Dual-target double-stranded RNA for treating hepatitis b, and pharmaceutical composition

By designing a dual-target liver-specific delivery system that targets both HBV and PD-L1 with double-stranded RNA, the limitations of HBsAg reduction and the complexity of combination therapy in existing hepatitis B treatments have been addressed, achieving a functional cure that simultaneously inhibits HBV replication and activates the immune system.

WO2026007243A1PCT designated stage Publication Date: 2026-01-08SUZHOU SIRAN BIOTECHNOLOGY CO LTD
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
PCT/CN2024/120336
Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Priority Date
2024-07-05
Filing Date
2024-09-23
Publication Date
2026-01-08

AI Technical Summary

Technical Problem

In existing hepatitis B treatment strategies, monotherapy has limited HBsAg reduction, and HBsAg is prone to rebound after reduction. Combination therapy has problems such as medication complexity and low patient compliance. No drug can effectively achieve functional cure.

Method used

A double-stranded RNA was designed to deliver liver-specifically targeting both the HBV lifecycle and the host immune PD-L1. The two targets were coupled via a linker to form a double-stranded RNA complex, enabling combined therapy with a single dose.

Benefits of technology

It simultaneously inhibits HBV viral replication and activates the human immune system, improving patient compliance and showing the potential to achieve a clinical functional cure for hepatitis B.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2024120336_08012026_PF_FP_ABST
    Figure CN2024120336_08012026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a dual-target double-stranded RNA for treating hepatitis B, and a pharmaceutical composition. The dual-target double-stranded RNA comprises a first double-stranded RNA and a second double-stranded RNA, wherein one of the first double-stranded RNA and the second double-stranded RNA targets the hepatitis B virus (HBV) life cycle, and the other targets a host immune target PD-L1. The double-stranded RNA can simultaneously target the dual targets of HBV and host immune PD-L1, which can inhibit HBV replication while activating human immunity, and is therefore expected to bring about a clinical functional cure.
Need to check novelty before this filing date? Find Prior Art

Description

Double-target double-stranded RNA for treating hepatitis B and pharmaceutical composition TECHNICAL FIELD

[0001] The present application belongs to the technical field of biological medicine, and particularly relates to a double-target double-stranded RNA for treating hepatitis B and a pharmaceutical composition. BACKGROUND

[0002] Hepatitis B is a global public health problem. The World Health Organization (WHO) estimates that in 2019, 296 million people worldwide were chronically infected with hepatitis B, and 1.5 million new infections occurred each year. Globally, the number of people with liver disease caused by hepatitis B decreased from 84.45 million in 1990 to 80.65 million in 2019, a decrease of 4.51%. However, the incidence of cirrhosis and other chronic liver diseases increased by 31.22%, and the incidence of liver cancer also increased by 10.47%. HBV infection is the most important risk factor for liver cancer. HBsAg clearance can significantly reduce the risk of liver cancer in patients with chronic hepatitis B (F. Liu, X.-W. Wang, L. Chen, et al. 2016 Jun; 43(12): 1253-61.).

[0003] Currently, the main treatment strategy for chronic hepatitis B in clinical practice is NA and interferon, but the HBsAg clearance rate is low, and the functional cure is low. The current innovative drug development strategy is to target the life cycle and target the host immune system. Whether targeting the HBV life cycle or targeting immune regulation, there is currently no drug that can achieve functional cure. The current pain points of single drugs are: limited HBsAg reduction; rapid rebound after HBsAg reduction or clearance; only a small number of people with low baseline HBsAg can achieve HBsAg clearance. The existing hepatitis B clinical practice is also exploring the combination of drugs with different mechanisms of action, such as VIR-2218 (HBV siRNA) combined with therapeutic vaccine, AB-729 (HBV siRNA) combined with interferon, etc. However, the existing combination of drugs requires independent, separate or sequential use, and there are problems such as complex medication and low patient compliance.

[0004] SUMMARY

[0005] The purpose of the present application is to provide a double-stranded RNA that can simultaneously target hepatitis B HBV virus and host immune PD-L1 and deliver liver-specific delivery of double-targets.

[0006] To achieve the above-mentioned purpose, the technical solution adopted by the present application is:

[0007] The first aspect of the present application provides a double-stranded RNA, comprising a first double-stranded RNA and a second double-stranded RNA; wherein one of the first double-stranded RNA and the second double-stranded RNA targets the HBV life cycle, and the other targets the host immune target PD-L1.

[0008] According to some embodiments, the double-stranded RNA comprises a mixture of the first double-stranded RNA and the second double-stranded RNA, wherein the mixing ratio of the first double-stranded RNA and the second double-stranded RNA can be any feasible ratio, for example 1:0.1-10, such as 1:0.5, 1:1, 1:1.5, 1:2, 1:2.5, 1:3, 1:3.5, 1:4, 1:4.5, 1:5, 1:5.5, 1:6, 1:6.5, 1:7, 1:7.5, 1:8, 1:8.5, 1:9, 1:9.5, 1:10.

[0009] According to some other embodiments, the first double-stranded RNA and the second double-stranded RNA are connected by a linker to form a conjugate or a conjugate.

[0010] Further, the linker comprises one or more of the groups as shown in the general structure (I):

[0011] wherein L is absent or selected from one or more of the linking combinations of the groups as shown in the following formulae (A1)-(A14):

[0012] wherein R' is hydrogen, C1-C10 alkyl or C3-C8 cycloalkyl; j1 is an integer of 1-20; j2 is an integer of 1-20;

[0013] m represents an integer of 0-6;

[0014] Q represents wherein R2, R3 are independently selected from H, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl or C2-C20 alkynyl;

[0015] X represents wherein R4, R5 are independently selected from H, fluorine, hydroxyl, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, C2-C20 alkynyl, or R4, R5 are directly connected to form a ring, and p is an integer of 1-6;

[0016] Z represents N or CR9, wherein R9 is selected from H, C1-C20 alkyl or C3-C10 cycloalkyl;

[0017] represents C3-C8cycloalkyl or C3-C8heterocyclyl;

[0018] R1is selected from H, fluorine, hydroxyl, cyano, C1-C20alkyl, C1-C20alkoxy, C2-C20alkenyl or C2-C20alkynyl;

[0019] Y is absent or is fluorine, chlorine, hydroxyl, a delivery molecule; wherein the delivery molecule is preferably

[0020] According to some embodiments, the groups represented by A1-A14 can be connected in any combination to form L, wherein the left and right ends of the groups represented by A1-A14 can be exchanged, for example, the N of A7 can be connected to the group on the side of Y or to the group on the side of Z. Preferably, L is selected from the connecting combination of at least two groups represented by A1-A14.

[0021] Further, L is selected from the connecting combination of one or more of A1, A2, A3, A5, A6, A7, A8, A10, A11, A13; preferably, L is selected from the connecting combination of at least two of A1, A2, A3, A5, A6, A7, A8, A10, A11, A13.

[0022] Further, L is selected from the connecting combination of one or more of A1, A2, A3, A5, A6, A7; preferably, L is selected from the connecting combination of at least two of A1, A2, A3, A5, A6, A7.

[0023] Further, L is selected from the connecting combination of one or more of A1, A2, A5, A7; further preferably, L is selected from the connecting combination of at least two of A1, A2, A5, A7. More preferably, L contains A1, A2 and A5 at the same time, and the number of A1, A2 and A5 is one or more, and the number of more can be two, three, four or five.

[0024] Further, L is absent.

[0025] According to some embodiments, R' is hydrogen, C1-C8alkyl or C3-C8cycloalkyl. Preferably, R' is hydrogen, C1-C5alkyl or C4-C6cycloalkyl. Preferably, R' is hydrogen.

[0026] According to some embodiments, j1 is an integer from 1 to 15, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15; j2 is an integer from 1 to 15, for example 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15. Preferably, j1 is an integer from 3 to 15; j2 is an integer from 3 to 15.

[0027] According to some embodiments, m represents an integer from 0 to 3, such as 0, 1, 2 or 3.

[0028] According to some embodiments, R2, R3are independently selected from H, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl or C2-C10 alkynyl. Preferably, R2, R3are independently selected from H, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl or C2-C5 alkynyl. Preferably, R2, R3are independently selected from H, C1-C3 alkyl, C1-C3 alkoxy, C2-C4 alkenyl or C2-C4 alkynyl. Preferably, R2, R3are H.

[0029] According to some embodiments, X represents wherein R4, R5are independently selected from H, fluorine, hydroxyl, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, C2-C10 alkynyl or R4, R5are directly linked to form a three to eight membered ring, and p is an integer from 1 to 6. Preferably, R4, R5are independently selected from H, fluorine, hydroxyl, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl, C2-C5 alkynyl or R4, R5are directly linked to form a four to six membered carbocyclic ring, and p is an integer from 1 to 3. Preferably, X represents

[0030] According to some embodiments, Z represents CR9, wherein R9is selected from H, C1-C10 alkyl or C3-C8 cycloalkyl. Preferably, R9is selected from H, C1-C5 alkyl or C3-C5 cycloalkyl.

[0031] According to some embodiments, represents C3-C6 cycloalkyl or C3-C8 nitrogen-containing heterocyclyl. Preferably, represents a four to eight membered nitrogen-containing saturated heterocyclic ring.

[0032] According to some embodiments, R1is selected from H, fluorine, hydroxyl, cyano, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl or C2-C10 alkynyl. Preferably, R1is selected from H, fluorine, hydroxyl, cyano, C1-C5 alkyl, C1-C5 alkoxy, C2-C5 alkenyl or C2-C5 alkynyl. Preferably, R1is H.

[0033] According to some embodiments, Y is absent, or is hydroxyl, or is

[0034] According to some more specific and preferred embodiments, the group according to structural formula (I) is selected from any one of the following structures:

[0035] According to some embodiments, the linker is 1 to 6 groups of the same or different structure as shown in structural formula (I) connected by phosphodiester bond or thiophosphodiester bond. Further, the number of groups as shown in structural formula (I) contained in the linker can be 1, 2, 3 or 4.

[0036] According to some embodiments, the linker is the structure shown in formula (II):

[0037] wherein, the definitions of L and Y are the same as those in structural formula (I), which are described above and will not be repeated here; the three Ls in formula (II) are the same or different in structure; the three Ys in formula (II) are the same or different in structure;

[0038] M is O or S;

[0039] m represents an integer from 0 to 6; for example, 0, 1, 2, 3, 4, 5 or 6; the three ms in formula (II) are the same or different in value;

[0040] represents a four to eight membered saturated nitrogen-containing heterocyclic ring, and the three in formula (II) are the same or different in structure;

[0041] represents the site where the groups are covalently connected.

[0042] According to some more specific embodiments, the multi-target double-stranded RNA is any one selected from the following structures:

[0043] (this structural formula is three SA51 connected in turn),

[0044] wherein, M is O or S, siRNA1 is the first double-stranded RNA, and siRNA2 is the second double-stranded RNA.

[0045] According to some embodiments, the linker is connected to the sense strand of the first double-stranded RNA and the sense strand of the second double-stranded RNA, respectively.

[0046] Further, the linker is connected to the 3' end of the sense strand of the first double-stranded RNA and the 5' end of the sense strand of the second double-stranded RNA, respectively, by a phosphodiester bond or a phosphorothioate bond.

[0047] According to some embodiments, the first double-stranded RNA and the second double-stranded RNA are both siRNAs, each comprising a sense strand and an antisense strand.

[0048] According to some embodiments, the antisense strand of the first double-stranded RNA and the antisense strand of the second double-stranded RNA are separated from each other (i.e., there is no connection between the two antisense strands, and the two antisense strands are only paired with their respective sense strands). Alternatively, the antisense strand of the first double-stranded RNA and the antisense strand of the second double-stranded RNA are connected by a nucleotide or a nucleotide derivative. Alternatively, the antisense strand of the first double-stranded RNA and the antisense strand of the second double-stranded RNA are connected by a Linker; wherein the Linker can adopt any linker in the prior art; preferably, the Linker adopts the linker described above. Wherein the nucleotide or nucleotide derivative or Linker can be biodegradable, so that the two antisense strands can be separated after entering the body to exert their respective functions.

[0049] According to some embodiments, the sequence of the double-stranded RNA targeting the HBV life cycle is as described in the patent application No. 2023112163206, and the siRNA with better activity in the patent can be used in the double-stranded RNA of the present application. The double-stranded RNA targeting the host immune target PD-L1 is as described in the patent CN117881783A, and the siRNA with better activity in the patent can be used in the double-stranded RNA of the present application. The present application uses a linker to construct a double-stranded RNA complex targeting HBV mRNA and PD-L1 siRNA, which can achieve combination therapy by administration once, improve patient compliance, and also facilitate the control of product quality, avoid the quality control problems existing in compound drugs, and lay the foundation for drug marketing.

[0050] According to some embodiments, the sense strand of one of the first double-stranded RNA and the second double-stranded RNA differs from the sequence GUGUGCACUUCGCUUCACA (SEQ ID NO: 1) by no more than 3 nucleotides, further no more than 2 nucleotides, and further no more than 1 nucleotide from the 5' end to the 3' end, and the anti-sense strand differs from the sequence UGUGAAGCGAAGUGCACACUU (SEQ ID NO: 2) by no more than 3 nucleotides, further no more than 2 nucleotides, and further no more than 1 nucleotide; the sense strand of the other differs from the sequence AGAUGAGGAUAUUUGCUGA (SEQ ID NO: 3) by no more than 3 nucleotides, further no more than 2 nucleotides, and further no more than 1 nucleotide, and the anti-sense strand differs from the sequence UCAGCAAAUAUCCUCAUCUUU (SEQ ID NO: 4) by no more than 3 nucleotides, further no more than 2 nucleotides, and further no more than 1 nucleotide; each of the nucleotides in the first double-stranded RNA and the second double-stranded RNA is independently a modified or unmodified nucleotide.

[0051] According to some embodiments, the first double-stranded RNA targets the host immune target PD-L1; and the second double-stranded RNA targets the HBV life cycle.

[0052] Further, the sense strand of the first double-stranded RNA comprises AGAUGAGGAUAUUUGCUGA, and the anti-sense strand comprises UCAGCAAAUAUCCUCAUCUUU; and the sense strand of the second double-stranded RNA comprises GUGUGCACUUCGCUUCACA, and the anti-sense strand comprises UGUGAAGCGAAGUGCACACUU.

[0053] According to some embodiments, at least one of the nucleotides in the sense strand or the anti-sense strand of the first double-stranded RNA and the second double-stranded RNA is a modified nucleotide. In certain embodiments, the number of modified nucleotides in the sense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen. In certain embodiments, the number of modified nucleotides in the anti-sense strand is one, two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, nineteen, twenty, or twenty-one. In certain embodiments, all of the nucleotides in the sense strand and the anti-sense strand are modified nucleotides.

[0054] According to some embodiments, some or all of the nucleotides in the siRNA are modified nucleotides, and the modifications on the nucleotide groups do not result in a significant reduction or loss of the function of the siRNA in inhibiting the expression of the corresponding gene.

[0055] According to some embodiments, at least one of the phosphate groups in the sense strand or the antisense strand is a phosphate group with a modification group, preferably, the phosphate group with a modification group is a phosphorothioate group in which at least one of the oxygen atoms in the phosphodiester bond is replaced by a sulfur atom.

[0056] According to some embodiments, the 5' terminal nucleotide of the sense strand is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0057] According to some embodiments, the 5' terminal nucleotide of the antisense strand is linked to a 5' phosphate group or a 5' phosphate derivative group.

[0058] According to some embodiments, the modified nucleotide is selected from a 2'-fluoro-modified nucleotide, a 2'-alkoxy-modified nucleotide, a 2'-substituted alkoxy-modified nucleotide, a 2'-alkyl-modified nucleotide, a 2'-substituted alkyl-modified nucleotide, a 2'-deoxy nucleotide, a 2'-amino-modified nucleotide, a 2'-substituted amino-modified nucleotide, a nucleotide analogue, or a combination of any two or more thereof.

[0059] Further, the modified nucleotide is selected from a 2'-fluoro-modified nucleotide, a 2'-methoxy-modified nucleotide, a 2'-O-CH2-CH2-O-CH3-modified nucleotide, a 2'-O-CH2-CH=CH2-modified nucleotide, a 2'-CH2-CH2-CH=CH2-modified nucleotide, a 2'-deoxy nucleotide, a nucleotide analogue, an inverted abasic deoxyribose residue, or a combination of any two or more thereof.

[0060] According to some preferred and specific embodiments, in the sense strand of each double-stranded RNA, in the 5' to 3' direction, 2'-fluoro-modified nucleotides are located at positions 7, 8 and 9 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 7, 9 and 11 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 9, 10 and 11 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 10, 11 and 12 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides; or, 2'-fluoro-modified nucleotides are located at positions 8, 9 and 10 of the sense strand, and the remaining positions are non-fluoro-modified nucleotides.

[0061] According to some preferred and specific embodiments, in the antisense strand of each double-stranded RNA, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14thand 16thpositions of the antisense strand, and the remaining positions are non-fluoro-modified nucleotides; or, in the 5' to 3' direction, the 2'-fluoro-modified nucleotides are located at the 2nd, 14thand 16thpositions of the antisense strand, and the remaining positions are non-fluoro-modified nucleotides.

[0062] Further, the hydroxyl group at the 2' position of the ribosyl group of the non-fluoro-modified nucleotides is substituted with a methoxyl group.

[0063] Further, in the sense strand and the antisense strand of each double-stranded RNA, the base at the 5' end of the sense strand and the base at the 3' end of the sense strand are respectively connected to a reverse dephospho deoxyribose residue containing a phosphate group or a phosphorothioate group.

[0064] According to some preferred and specific embodiments, in the sense strand of each double-stranded RNA, in the 5' to 3' direction, the sense strand comprises one or more phosphorothioate groups at any one or more of the following positions:

[0065] between the 1stand 2ndnucleotides starting from the 5' end of the sense strand;

[0066] between the 2ndand 3rdnucleotides starting from the 5' end of the sense strand.

[0067] Further, in the sense strand of each double-stranded RNA, in the 5' to 3' direction, the sense strand can further optionally comprise one or more phosphorothioate groups at any one or more of the following positions:

[0068] between the 1stand 2ndnucleotides starting from the 3' end of the sense strand;

[0069] between the 2ndand 3rdnucleotides starting from the 3' end of the sense strand.

[0070] According to some preferred and specific embodiments, in the antisense strand of each double-stranded RNA, in the 5' to 3' direction, the antisense strand comprises one or more phosphorothioate groups at any one or more of the following positions:

[0071] between the 1stand 2ndnucleotides starting from the 5' end of the antisense strand;

[0072] between the 2ndand 3rdnucleotides starting from the 5' end of the antisense strand;

[0073] between the 1stand 2ndnucleotides starting from the 3' end of the antisense strand;

[0074] the 2nd nucleotide to the 3rd nucleotide from the 3' terminus of the antisense strand.

[0075] According to some preferred embodiments and specific embodiments, the nucleotide at any one or more of positions 6 to 10 of the antisense strand, in the 5' to 3' direction, comprises a modification as shown in the structural formula , wherein R1 is H, OH or CH3, and R2 is a natural nucleobase, an unnatural nucleobase or an H atom. By adding the modification shown in the structural formula to the antisense strand, the off-target activity of the siRNA can be reduced without substantially affecting the on-target activity of the siRNA.

[0076] Further, the modification as shown in the structural formula is selected from any one of the following structures:

[0077] According to some specific embodiments, 0 to 5 nucleotides from the 3' end and / or the 5' end of the first double-stranded RNA and / or the second double-stranded RNA are debased nucleotides, deoxyribonucleotides or nucleotide analogs. Further preferably, the nucleotides from the 3' end and / or the 5' end of the first double-stranded RNA and / or the second double-stranded RNA are one or more of -dTdTdT-, -IB- or -s-IB-s-.

[0078] According to some specific embodiments, from the 5' end to the 3' end, the sense strand of the first double-stranded RNA is AmsGmsAmUmGmAmGfGfAfUmAmUmUmUmGmCmUmGmAm, and the antisense strand is VPUmsCfsAmGmCmAfAmAmUmAmUmCmCmUfCmAfUmCmUmsUmsUm; the sense strand of the second double-stranded RNA is GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmsCmsAm, and the antisense strand is VPUmsGfsUmGmAmAfIsoGCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm.

[0079] According to some embodiments, the first double stranded RNA has a sense strand of AmsGmsAmUmGmAmGfGfAfUmAmUmUmUmGmCmUmGmAm and an antisense strand of VPUmsCfsAmGmCmAfAmAmUmAmUmCmCmUfCmAfUmCmUmsUmsUm from 5' to 3' end; and the second double stranded RNA has a sense strand of IB-s-GmUmGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmAm-s-IB and an antisense strand of VPUmsGfsUmGmAmAfIsoGCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm.

[0080] According to some embodiments, the multi-target double stranded RNA further comprises a conjugating group covalently conjugated to the first double stranded RNA and / or the second double stranded RNA, the conjugating group is a lipid or a ligand of a receptor. The lipid can be any lipid currently available for siRNA delivery. The ligand can be selected from any one of D-mannopyranose, L-mannopyranose, D-arabinose, D-xylofuranose, L-xylofuranose, D-glucose, L-glucose, D-galactose, L-galactose, a-D-mannofuranose, β-D-mannofuranose, a-D-mannopyranose, β-D-mannopyranose, a-D-glucopyranose, β-D-glucopyranose, a-D-glucoruranose, β-D-glucoruranose, a-D-fructofuranose, a-D-fructopyranose, a-D-galactopyranose, β-D-galactopyranose, a-D-galactofuranose, β-D-galactofuranose, glucosamine, sialic acid, galactosamine, N-acetylgalactosamine, N-trifluoroacetylgalactosamine, N-propionylgalactosamine, N-n-butyrylgalactosamine, N-isobutyrylgalactosamine, 2-amino-3-O-[(R)-1-carboxyethyl]-2-deoxy-β-D-glucopyranose, 2-deoxy-2-methylamino-L-pyranose, 4,6-dideoxy-4-formamido-2,3-di-O-methyl-D-mannopyranose, 2-deoxy-2-sulfonamido-D-glucopyranose, N-glycolyl-a-neuraminic acid, 5-thio-β-D-glucopyranose, 2,3,4-tri-O-acetyl-1-thio-6-O-trityl-a-D-glucopyranoside methyl ester, 4-thio-β-D-galactopyranose, 3,4,6,7-tetra-O-acetyl-2-deoxy-1,5-dithio-a-D-glucopyranoside ethyl ester, 2,5-anhydro-D-allosonitrile, ribose, D-ribose, D-4-thioribose, L-ribose, L-4-thioribose.

[0081] Preferably, the conjugation group is defined the same as the linker. Preferably, the number of the conjugation group is one or a plurality of sequentially connected groups. In some embodiments, the plurality of groups is 2-6, such as 2, 3, 4, 5 or 6.

[0082] In some embodiments, the multi-target double-stranded RNA does not contain the conjugation group, and in some embodiments, the multi-target double-stranded RNA contains the conjugation group. In particular, when the linker does not have liver-specific delivery properties, the multi-target double-stranded RNA contains the conjugation group; and when the linker has liver-specific delivery properties, the multi-target double-stranded RNA can contain the conjugation group or not.

[0083] The second aspect of the present application provides a double-stranded RNA, which comprises a first double-stranded RNA, a second double-stranded RNA, a linker connected to the first double-stranded RNA and the second double-stranded RNA, respectively, and an inverted abasic deoxyribose residue connected to the 3' end and / or 5' end of the sense strand of the second double-stranded RNA, one of the first double-stranded RNA and the second double-stranded RNA targets the HBV life cycle, and the other targets the host immune target PD-L1.

[0084] According to some embodiments, the inverted abasic deoxyribose residue is connected to the nucleotide of the linker or the second double-stranded RNA by a phosphodiester bond or a phosphorothioate bond.

[0085] The linker in this embodiment can be a linker that can perform multi-target delivery in the prior art, or a linker as described in the multi-target double-stranded RNA provided in the first aspect above, i.e. a linker as shown in the general structure (I) and the specific structures defined under this general structure.

[0086] The first double-stranded RNA and the second double-stranded RNA in this embodiment are also as described in the first aspect above, which will not be repeated here.

[0087] The present application also provides a pharmaceutical composition comprising the double-stranded RNA described above and a pharmaceutically acceptable carrier or excipient.

[0088] According to some embodiments, the pharmaceutical composition has liver-specific delivery properties.

[0089] According to some embodiments, the pharmaceutical composition is used for treating hepatitis B or hepatitis B virus infection.

[0090] The present application also provides the use of the double-stranded RNA described above or the pharmaceutical composition described above in the preparation of a medicament for preventing and / or treating hepatitis B.

[0091] The present application also provides a method for treating hepatitis B or hepatitis B virus infection in a human patient, comprising administering to the human patient a double-stranded RNA as described above.

[0092] Thanks to the above technical solution, the present application has the following advantages compared with the prior art:

[0093] The double-stranded RNA of the present application can simultaneously target the double targets of hepatitis B HBV virus and host immune PD-L1, can realize the inhibition of HBV virus replication while activating human immunity, and is expected to realize clinical functional cure. BRIEF DESCRIPTION OF DRAWINGS

[0094] Figure 1 is a siRNA in Example 3 in vivo efficacy results chart. DETAILED DESCRIPTION

[0095] It should be noted that, unless otherwise defined, technical terms or scientific terms used in the present application should be understood as the usual meaning understood by those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. The medicinal material raw materials, reagent materials, etc. used in the following examples are all commercially available products unless otherwise specified. As used herein and in the appended claims, the singular forms "a," "an," and "the" include plural referents unless the context clearly dictates otherwise.

[0096] DEFINITIONS

[0097] In the present disclosure, the compounds represented by the general formula (I) and the compounds represented by the specific structures include their tautomers, racemates, enantiomers, diastereomers, mixtures thereof, etc.

[0098] As used herein, a dash ("-") that is not between two letters or two symbols is used to indicate a point of attachment of a substituent. is used to indicate the position of the point of attachment of a substituent.

[0099] As used herein, "optional" or "optionally" means that the subsequently described event or circumstance can or can not occur, and that the description includes the situation where it occurs and the situation where it does not. For example, "an optionally substituted alkyl" includes "alkyl" and "substituted alkyl" as defined below. Those skilled in the art will appreciate that for any group containing one or more substituents, such groups do not intend to introduce any substitution or substitution pattern that is spatially impractical, synthetically unfeasible, and / or intrinsically unstable.

[0100] As used herein, "alkyl" refers to straight and branched chains, typically of 1 to 20 carbon atoms, such as 1 to 10 carbon atoms, such as 1 to 8 or 1 to 6 carbon atoms. For example, C1-C6 alkyl includes straight and branched chains of 1 to 6 carbon atoms. When reference is made to an alkyl residue having a particular number of carbons, it is intended to encompass all branched and straight chain forms having that number of carbons; thus, for example, "butyl" is intended to include n-butyl, sec-butyl, iso-butyl, and t-butyl; "propyl" includes n-propyl and iso-propyl. Alkylene is a subset of alkyl, referring to the same residues as alkyl, but having two points of attachment.

[0101] As used herein, "cycloalkyl" refers to non-aromatic carbon rings, typically having 3 to 7 ring carbon atoms. The ring can be saturated, or have one or more carbon-carbon double bonds. Examples of cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, and cyclohexenyl, as well as bridged and clathrate cyclic groups such as norbornane.

[0102] In the context of the present application, capital letters A, U, C, G: represent the base composition of a nucleotide; lower case letter m represents that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; lower case letter f represents that the nucleotide adjacent to the left of the letter f is a fluoro-modified nucleotide; lower case letter s represents that the two nucleotides adjacent to the left and right of the letter s are connected by a phosphorothioate group; the letter combination VP represents that the nucleotide adjacent to the right of the letter combination VP is a vinylphosphonate-modified nucleotide, as shown below. The meaning of phosphorothioate group is the same as phosphorodithioate linkage, both of which can be used interchangeably. Lower case letter d represents that the nucleotide adjacent to the right of the letter is a deoxy nucleotide, such as dT is a deoxythymine nucleotide. m5dC refers to 5-methyl deoxyribose cytidine. IB refers to an inverted abasic deoxyribose residue. -s-IB- or -s-IB-s- refers to the phosphate linkage in IB is a phosphorothioate linkage. In siRNA sequences, unless otherwise specified, the two nucleotides are connected by an unsubstituted or modified phosphate group. The structure of IsoG is as follows.

[0103] As used herein, the term "nucleotide position" refers to the position of a nucleotide in an oligonucleotide, as counted from the 5' end of the nucleotide. For example, nucleotide position 1 refers to the 5' end nucleotide of an oligonucleotide.

[0104] As used herein, double-stranded RNA refers to a polymeric form of nucleotides within the range of 2 to 2500 nucleotides. In certain embodiments, the double-stranded RNA has 500 to 1500 nucleotides, typically, for example, where the double-stranded RNA is used in gene therapy. In certain embodiments, the double-stranded RNA has 7 to 100 nucleotides. In certain embodiments, the double-stranded RNA has 15 to 100 nucleotides. In another embodiment, the double-stranded RNA has 15 to 50 nucleotides, typically, for example, where the double-stranded RNA is a nucleic acid inhibitor molecule. In another embodiment, the double-stranded RNA is a duplex having 25 to 40 nucleotides. In yet another embodiment, the double-stranded RNA has 19 to 40 or 19 to 25 nucleotides, typically, for example, where the double-stranded RNA is a double-stranded nucleic acid inhibitor molecule and forms a duplex having at least 18 to 25 base pairs. Typically, as described herein, the double-stranded RNA contains one or more phosphorus-containing internucleotide linking groups. In other embodiments, as described herein, the internucleotide linking groups are phosphoramide groups.

[0105] As used herein, "fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group is replaced with a fluorine to form a nucleotide having the structure shown in Formula (7) below. In some embodiments, the alkyl-modified nucleotide is a nucleotide in which the hydroxyl group at the 2' position of the ribose group is replaced with a methoxyl group (2'-OMe), as shown in Formula (8).

[0106] wherein base represents a base, such as A, U, G, C, or T.

[0107] As used herein, "non-fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group is replaced with a non-fluoro group.

[0108] As used herein, "conjugate" refers to a compound formed by the covalent linkage between two or more chemical moieties each having a specific function; accordingly, "conjugate" refers to a compound formed by the covalent linkage between the respective chemical moieties. Further, "siRNA conjugate" refers to a compound formed by the covalent linkage of one or more chemical moieties having a specific function to an siRNA.

[0109] In the context of the present application, particularly when describing the methods of preparing the siRNA, siRNA-containing compositions or siRNA conjugates of the present application, the nucleoside monomers refer, unless otherwise specified, to modified or unmodified nucleoside phosphoramidite monomers (unmodified or modified RNA phosphoramidites, sometimes also referred to as Nucleoside phosphoramidites) used in the phosphoramidite solid phase synthesis depending on the kind and order of the nucleotides in the siRNA or siRNA conjugate to be prepared. The phosphoramidite solid phase synthesis is a method commonly used in RNA synthesis and well known to the person skilled in the art. The nucleoside monomers used in the present application are all commercially available.

[0110] Various hydroxyl protecting groups can be used in the present disclosure. In general, a protecting group renders a chemical functional group insensitive to particular reaction conditions, and can be added to and removed from that functional group in a molecule without substantially impairing the rest of the molecule.

[0111] The pharmaceutically acceptable carrier described in the present disclosure can be a carrier conventionally used in the field of siRNA administration, for example, but not limited to, one or more of magnetic nanoparticles such as nanoparticles based on Fe3O4 or Fe2O3, carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine) (PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly(D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate) (PPEEA), and poly(2-dimethylaminoethyl methacrylate) (PDMAEMA), and derivatives thereof. The excipient can be one or more of various formulations or compounds conventionally employed in the art. For example, the pharmaceutically acceptable other excipient can include at least one of a pH buffer, a protective agent, and an osmotic pressure adjusting agent.

[0112] The term "subject," as used herein, refers to any animal, such as a mammal or a marsupial. Subjects of the present disclosure include, but are not limited to, humans, non-human primates (e.g., rhesus or other types of macaques), mice, pigs, horses, donkeys, cows, rabbits, sheep, rats, and any species of poultry.

[0113] As used herein, "treatment" refers to an approach for obtaining beneficial or desired results, including but not limited to therapeutic benefit. "Therapeutic benefit" means eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more physiological symptoms associated with the underlying disorder such that an improvement is observed in the subject, notwithstanding the fact that the subject can still be afflicted with the disorder.

[0114] "Prevention" as used herein refers to a method of obtaining a beneficial or desired result, including but not limited to prophylactic benefit. To obtain "prophylactic benefit," the siRNA, siRNA conjugate, or pharmaceutical composition can be administered to a subject at risk of developing a particular disease, or to a subject reporting one or more physiological symptoms of a disease, even though the diagnosis of this disease can not have been made.

[0115] The technical solutions provided by the present application are further described below in combination with specific examples. The following examples are only used to illustrate the present application and will not limit the protection scope of the present application.

[0116] Example 1 Synthesis of siRNA

[0117] In this document, if the actual source of reagents is not given, such reagents can be obtained from any supplier of molecular biology reagents; and have the quality / purity standards to meet the application for molecular biology.

[0118] The siRNA sequence was synthesized on a Dr. Oligo 48 synthesizer (Biolytic) using solid support mediated phosphoramidite chemistry in 200 nanomole (nmol) scale. The solid support was universal solid support (Shenzhen Diankong Bio). The nucleoside monomer raw materials 2'-F RNA, 2'-O-methyl RNA, and other nucleoside phosphoramidite monomers were purchased from Shanghai Zoben or Suzhou Jima. The coupling time of all phosphoramidites (50 mM acetonitrile solution) was 6 minutes (min), 5-ethylthio-1H-tetrazole (ETT) was used as an activator (0.6 M acetonitrile solution), 0.22 M PADS dissolved in 1:1 volume ratio of acetonitrile and trimethylpyridine (Suzhou Colema) solution was used as a sulfurizing agent, and the sulfurization reaction time was 3 minutes (min). Iodopyridine / water solution (Colema) was used as an oxidizing agent, and the oxidation reaction time was 2 minutes (min).

[0119] After the completion of solid-phase synthesis, the oligoribonucleotide was cleaved from the solid support, and soaked in a 3:1 solution of 28% ammonia water and ethanol at 50°C for 16 hours. Then high-speed centrifugation was performed, and the supernatant was transferred to another centrifuge tube. After concentrated evaporation, C18 reverse phase chromatography was used for purification, the mobile phase was 0.1 M TEAA and acetonitrile, and 3% trifluoroacetic acid solution was used to remove DMTr. The target oligonucleotide was collected, freeze-dried, and identified as the target product by LC-MS, and then quantified by UV (260 nm).

[0120] The obtained single-stranded oligonucleotide was annealed according to the equimolar ratio of two complementary sequences, and the obtained double-stranded siRNA was dissolved in 1X PBS and adjusted to the required concentration for the experiment. These monomers are connected to each other into oligonucleotides through 5'-3'-phosphodiester bonds.

[0121] Preparation of siRNA

[0122] I. GalNAc Target Head or Linker

[0123] Compound SA51 (I-1-7), its synthesis method and structure are disclosed in the patent application No. 2024100522838.

[0124] II. Preparation of siRNA

[0125] The nucleotide monomers were connected one by one in the order of 3'-5' direction by solid-phase phosphoramidite method. Each connection of a nucleotide monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization. The same synthesis conditions were used for the sense strand and the antisense strand.

[0126] Instrument equipment model: Biolytic Dr. Oligo 48 solid-phase synthesizer, comma biological Embed CPG Frits general synthesis column DS0200, comma biological 96-well plate desalting column DC189650 (80 mg). Table 1 shows the reagents used for the synthesis of siRNA conjugates.

[0127] Table 1

[0128] The synthesis conditions are as follows:

[0129] The nucleotide monomers were provided in an acetonitrile solution with a concentration of 0.05 M. The deprotection conditions for each step were the same, i.e., the temperature was 25°C, the reaction time was 3 minutes, the deprotection reagent was DCA, and the sample volume was 180 μL.

[0130] The coupling conditions for each step were the same, including a temperature of 25°C and a reaction time of 3 minutes. The nucleotide monomer sample volume was 90 μL, and the catalyst ACT sample volume was 110 μL.

[0131] The capping conditions for each step were the same, including a temperature of 25°C and a reaction time of 2 minutes. The molar ratio of the capping reagent solution was a mixture of CapA and CapB at a ratio of 1:1. The capping reagent sample volume was 180 μL.

[0132] The oxidation conditions for each step were the same, including a temperature of 25°C, a reaction time of 3 minutes, and an oxidation reagent OXD sample volume of 180 μL.

[0133] The sulfurization conditions for each step were the same, including a temperature of 25°C, a reaction time of 4 minutes, and a sulfurization reagent of 0.05 M PADS in pyridine acetonitrile. The sulfurization reagent sample volume was 180 μL.

[0134] After the last nucleoside monomer is completed, the nucleic acid sequence connected to the solid carrier is sequentially cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense strand and the antisense strand, wherein:

[0135] The cutting and deprotection conditions are as follows: the synthesized nucleotide sequence connected with the carrier is added to an ammonia: ethanol = 3: 1 mixed solution to a volume of 0.8 mL. React at 50°C for 15 h, filter out the remaining carrier, and vacuum concentrate the supernatant to dryness.

[0136] The purification and desalting conditions are as follows: desalting is performed using a C18 reverse phase chromatographic column. The specific conditions include:

[0137] (1) Preparation of sample

[0138] 0.1M TEAA (triethylamine acetate) is added to the oligonucleotide sample to a volume of 0.8 mL.

[0139] (2) Activation of 96-well plate

[0140] Activation: 0.8 mL of acetonitrile is activated through each hole of the 96-well plate;

[0141] Equilibrium: the 96-well plate is equilibrated with 0.8 mL of TEAA (pH 7.0) solution.

[0142] (3) The purification process is performed in the following order:

[0143] 0.8 mL of the solution containing the oligonucleotide is passed through the desalting column;

[0144] The 96-well plate is washed with 0.8 mL of 6.5% ammonia water twice to remove failed sequences;

[0145] The 96-well plate is rinsed with 0.8 mL of deionized water twice to remove salt;

[0146] The 96-well plate is rinsed with 0.8 mL of 3% trifluoroacetic acid three times to remove DMT, and the adsorption layer is observed to turn orange-red;

[0147] The 96-well plate is rinsed with 0.8 mL of 0.1M TEAA;

[0148] The 96-well plate is rinsed with 0.8 mL of deionized water twice to remove trifluoroacetic acid and residual salt;

[0149] 0.6 mL of 20% acetonitrile is used for elution, and freeze-drying is performed.

[0150] The detection method is as follows: the above sense strand and antisense strand purity and molecular weight are detected and analyzed using WATERS ACQUITY UPLC-LTQ LCMS (COLUMN: ACQUITY UPLC BEH C18). The measured value is consistent with the theoretical value, indicating that the synthesized is the sense strand and antisense strand conjugated with groups at the 3' end and / or 5' end.

[0151] The annealing operation is as follows: the synthesized sense strand and antisense strand are dissolved in water for injection respectively, a solution of 0.1 mg / mL-40 mg / mL is prepared, the isomolar ratio is calibrated with a concentration instrument, mixed, heated at 90°C for 5 minutes, and then slowly naturally cooled, so that they form a double-stranded structure through hydrogen bonding, and the sample is sent for detection of the SEC purity of the product. The double-stranded sample is freeze-dried.

[0152] Example 3 In vivo efficacy of different double-target compounds in hPD-1 / PD-L1 humanized mouse AAV-HBV (hepatitis B virus) model

[0153] In this example, the in vivo efficacy of different design double-target siRNA in the hPD-1 / PD-L1 humanized mouse AAV-HBV model was evaluated, and the siRNA conjugate was synthesized by solid-phase synthesis as in Example 2, and the specific sequence and modification information are shown in Table 2.

[0154] Table 2

[0155] Experimental method:

[0156] The hPD-1 / PD-L1 humanized mouse AAV-HBV model was constructed 6 weeks before the administration of the conjugate. A mouse animal model of persistent HBV infection was prepared by injecting rAAV8-1.3HBV into the tail vein of 6-8-week-old B6-hPD-1 / PD-L1 female mice. The injection dose of AAV virus was 1E+11 vg per mouse, and the animals were submandibularly bled 6 weeks after virus injection. After bleeding, the blood was centrifuged at 5000 rpm, 4°C for 10 minutes. The serum was diluted with PBS, and the dilution factor was determined according to the actual situation. Then the diluted sample was sent to Beijing Di'an Medical Laboratory Co., Ltd. for detection of HBsAg (hepatitis B surface antigen), and the determination result was back calculated according to the dilution factor. The HBsAg quantitative method is direct electrochemical luminescence method. According to the HBsAg level, the animals were subcutaneously injected on day 0, and G1, G2 and G3 groups were injected with different designed double-target siRNAs, respectively, SD4875-G3839G3763, SD5394-G3763G3839 and SD5395-G3839G3763, with a dose of 6 mg / kg. G4 group was administered with a mixture of SD004180 (PD-L1 siRNA) and SD004195 (HBV mRNA siRNA) at a dose of 6 mg / kg (3 mg / kg each). Blood was taken to detect the levels of HBsAg and HBV DNA at 7th, 14th, 21st, 28th, 35th, 42nd, 49th and 56th days of the experiment to evaluate the activity of siRNA against hepatitis B virus.

[0157] The HBsAg and HBV DNA levels at different time points were calculated as percentages compared to the pre-administration, and the results are shown in Figure 1. The results show that the design of SD5395-G3839G3763 in G3 group is comparable to the activity of the mixture, indicating that this design has no effect on the activity, and can achieve simultaneous targeting and inhibition of viral and host immune targets with only one administration, better drug compliance, and better controllability of compound synthesis quality. SD5395-G3763G3839 has no rebound effect 8 weeks after drug withdrawal, which is expected to solve the problem of clinical rebound after drug withdrawal of existing hepatitis B drugs.

[0158] Example 4 Optimization of Double-Target Conjugate in hPD-1 / PD-L1 Humanized Mouse AAV-HBV (Hepatitis B Virus) Model

[0159] According to the design in Example 3, the modification mode of HBV siRNA was optimized. The siRNA conjugate was obtained by solid-phase synthesis in Example 2, and the specific sequence and modification information are shown in Table 3.

[0160] In this example, siRNA was selected for conjugate synthesis, and the in vivo efficacy was evaluated in the hPD-1 / PD-L1 humanized mouse AAV-HBV model.

[0161] Table 3

[0162] Experimental method:

[0163] The hPD-1 / PD-L1 humanized mouse AAV-HBV model was constructed 6 weeks before the conjugate administration. The mouse animal model of persistent HBV infection was prepared by injecting rAAV8-1.3HBV into the tail vein of 6-8-week-old B6-hPD-1 / PD-L1 female mice. The AAV virus injection dose was 1E+11 vg per mouse, and the animals were submandibularly bled 6 weeks after virus injection. After blood collection, centrifugation was performed at 5000 rpm, 4°C for 10 minutes. The serum was diluted with PBS, and the dilution factor was determined according to the actual situation. Then the diluted sample was sent to Beijing Di'an Medical Laboratory Co., Ltd. for detection of HBsAg (hepatitis B surface antigen), and the measured results were back calculated according to the dilution factor. The HBsAg quantitative method is direct electrochemical luminescence method. According to the HBsAg level, the animals were subcutaneously injected on day 0, and G1-G3 groups were subcutaneously injected with PBS, SD5395-G3839G3763, and SD5475-G3763G3839, respectively, at a dose of 6 mg / kg. The activity of siRNA against hepatitis B virus was evaluated by detecting HBsAg at 7 days and HBsAg and HBV DNA at 14 days.

[0164] The reduction values of HBsAg and HBV DNA at different time points compared to those before administration are shown in Table 4. The results show that SD5475-G3763G3839 has better efficacy, which is expected to obtain better benefits in the clinic.

[0165] Table 4

Claims

1. A double-stranded RNA, characterized in that: It comprises a first double-stranded RNA and a second double-stranded RNA; wherein one of the first double-stranded RNA and the second double-stranded RNA targets the HBV life cycle, and the other targets the host immune target PD-L1.

2. The double stranded RNA of claim 1, wherein: The double-stranded RNA comprises a mixture of the first double-stranded RNA and the second double-stranded RNA, or the first double-stranded RNA and the second double-stranded RNA are connected by a linker.

3. The double stranded RNA of claim 1, wherein: From 5' end to 3' end, the sense strand of one of the first double-stranded RNA and the second double-stranded RNA differs from the sequence GUGUGCACUUCGCUUCACA by no more than 3 nucleotides, and the anti-sense strand differs from the sequence UGUGAAGCGAAGUGCACACUU by no more than 3 nucleotides; the sense strand of the other differs from the sequence AGAUGAGGAUAUUUGCUGA by no more than 3 nucleotides, and the anti-sense strand differs from the sequence UCAGCAAAUAUCCUCAUCUUU by no more than 3 nucleotides; each nucleotide in the first double-stranded RNA and the second double-stranded RNA is independently a modified or unmodified nucleotide.

4. The double stranded RNA of claim 3, wherein: The 3' end and / or 5' end of the sense strand of the first double-stranded RNA and / or the sense strand of the second double-stranded RNA is connected with an inverted abasic deoxyribose residue; or, The 5' end of the anti-sense strand of the first double-stranded RNA and / or the anti-sense strand of the second double-stranded RNA has a VP modification; or, In the sense strand of each double-stranded RNA, in the direction from 5' to 3', 2'-fluoro-modified nucleotides are located at the 7th, 8th and 9th positions of the sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; in the anti-sense strand of each double-stranded RNA, in the direction from 5' to 3', 2'-fluoro-modified nucleotides are located at the 2nd, 6th, 14th and 16th positions of the anti-sense strand, and the remaining positions are 2'-methoxy-modified nucleotides; or, In the sense strand of each double-stranded RNA, in the direction from 5' to 3', the sense strand comprises a phosphorothioate group at any one or more of the following positions: between the 1st and 2nd nucleotides from the 5' end of the sense strand, between the 2nd and 3rd nucleotides from the 5' end of the sense strand; or In the sense strand of each double-stranded RNA, in the direction from 5' to 3', the sense strand further optionally comprises a phosphorothioate group at one or more of the following positions: between the 1st and 2nd nucleotides from the 3' end of the sense strand, between the 2nd and 3rd nucleotides from the 3' end of the sense strand; or In the anti-sense strand of each double-stranded RNA, in the direction from 5' to 3', the anti-sense strand comprises a phosphorothioate group at any one or more of the following positions: between the 1st and 2nd nucleotides from the 5' end of the anti-sense strand, between the 2nd and 3rd nucleotides from the 5' end of the anti-sense strand, between the 1st and 2nd nucleotides from the 3' end of the anti-sense strand, between the 2nd and 3rd nucleotides from the 3' end of the anti-sense strand, between the 2nd and 3rd nucleotides from the 3' terminus of the antisense strand; or, In the 5' to 3' direction, the nucleotide at any one or more of positions 6 through 10 of the antisense strand comprises a nucleotide having the structure the modification shown, wherein R1 is H, OH, or CH3, and R2 is a natural nucleobase, an unnatural nucleobase, or an H atom.

5. The double stranded RNA according to any one of claims 1 to 4, wherein: The first double-stranded RNA and the second double-stranded RNA are linked by a linker, the linker comprising one or more of the groups as shown in structural formula (I): wherein L is absent or selected from the linking combination of one or more of the groups shown in the following formulae (A1)-(A14): wherein R' is hydrogen, C1-C10 alkyl, or C3-C8 cycloalkyl; j1 is an integer from 1 to 20; and j2 is an integer from 1 to 20. m represents an integer from 0 to 6. Q represents wherein R2 and R3 are each independently selected from H, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, or C2-C20 alkynyl. X represents wherein R4 and R5 are each independently selected from H, fluorine, hydroxyl, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, C2-C20 alkynyl, or R4 and R5 are directly connected to form a ring, and p is an integer from 1 to 6. Z represents N or CR9, wherein R9 is selected from H, C1-C20 alkyl, or C3-C10 cycloalkyl. represents C3-C8 cycloalkyl or C3-C8 heterocyclyl. R1 is selected from H, fluorine, hydroxyl, cyano, C1-C20 alkyl, C1-C20 alkoxy, C2-C20 alkenyl, or C2-C20 alkynyl. Y is absent or is fluorine, chlorine, hydroxyl, a delivery molecule; wherein represents the site of covalent linkage of the group.

6. The double stranded RNA of claim 5, wherein: L is absent or is selected from one or more of A1, A2, A3, A5, A6, A7, A8, A10, A11, A13 in a linking combination; or, R' is hydrogen, C1-C8 alkyl, or C3-C8 cycloalkyl; j1 is an integer from 1 to 15; and j2 is an integer from 1 to 15; or, m represents an integer from 0 to 3; or, R2 and R3 are each independently selected from H, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl; or, X represents or Z represents CR9, wherein R9 is selected from H, C1-C10 alkyl, or C3-C8 cycloalkyl; or, represents C3-C6 cycloalkyl or C3-C8 nitrogen-containing heterocyclyl; or, R1 is selected from H, fluorine, hydroxyl, cyano, C1-C10 alkyl, C1-C10 alkoxy, C2-C10 alkenyl, or C2-C10 alkynyl; or, The delivery molecule is 7. The double stranded RNA of claim 6, wherein: L is absent or is selected from one or more of A1, A2, A3, A5, A6, A7 in a linking combination; or, R' is hydrogen, C1-C5 alkyl, or C4-C6 cycloalkyl; j1 is an integer from 3 to 15; and j2 is an integer from 3 to 15; or, Y is absent, or is hydroxy, or is 8. The double stranded RNA of claim 7, wherein: L is absent or is selected from one or more of A1, A2, A5, A7 in a linking combination.

9. The double stranded RNA of claim 8, wherein: L is absent or is selected from a linking combination of at least two of A1, A2, A5, A7.

10. The double stranded RNA of claim 5, wherein: the linker is connected to the 3' end of the sense strand of the first double-stranded RNA and to the 5' end of the sense strand of the second double-stranded RNA via a phosphodiester bond or a phosphorothioate bond, respectively.

11. The double stranded RNA of claim 10, wherein: the linker is connected to the 3' end of the sense strand of the first double-stranded RNA and to the 5' end of the sense strand of the second double-stranded RNA via a phosphodiester bond or a phosphorothioate bond, respectively.

12. The double stranded RNA of claim 5, wherein: the linker is connected to the 3' end of the sense strand of the first double-stranded RNA and to the 5' end of the sense strand of the second double-stranded RNA via a phosphodiester bond or a phosphorothioate bond, respectively.

13. The double stranded RNA of claim 5, wherein: The group as shown in structural general formula (I) is any one selected from the structures as shown below:

14. The double stranded RNA of claim 5, wherein: The linker is of the structure of Formula (II): wherein the three L in formula (II) are the same or different in structure; the three Y in formula (II) are the same or different in structure; the three m in formula (II) are the same or different in value; M is O or S; representing four to eight membered saturated nitrogen containing heterocyclic rings, three of which are in formula (II) are the same or different in structure.

15. The double stranded RNA of claim 14, wherein: The double-stranded RNA is a substance selected from the group consisting of the following structures: wherein M is O or S, siRNA1 is the first double-stranded RNA, and siRNA2 is the second double-stranded RNA.

16. The double stranded RNA of claim 1, wherein: The first double-stranded RNA and the second double-stranded RNA are both siRNAs; or, The double-stranded RNA further comprises a conjugate group covalently conjugated to the first double-stranded RNA and / or the second double-stranded RNA, the conjugate group being a lipid or a ligand of a receptor; preferably, the conjugate group is defined the same as the linker; or, The antisense strand of the first double-stranded RNA and the antisense strand of the second double-stranded RNA are separated from each other, or linked by a nucleotide or a nucleotide derivative, or linked by a Linker; preferably, the Linker is defined the same as or different from the linker; or, The double-stranded RNA has liver-specific targeting property.

17. The double stranded RNA of claim 1, wherein: from 5' end to 3' end, the sense strand of the first double-stranded RNA is AmsGmsAmUmGmAmGfGfAfUmAmUmUmUmGmCmUmGmAm, and the antisense strand is VPUmsCfsAmGmCmAfAmAmUmAmUmCmCmUfCmAfUmCmUmsUmsUm; the sense strand of the second double-stranded RNA is GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmsCmsAm, and the antisense strand is VPUmsGfsUmGmAmAfIsoGCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm; or from 5' end to 3' end, the sense strand of the first double-stranded RNA is AmsGmsAmUmGmAmGfGfAfUmAmUmUmUmGmCmUmGmAm, and the antisense strand is VPUmsCfsAmGmCmAfAmAmUmAmUmCmCmUfCmAfUmCmUmsUmsUm; the sense strand of the second double-stranded RNA is IB-s-GmUmGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmAm-s-IB, and the antisense strand is VPUmsGfsUmGmAmAfIsoGCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm.

18. A pharmaceutical composition, characterized by: It comprises the double-stranded RNA of any one of claims 1 to 17, and a pharmaceutically acceptable carrier or excipient.

19. The pharmaceutical composition of claim 18, wherein: The pharmaceutical composition is used for treating hepatitis B or hepatitis B virus infection.

20. A method for treating hepatitis B or a hepatitis B virus infection in a human patient, comprising: administering to the patient a therapeutically effective amount of a compound of claim 1, or a pharmaceutically acceptable salt thereof. It comprises administering the double-stranded RNA of claim 1 to the human patient. It comprises administering the double-stranded RNA of claim 1 to the human patient.

Citation Information

Patent Citations

  • Application of bifunctional vector in inhibiting HBV (hepatitis B virus) infection

    CN108285907A

  • Methods and compositions for targeting PD-L1

    CN115176009A

  • Double-stranded RNA (Ribonucleic Acid) for regulating angiotensinogen gene expression, conjugate of double-stranded RNA, pharmaceutical composition and application of double-stranded RNA

    CN117568350A

  • SiRNA for inhibiting programmed cell death-ligand 1 gene expression, conjugate thereof, pharmaceutical composition and application

    CN117881783A

  • Double-stranded oligonucleotide, composition and conjugate comprising double-stranded oligonucleotide, preparation method therefor and use thereof

    WO2019105418A1