HTNV host binding protein screening system established based on CRISPR / dCas13 system and application of HTNV host binding protein screening system

Abstract

The invention relates to an HTNV host binding protein screening system established based on a CRISPR / dCas13 system and application of the HTNV host binding protein screening system. The screening system comprises dCas13 protein and crRNA. The dCas13 protein is a dCasRx protein, and the dCasRx protein is a The crRNA comprises crRNA2 and crRNA7, and the sequences of the crRNA2 and the crRNA7 are respectively SEQ ID NO: 2 and SEQ ID NO: 7. The screening system for screening the HTNV-S-RNA host binding protein is established by utilizing a CRISPR / dCasRx system, the feasibility of the screening system is verified through experiments, meanwhile, the screened candidate protein is verified to have obvious influence on HTNV replication, and a new thought is provided for researching an HTNV virus replication mechanism and discovering a new antiviral treatment target.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of antiviral therapy, and particularly relates to an HTNV host binding protein screening system based on a CRISPR / dCas13 system and application thereof. BACKGROUND

[0002] Hantaan virus (HTNV) belongs to the Bunyaviridae class, the Hantaviridae family, the Orthohantavirus genus, and is mainly distributed in East Asia (China, South Korea, and the Far East of Russia) and some regions in Europe, and takes rodents such as wild mice as the main natural host, and the virus is transmitted through urine, feces or saliva. The virus is transmitted to humans through rodents, and can cause severe Hemorrhagic fever with renal syndrome (HFRS), and rapid disease progression may increase the mortality rate if treatment is delayed.

[0003] HTNV is an enveloped pleomorphic virus particle, and the genome is a single-stranded negative-strand RNA, which is divided into L, M and S segments. The viral genomic RNA is used as a template to synthesize complementary viral full-length positive-strand RNA (cRNA) under the action of a viral replicase, and the cRNA is used as a template to synthesize progeny viral RNA to complete the replication of the viral genome; on the other hand, under the action of a viral transcriptase, different segments of mRNA are transcribed from different segments of vRNA, and in this process, the host mRNA cap structure is needed as a primer to synthesize its own mRNA, which is called "cap snatching". Subsequently, the mRNA is translated into corresponding viral structural proteins, and the processes of transcription and translation are completed. A large number of host binding proteins are involved in the processes of viral genome replication, transcription and translation. However, there are few host binding proteins that have been clearly identified to participate in the processes of HTNV genome replication, transcription and translation, which hinders the research on the replication mechanism of HTNV and limits the development of HTNV antiviral target therapy.

[0004] Therefore, new measures need to be proposed to provide technical support for the discovery of HTNV antiviral therapy targets. SUMMARY

[0005] The application aims to provide an HTNV host binding protein screening system based on a CRISPR / dCas13 system and application thereof, so as to solve the problem that there is currently a lack of tools for screening HTNV-RNA related host binding proteins.

[0006] In order to achieve the above-mentioned purpose, the technical scheme adopted by the application is that:

[0007] The HTNV host binding protein screening system based on the CRISPR / dCas13 system comprises a dCas13 protein and a crRNA.

[0008] The dCas13 protein is a dCasRx protein.

[0009] The crRNA comprises crRNA2 and crRNA7, and the sequences are SEQ ID NO: 2 and SEQ ID NO: 7 respectively.

[0010] Further, the expression plasmid of the dCasRx protein is PLVX-BASU-dCasRx-HA-T2A-GFP-IRES-Neo.

[0011] Further, the expression plasmid of the crRNA is pXR003-CasRx-crRNA(2, 7)-cloningbackbone.

[0012] Further, in the crRNA, the crRNA2 is complementary to the viral RNA corresponding to the HTNV-S gene.

[0013] Further, in the crRNA, the crRNA7 is complementary to the messenger RNA corresponding to the HTNV-S gene.

[0014] In another aspect, the application provides the use of the HTNV host binding protein screening system based on the CRISPR / dCas13 system as described, which is used as a tool for screening HTNV-RNA related host binding proteins.

[0015] Compared with the prior art, the application has the following advantages:

[0016] The application provides an HTNV host binding protein screening system based on a CRISPR / dCas13 system and an application thereof, and establishes a screening system for screening HTNV-S-RNA host binding proteins by using a CRISPR / dCasRx system. The feasibility of the screening system is verified by experiments, and it is verified that the candidate proteins screened have a significant influence on HTNV replication, which provides a new idea for the research on the virus replication mechanism and the discovery of new anti-virus treatment targets. BRIEF DESCRIPTION OF DRAWINGS

[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows. Obviously, the accompanying drawings in the following description only represent some embodiments of the present application, and for those skilled in the art, other drawings can also be obtained from these drawings without any creative effort.

[0018] Figure 1 is the plasmid map of PLVX-BASU-dCasRx-HA-T2A-GFP-IRES-Neo.

[0019] Figure 2 is the plasmid map of pXR003-CasRx-crRNA(0,2,7)-cloning backbone.

[0020] Figure 3 is the identification result of constructing a plasmid for expressing dCasRx protein and crRNA sequence.

[0021] Figure 4 is the influence of crRNA(0,2,7) plasmid respectively transfected with CasRx or dCasRx expression plasmid on HTNV-S gene and HTNV-NP protein expression.

[0022] Figure 5 is the enrichment of HTNV-NP protein after biotin-streptavidin magnetic bead enrichment and purification.

[0023] Figure 6 is the result map of the candidate proteins interacting with HTNV-S-vRNA or mRNA screened by mass spectrometry identification and bioinformatics analysis, and using AlphaFold3 for molecular docking.

[0024] Figure 7 is the RNA immunoprecipitation verification of the interaction of candidate proteins with HTNV-S-vRNA or mRNA.

[0025] Figure 8 is the influence of RNA interference technology on HTNV replication after knocking down the expression of each candidate protein. DETAILED DESCRIPTION

[0026] In order to facilitate the understanding of the present application, the present application will be described more fully below with reference to the related drawings. The preferred embodiments of the present application are shown in the drawings. However, the present application can be realized in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thorough and comprehensive.

[0027] In the description of the application, it is to be understood that all technical and scientific terms used have the same meaning as ordinarily understood by a person of ordinary skill in the art to which the application pertains. When there is a conflict between the definitions in the specification and the definitions in the prior art, the definitions in the specification are to prevail. If not specifically indicated, the technical means used in the examples are the conventional means known to those skilled in the art, the reagents used in the examples are commercially available, the devices used in the examples are the existing devices, the limitation of the means, reagents or devices cannot be understood as the limitation of the application, the means, reagents or devices of the same type solving the same technical problem are within the protection scope of the application.

[0028] In the description of the application, it is to be understood that when the equivalent, concentration, or other value or parameter is expressed in a range, a preferred range, or a range defined by a series of upper preferred values and lower preferred values, it should be understood that all ranges formed by any pair of range upper limit or preferred value and any range lower limit or preferred value are specifically disclosed, regardless of whether the range is disclosed separately. When a numerical range is described herein, unless otherwise stated, the range is intended to include its end values and all integers and fractions within the range.

[0029] In addition, during the description of the method, a plurality of steps are involved, and the order of the steps of the method should not be understood as a limitation, and the technical solutions obtained by changing the order of the steps only for solving the same technical problem are also within the protection scope of the application.

[0030] CRISPR (Clusters of Regularly Interspaced Short Palindromic Repeats) is a naturally occurring adaptive immune system in bacteria and archaea, which is used to resist the invasion of viruses (bacteriophages) or foreign DNA, and has been recently modified into a powerful gene editing tool that can accurately and efficiently modify the genome of an organism, generally including CRISPR sequences, Cas proteins and guide RNA. CRISPR sequences can target almost any gene site, with editing efficiency far exceeding traditional techniques, not only knocking out genes, but also activating, inhibiting or replacing specific genes.

[0031] The CRISPR / dCas13 system has the characteristics of high specificity, high sensitivity, specific binding to single-stranded RNA, and no RNA cleavage activity. Based on the above characteristics of the CRISPR / dCas13 system, the system is used as a tool for screening HTNV-RNA associated host binding proteins. The specific principle is as follows: a crRNA targeting HTNV-S-RNA (corresponding to the RNA of HTNV-S gene) is designed; under the mediation of the crRNA, the BASU-dCasRx-HA fusion protein is combined with the HTNV-S-RNA, and after biotin treatment, the BASU will label the interaction protein adjacent to the HTNV-S-RNA with biotin, and under the action of biotin-streptavidin magnetic beads, the biotin-labeled binding protein is enriched, and the feasibility of the system is proved through mass spectrometry identification, bioinformatics analysis and verification of the screened candidate proteins.

[0032] Specifically, the HTNV host binding protein screening system based on the CRISPR / dCas13 system provided by the present application comprises a dCas13 protein and a crRNA.

[0033] Among them:

[0034] The dCas13 protein is a dCasRx protein, and the expression plasmid is PLVX-BASU-dCasRx-HA-T2A-GFP-IRES-Neo, as shown in Figure 1 .

[0035] The crRNA includes crRNA2 and crRNA7, and the sequences are SEQ ID NO:2 and SEQ ID NO:7, respectively. The expression plasmid is pXR003-CasRx-crRNA(2,7)-cloning backbone, as shown in Figure 2 . Among them, the crRNA2 is targeted and complementary to the virus RNA (HTNV-S-vRNA) corresponding to the HTNV-S gene, and the crRNA7 is targeted and complementary to the messenger RNA (HTNV-S-mRNA) corresponding to the HTNV-S gene. The specific sequence is shown in Table 1.

[0036] Table 1

[0037] Name Targeted gene Sequence (5'~3') crRNA2 HTNV-S-vRNA SEQ ID NO: 2: ATAGAACAGCAGTCTGTGGGCTC crRNA7 HTNV-S-mRNA SEQ ID NO: 7: ATTGTTCGATACGATCACTCCAG

[0038] The present application designs a crRNA2 sequence for HTNV-S-vRNA and a crRNA7 sequence for HTNV-S-mRNA, thereby constructing a CRISPR / dCasRx screening system, and using the screening system to screen candidate proteins that interact with HTNV-S-RNA, and through experimental verification, it can be proved that the candidate proteins interact with HTNV-S-RNA, and it is also proved that the candidate proteins are involved in the replication process of HTNV. Therefore, the HTNV host binding protein screening system established based on the CRISPR / dCas13 system provided by the present application can be used for screening HTNV viral RNA host binding proteins, and can be used as a tool for screening HTNV-RNA related host binding proteins.

[0039] The following is the specific experimental process:

[0040] Firstly, a random sequence crRNA0 without target complementary pairing is designed for control in the experimental process, and the specific sequence is shown in Table 2.

[0041] Table 2

[0042] Name Targeted gene Sequence (5'~3') crRNA0 None SEQ ID NO: 0: GGAGGGACGGGTCCAATCGGAAT

[0043] The experimental principle is:

[0044] In human embryonic kidney HEK293T cells, the plasmid expressing crRNA (0, 2, 7) is co-transfected with the plasmid expressing BASU-dCasRx-HA fusion protein, and the expressed crRNA2 and crRNA7 sequences mediate the directional movement of BASU-dCasRx-HA fusion protein to the positions of HTNV-S-vRNA or mRNA, respectively, and after biotin treatment, BASU labels biotin on the adjacent proteins, i.e. on the proteins interacting with HTNV-S-vRNA or mRNA around, and the proteins interacting with HTNV-S-vRNA or mRNA labeled with biotin are enriched and purified by biotin-streptavidin magnetic beads. The candidate proteins screened by mass spectrometry identification and bioinformatics analysis are verified by RNA immunoprecipitation and RNA interference technology for the influence of the candidate proteins on HTNV replication.

[0045] (I) Construction and identification of plasmid:

[0046] The present application uses DNA recombination technology to construct the BASU-dCasRx-HA-T2A-GFP target gene sequence into the PLVX-IRES-Neo vector digested with restriction endonuclease EcoR I and BamH I. The crRNA (0, 2, 7) annealing products are constructed into the pXR003-CasRx-crRNA-cloning backbone vector digested with restriction endonuclease Bbs I using T4 ligase, respectively. All the above-mentioned ligation products are transformed into competent cells DH5a, respectively, and plated. After shaking the formed monoclonal colonies, the plasmids are extracted and identified by sequencing.

[0047] Figure 3 The results of sequencing identification are shown. As shown in Figure 3 , the sequencing result sequence alignment is correct.

[0048] (II) Detection of the activity of dCasRx protein without cutting target RNA:

[0049] HEK293T cell suspension is inoculated in 6-well plates and 24-well plates, and the plates are placed in a 37°C CO2 incubator for cell adhesion; the plasmids expressing crRNA (0, 2, 7) sequences are co-transfected into HEK293T cells with plasmids expressing CasRx protein and dCasRx protein at an amount of 1000 ng per well in 6-well plates and 250 ng per well in 24-well plates, respectively. After 12 h of transfection, HTNV is infected at an MOI of 0.1, and cultured for 48 h after infection. Total RNA and protein are extracted, and RT-qPCR is used to detect the expression of HTNV-S gene, and Western-blot is used to detect the expression of HTNV-NP protein.

[0050] Figure 4 is the effect of crRNA (0, 2, 7) plasmids transfected with CasRx or dCasRx expression plasmids on the expression of HTNV-S gene and HTNV-NP protein. As shown in Figure 4 , the crRNA 0 group is used as a control group, the experimental group transfected with CasRx plasmid can reduce the expression level of HTNV-S gene and HTNV-NP protein in cells, while the experimental group transfected with dCasRx plasmid has no significant effect on the expression level of HTNV-S gene and HTNV-NP protein in cells. It is proved that dCasRx protein has no activity of cutting target RNA.

[0051] (III) Specific detection of CRISPR / dCasRx system screening HTNV-S-RNA binding protein:

[0052] HEK293T cell suspension was inoculated in a 10 cm diameter cell culture dish, and the dish was placed in a 37°C, CO2 incubator for culture until the cells adhered; the plasmid expressing the crRNA (0, 2, 7) sequence was co-transfected into HEK293T cells with the plasmid expressing the dCasRx protein at a dose of 6000 ng per dish, and 12 h after transfection, HTNV was infected at an MOI of 0.1, and cultured for 48 h after infection, the original culture medium was removed, washed twice with PBS, and DMEM medium containing 200 μM biotin was added, incubated at 37°C in a CO2 cell incubator for 15 min, then the cells were collected and purified using biotin-streptavidin magnetic beads, and the expression of HTNV-NP protein was detected by Western-blot.

[0053] Figure 5 is the expression of HTNV-NP protein after biotin-streptavidin magnetic bead enrichment. As shown in Figure 5 , the HTNV-NP protein was expressed in each group in the Input control group; only the crRNA2 and crRNA7 groups could enrich HTNV-NP protein in the biotin-streptavidin magnetic bead enrichment group. It is known that HTNV-NP protein interacts with HTNV-S-vRNA or mRNA, so this result proves that the screening system based on the CRISPR / dCasRx system has high specificity.

[0054] (Four) Screening of candidate proteins and visualization of candidate protein molecular docking results:

[0055] The PAGE gel strip samples were subjected to liquid chromatography-tandem mass spectrometry detection, and the proteins screened were subjected to differential analysis. The proteins enriched separately in the crRNA2 and crRNA7 groups were subjected to GO enrichment analysis and KEGG enrichment analysis, and the interaction of the differential proteins was analyzed using the STRING database. The proteins with significant interaction were used to predict the interaction with HTNV-S-vRNA or mRNA using the catRAPID nucleic acid-protein prediction website, and the molecular docking prediction of the proteins with significant interaction was performed using AlphaFold3, and the visualization of the molecular docking results was realized using PyMOL.

[0056] Figure 6 is the candidate protein screened by mass spectrometry analysis and bioinformatics analysis that interacts with HTNV-S-vRNA or mRNA, and the result of molecular docking using AlphaFold3. As shown in Figure 6 is a schematic diagram of the molecular docking results of the three candidate proteins ERP29, TCP-1 and SETD1A screened with HTNV-S-vRNA or mRNA.

[0057] (v) RNA immunoprecipitation to detect the interaction of candidate proteins with HTNV-S-RNA:

[0058] A549 cell suspension was inoculated in a 10 cm diameter cell culture dish, and the well plate was placed in a 37°C, CO2 incubator for cell adhesion. HTNV was infected at an MOI of 0.1, and cultured for 48 h after infection. The original culture solution was removed, and washed twice with PBS. 4% paraformaldehyde fixing solution was added for fixation on ice for 30 min. Each candidate protein antibody was incubated with Protein A / G magnetic beads. The cell lysate was enriched and purified using each candidate protein antibody magnetic beads, and RNA was extracted. The content of HTNV-S gene was detected by RT-qPCR.

[0059] Figure 7 RNA immunoprecipitation to verify the interaction of candidate proteins with HTNV-S-vRNA or mRNA. As shown in Figure 7 , three candidate proteins can be enriched in HTNV-S-vRNA or mRNA compared with the control group, proving that the established CRISPR / dCasRx screening system can screen host proteins that interact with HTNV-RNA.

[0060] (vi) RNA interference technology to detect the effect of knocking down candidate protein genes on HTNV replication:

[0061] A549 cell suspension and HEK293T cell suspension were inoculated in 12-well plates, and the well plates were placed in a 37°C, CO2 incubator for cell adhesion. Each candidate protein corresponding to three siRNAs was transfected, and the transfection system was 3 pmol siRNA / well for 12-well plates. HTNV was infected 12 h after transfection at an MOI of 0.1, and cultured for 48 h after infection. The cells were collected and RNA was extracted. The knockdown efficiency and the effect on HTNV-S gene expression were detected by RT-qPCR.

[0062] Figure 8 The effect of RNA interference technology on HTNV replication after knocking down each candidate protein gene. As shown in Figure 8 , the designed siRNA can knock down the expression of each candidate protein gene, and knocking down each candidate protein gene has an inhibitory effect on HTNV replication.

[0063] In conclusion, the three candidate proteins ERP29, TCP-1 and SETD1A screened by the CRISPR / dCasRx screening system and having interaction with HTNV-S-RNA are verified, it is proved that the above three proteins have interaction with HTNV-S-RNA, and it is proved that the three candidate proteins are involved in the replication process of HTNV, and it is proved that the HTNV host binding protein screening system based on the CRISPR / dCas13 system is feasible, which provides a new method for screening the host binding protein of HTNV virus RNA interaction, and provides a new idea for the research of virus mechanism and the discovery of antiviral target.

[0064] The above application of specific examples to the present application is described, only for helping to understand the present application, and is not used to limit the present application. For the skilled in the art to which the present application belongs, according to the idea of the present application, a number of simple deductions, deformations or substitutions can be made.

Claims

1.A HTNV host-binding protein screening system based on a CRISPR / dCas13 system, characterized in that: the screening system comprises a dCas13 protein and a crRNA; the dCas13 protein is a dCasRx protein; the crRNA comprises crRNA2 and crRNA7, and the sequences are SEQ ID NO: 2 and SEQ ID NO: 7 respectively. 2.The HTNV host-binding protein screening system based on a CRISPR / dCas13 system according to claim 1, characterized in that: the expression plasmid of the dCasRx protein is PLVX-BASU-dCasRx-HA-T2A-GFP-IRES-Neo. 3.The HTNV host-binding protein screening system based on a CRISPR / dCas13 system according to claim 2, characterized in that: the expression plasmid of the crRNA is pXR003-CasRx-crRNA(2, 7)-cloning backbone. 4.The HTNV host-binding protein screening system based on a CRISPR / dCas13 system according to claim 3, characterized in that: in the crRNA, the crRNA2 is complementary to the viral RNA corresponding to the HTNV-S gene. 5.The HTNV host-binding protein screening system based on a CRISPR / dCas13 system according to claim 4, characterized in that: in the crRNA, the crRNA7 is complementary to the messenger RNA corresponding to the HTNV-S gene. 6.An application of the HTNV host-binding protein screening system based on a CRISPR / dCas13 system according to claim 5, characterized in that: the screening system is used as a tool for screening HTNV-RNA related host-binding proteins.

Images