described in claim 1 BnaWLT8 The application of genes in improving the tolerance of rapeseed to flooding stress is characterized by, Improve the BnaWLT8 Methods for measuring gene expression levels include: Build BnaWLT8 Gene overexpression vector, the BnaWLT8 The gene overexpression vector contains the above BnaWLT8 The full-length coding region of a gene; The BnaWLT8 The gene overexpression vector was transformed into wild-type rapeseed, and the resulting product was cultured. BnaWLT8 Rapeseed plants with increased gene expression levels.

5. The method according to claim 4 BnaWLT8 The application of genes in improving the tolerance of rapeseed to flooding stress is characterized by, The BnaWLT8 The construction of gene overexpression vectors includes: Using rapeseed cDNA as a template, PCR amplification was performed using the primer pairs shown in SEQ ID NO. 6-7 to obtain the... BnaWLT8 The full-length coding region of a gene; The pCambia1302 expression vector was linearized by digesting it with SpeI and PstI restriction endonucleases. The BnaWLT8 The full-length coding region of the gene was linked to the linearized pCambia1302 expression vector to construct the [the gene]. BnaWLT8 Gene overexpression vector.

6. The method according to claim 1 BnaWLT8 The application of genes in improving the tolerance of rapeseed to flooding stress is characterized by, To improve the growth performance of rapeseed under flood stress, the growth performance includes at least one of the following (1)-(2): (1) Root length during germination under flood stress; (2) At least one of the aboveground fresh weight, root fresh weight, number of lateral roots and root surface area during the seedling stage under flood stress.

7. Improve BnaWLT8 The application of a gene expression leveling agent in improving the flood tolerance of rapeseed is characterized by, Improve the BnaWLT8 The reagent for gene expression levels is selected from one of the following (A)-(C): (A) Includes the above BnaWLT8 Nucleic acid molecules in the full-length coding region of a gene; (B) A recombinant plant expression vector containing the nucleic acid molecules described in (A); (C) Recombinant microorganisms containing the recombinant plant expression vector described in (B); Among them, the BnaWLT8 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the rapeseed is Brassica napus.

8. A breeding method for rapeseed tolerant to flooding stress, characterized in that, Includes the following steps: Increase the concentration of rapeseed plants BnaWLT8 The expression level of the gene, the BnaWLT8 The nucleotide sequence of the gene is shown in SEQ ID NO.1; wherein the rapeseed is Brassica napus.

Images