Method for breeding short grain-saving chickens by using PGC gene editing technology

Abstract

The invention provides a method for breeding short grain-saving chickens by using a PGC gene editing technology, and belongs to the field of poultry breeding and genetic engineering. A CRISPR-Cas9 system is utilized, gRNA designed for GHR gene 3 'UTR and tenth exon is used for guiding Cas9 nuclease for gene editing, partial deletion is introduced into the chicken GHR gene 3' UTR, the stability or translation efficiency of GHR mRNA is influenced, the expression level of GHR protein is reduced, and partial deletion is introduced into the tenth exon of the GHR gene, so that the intracellular signal transduction function of the GHR protein is damaged. The synergistic effect of the two mechanisms can reduce the sensitivity of the chicken to growth hormone, and the chicken shows the characteristics of being short and small. The short body type is generally related to lower metabolic requirements, and the gene editing chicken bred by the method can maintain the vital activity and production performance with less feed, so that the purpose of saving feed is achieved.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of poultry breeding and genetic engineering, and specifically relates to a method for breeding small grain-type chickens using PGC gene editing technology. BACKGROUND

[0002] In modern agriculture, efficient poultry production is crucial to meet the growing global demand for protein. Poultry, especially chickens, are an important food source for humans, and their production efficiency directly affects food security and economic benefits. The key to improving poultry production efficiency lies in optimizing growth rate, reducing disease susceptibility, and minimizing resource consumption.

[0003] In the process of poultry breeding, feed costs are one of the main economic burdens. Fluctuations in feed prices can have a significant impact on the profitability of the poultry industry. Therefore, breeding poultry varieties with higher feed conversion rates, i.e., consuming less feed to achieve the same growth level or production performance, has always been an important goal in poultry breeding.

[0004] Traditional poultry breeding methods mainly rely on selective breeding, which involves breeding individuals with desired traits over multiple generations to gradually improve the genetic characteristics of the breed, including feed efficiency. However, this method is usually time-consuming and the improvement effect is limited by naturally occurring genetic variation. In recent years, with the development of genetic engineering technology, especially gene editing technology, new ways have been provided for more rapid and precise genetic modification of poultry. Although some progress has been made in existing technologies, there is still a need to further improve feed efficiency and control body size.

[0005] Growth hormone (GH) and its receptor (GHR) play a crucial role in regulating chicken growth and metabolism. Growth hormone is secreted by the pituitary gland and binds to GHR on the surface of target cells, activating intracellular signaling pathways and affecting various physiological processes, including growth, development, and material metabolism. Studies have shown that GHR not only participates in the growth of bone and muscle, but also is essential for chicken mitochondrial function, which is directly related to energy production and utilization, thereby affecting feed efficiency. In addition, GHR also participates in regulating chicken lipid metabolism, affecting fat deposition and energy storage. Therefore, growth hormone and its receptor play a core role in regulating chicken growth and energy balance, and are key targets for improving chicken feed efficiency and body size.

[0006] Multiple mutations and variations in the GHR gene of chickens are known, which can significantly affect the phenotype of chickens, including dwarfism and feed efficiency. For example, sex-linked dwarf (SLD) chickens are caused by mutations in the GHR gene, characterized by reduced body size and shortened tibia. Some studies have shown that mutations in the GHR gene of dwarf chickens are associated with changes in feed intake and feed efficiency. Generally, dwarf chickens have reduced feed intake, which is beneficial for reducing feeding costs. The 3'UTR region of the GHR gene plays an important role in gene expression regulation, affecting mRNA stability, translation efficiency, etc. For example, microRNAs such as let-7b can target the 3'UTR of GHR to inhibit the expression of GHR, thereby affecting the growth of chickens. Deletion of the 3'UTR can change the stability of mRNA and the translation process. The 10th exon of the GHR gene encodes part of the intracellular domain of the GHR protein, which is essential for the transmission of growth hormone signals. Mutations or deletions of the 10th exon can block the growth hormone signaling pathway, leading to growth restriction and even dwarfism. Studies have shown that deletions or mutations in the 10th exon and 3'UTR region of the GHR gene are associated with the dwarf phenotype of chickens.

[0007] Gene editing technology, especially the CRISPR-Cas9 system, provides an efficient and versatile tool for precisely modifying the chicken genome. CRISPR-Cas9 has been widely used for gene knockout, gene insertion, and other gene editing operations in chickens, providing strong technical support for improving poultry traits. By designing specific guide RNA (gRNA), the CRISPR-Cas9 system can accurately target the target site on the genome and induce DNA double-strand breaks, which are repaired by mechanisms such as non-homologous end joining (NHEJ), thereby achieving gene knockout or deletion. SUMMARY

[0008] The purpose of the present application is to provide a method for breeding dwarf and grain-saving chickens.

[0009] To achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0010] The present application provides a method for breeding dwarf and grain-saving chickens using PGC gene editing technology. The CRISPR-Cas9 system is used to guide Cas9 nuclease for gene editing by designing gRNA targeting the 3'UTR and / or the 10th exon of the GHR gene, resulting in partial deletion of the 3'UTR region of the GHR gene and partial deletion of the 10th exon of the GHR gene.

[0011] The gRNA includes sgRNA1 and sgRNA2

[0012] sgRNA1 SEQ ID NO.1: AAAGAATTTAACATGTCTTG;

[0013] sgRNA2 SEQ ID NO.2: TGACATTCTGAGTTTGATTG.

[0014] Preferably, the partial deletion of the GHR gene 3'UTR region ranges from 1050 to 1700 base pairs, and the partial deletion of the 10th exon ranges from 30 to 100 base pairs.

[0015] The specific operation of the breeding method is as follows:

[0016] (1) Design gRNA sequences respectively for the GHR gene 3'UTR and the 10th exon, and construct gRNA expression vectors;

[0017] (2) Mix the gRNA expression vectors and the Donor template, introduce into chicken PGCs, perform gene editing in vitro, then transplant the edited PGCs back into the recipient embryos, and incubate;

[0018] (3) Select the gene edited chicken carrying the target deletion and showing ideal dwarf and grain-saving characteristics for breeding, and establish a stable homozygous strain.

[0019] Preferably, the whole gene sequence of the gRNA expression vector is shown in SEQ ID NO. 3.

[0020] The sequence of the Donor template is shown in SEQ ID NO. 4.

[0021] Preferably, the content of the gRNA expression vector in the mixed solution is 0.8-1.2 μg / ml,

[0022] The content of the Donor template in the mixed solution is 0.8-1.2 μg / ml.

[0023] The application further provides a reagent for breeding dwarf grain-saving type chickens, comprising the gRNA expression vector and the Donor template.

[0024] The present application reduces the expression level of GHR protein by introducing partial deletion in the 3'UTR of GHR gene of chicken, affecting the stability or translation efficiency of GHR mRNA. The partial deletion of the 10th exon will destroy the intracellular signal transduction function of GHR protein. The synergistic effect of the two mechanisms will lead to the decrease of the sensitivity of chicken to growth hormone, thereby showing the characteristics of dwarfism. The dwarf type of chicken bred by the present application has an adult body weight at least 20% lower than that of wild type chicken, but the feed conversion rate is increased by at least 10%, which can maintain its life activities and production performance with less feed, thereby achieving the purpose of saving feed. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Structure diagram of gRNA expression vector. DETAILED DESCRIPTION

[0026] The technical solutions provided by the present application will be described in detail below in combination with examples, but they should not be understood as limiting the scope of protection of the present application.

[0027] Example 1

[0028] 1. Design and construction of gRNA:

[0029] According to the sequence information (accession number: Gene ID: 408184) of chicken GHR gene, and the position of 3'UTR and the 10th exon, the gRNA sequence targeting 3'UTR and the 10th exon is designed.

[0030] The gRNA sequence is:

[0031] sgRNA1: AAAGAATTTAACATGTCTTG (SEQ ID NO. 1);

[0032] sgRNA2: TGACATTCTGAGTTTGATTG (SEQ ID NO. 2).

[0033] The designed gRNA sequence is respectively cloned into the vector-pX330 skeleton for expressing sgRNA, to obtain gRNA expression vector (structure diagram as Figure 1 , the full sequence is shown as SEQ ID NO. 3. These vectors usually contain an expression cassette of Cas9 nuclease, which is described in detail in Figure 1 .

[0034]

[0035] 3. Injection of gene editing tools

[0036] An equal volume of gRNA expression vector (final concentration 1 μg / ml) and Donor template with point mutations (SEQ ID NO. 4, final concentration 1 μg / ml) were mixed and then introduced into chicken PGCs by transfection. Using the CRISPR-Cas9 system, a gRNA designed for the 3'UTR and / or the 10th exon of the GHR gene was used to guide the Cas9 nuclease for gene editing, resulting in partial deletion of the 3'UTR region of the GHR gene and partial deletion of the 10th exon of the GHR gene. The edited PGCs were then transplanted back into the recipient embryos and hatched.

[0037] Donor sequence (SEQ ID NO. 4):

[0038] GGAGCTTCAATGGCAGAAACCCCAAGTATGGAAATGCCTGTCCCAGACTACACTTCTATTCATATTGTTCACTCTCCACAAGGCCTTGTGCTCAATGCAAATTCTGAATGCCATTTTGGTACTTTACTGGTCACACAAGCCATTATTCGCCGGTCAGAAGATGTGTCTTTCAGTTTCTATTTAACTTTCCTTATGTCAGT;

[0039] 4. Hatching of embryos and screening of offspring

[0040] Blood was collected from the chickens and genomic DNA was extracted. The 3'UTR and 10th exon regions of the GHR gene were amplified using PCR technology, and the PCR products were subjected to gel electrophoresis. The PCR products with abnormal electrophoresis results (deletion occurred) were subjected to Sanger sequencing (such as SEQ ID NO. 5) to determine the specific sequence and range of the deletion. Individuals carrying both 3'UTR and 10th exon partial deletion genes were identified. AAACACTGACATAAGGAAAGTTAAATAGAAACTGAAAGACACATCTTCTGACCGGCGAATAATGGCTTGTGTGACCAGTAAAGTACCAAAATGACATTCTGAGTTTGCATTGAGCACAAGGCCTTGTGGAGAGTGAACAATATGAATAGAAGTGTAGTCTGGGACAGGCATTTCCATACTTGGGGTTTCT sequencing results, the above process was entrusted to Suzhou Jinyuizhi Biological Co., Ltd.

[0041] 5. Phenotype analysis and establishment of line:

[0042] The gene edited chicken with the target deletion and showing the ideal dwarf and grain-saving characteristics is selected for breeding to establish a stable homozygous line. Through multiple generations of breeding and selection, a stable dwarf grain-saving chicken line is finally obtained.

[0043] Example 2

[0044] The identified gene edited chicken carrying the target deletion is bred separately from the unedited chicken. White leihang chicks at 1 day old are selected for the experiment, the total amount of feed is weighed and recorded at a fixed time (8 am) every day, the remaining feed is collected and weighed at the same time the next day, the daily feed consumption of the gene edited chicken is recorded, and the feed conversion rate is calculated. The body weight of the gene edited chicken and the wild type chicken is measured before feeding every day to evaluate the degree of dwarf phenotype and grain-saving characteristics.

[0045] The results show that the adult weight of the dwarf grain-saving chicken bred in the present application is at least 20% lower than that of the wild type chicken, but the feed conversion rate is increased by at least 10%.

[0046] When the female gene edited chicken grows to 25 weeks old, the number of eggs laid is recorded at 8:00 am every day, and 20 eggs are randomly selected to measure the egg weight, which is compared with that of the wild type chicken (the measurement method is the same as that of the gene edited chicken) for 3 weeks to evaluate whether the egg laying performance is affected. The results show that the average daily egg laying amount of the dwarf grain-saving chicken bred in the present application is 0.90 per chicken, and the egg weight is 60g, which has no significant difference with the egg laying performance of the wild type chicken.

[0047] The above only describes the preferred embodiments of the present application, and it should be noted that for those skilled in the art, without departing from the principles of the present application, a number of improvements and refinements can be made, which should also be considered as the protection scope of the present application.

Claims

1. A method for breeding dwarf, feed-efficient chickens using PGC gene editing technology, characterized in that, Using the CRISPR-Cas9 system, gRNA designed targeting the 3'UTR and / or exon 10 of the GHR gene was used to guide the Cas9 nuclease to perform gene editing, resulting in partial deletion of the 3'UTR region and exon 10 of the GHR gene; The gRNA includes sgRNA1 and sgRNA2; sgRNA1 SEQ ID NO.1: AAAGAATTTAACATGTCTTG; sgRNA2 SEQ ID NO. 2: TGACATTCTGAGTTTGATTG.

2. The method as described in claim 1, characterized in that, The partial deletion in the 3'UTR region of the GHR gene ranges from 1050 to 1700 base pairs, and the partial deletion in the 10th exon ranges from 30 to 100 base pairs.

3. The method as described in claim 1, characterized in that, The specific operation of the cultivation method is as follows: (1) Design gRNA sequences targeting the 3'UTR and exon 10 of the GHR gene, respectively, and construct gRNA expression vectors; (2) The gRNA expression vector and the Donor template were mixed and introduced into chicken PGCs for in vitro gene editing. The edited PGCs were then transplanted back into the recipient embryos and hatched. (3) Select gene-edited chickens that carry the missing target and exhibit dwarfism and feed-saving characteristics for breeding to establish a stable homozygous strain.

4. The method as described in claim 3, characterized in that, The full genome sequence of the gRNA expression vector is shown in SEQ ID NO.

3.

5. The method as described in claim 3, characterized in that, The sequence of the Donor template is shown in SEQ ID NO.

4.

6. The method as described in claim 3, characterized in that, The concentration of the gRNA expression vector in the mixture is 0.8–1.2 μg / ml; The content of the Donor template in the mixture is 0.8–1.2 μg / ml.

7. A reagent used for breeding dwarf, feed-efficient chickens, characterized in that, This includes the gRNA expression vector and the Donor template.

Images