Application of Mpswd3 or gene expression regulation substance thereof in regulation of aminobutyric acid expression in monascus purpureus
By overexpressing or knocking out the Mpswd3 gene in Monascus purpureus, the synthesis of γ-aminobutyric acid (GABA) was regulated, solving the problem of insufficient GABA production and achieving a significant increase in GABA yield, which has important industrial application value.
Patent Information
- Application Number
- CN202511402969.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-28
- Publication Date
- 2025-12-12
AI Technical Summary
In the existing technology, the regulatory factors of γ-aminobutyric acid (GABA) synthesis in Monascus purpureus have not been fully explored, resulting in insufficient GABA production during fermentation and affecting its application in food fermentation.
By using genetic engineering techniques, the Mpswd3 gene in Monascus purpureus was overexpressed or knocked out to regulate the synthesis of γ-aminobutyric acid (GABA). The Mpswd3 gene expression regulator was then used to regulate GABA expression in Monascus purpureus, thereby increasing its yield.
It significantly increased the synthesis of γ-aminobutyric acid (GABA), increasing it by 45.4% during overexpression and decreasing it by 66% during knockout. This provides a key target for improving the fermentation production efficiency of GABA and has significant industrial application value.
Smart Images

Figure BDA0005619401570000051 
Figure BDA0005619401570000061 
Figure HDA0005619401580000011
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genetic engineering, in particular to the application of Mpswd3 or its gene expression regulation substance in regulating the expression of aminobutyric acid in Monascus purpureus. BACKGROUND
[0002] Monascus purpureus is a small filamentous fungus widely used in food fermentation in China and even Southeast Asia. Monascus rice produced by Monascus fermentation has a history of thousands of years of use in China. Under appropriate conditions, Monascus fermentation can produce beneficial secondary metabolites such as gamma-aminobutyric acid. Gamma-aminobutyric acid has a protective effect on cell apoptosis induced by neurotoxicity and can inhibit the activity of angiotensin I converting enzyme, thereby lowering blood pressure. Therefore, the secondary metabolite gamma-aminobutyric acid of Monascus has anti-inflammatory, antifungal and neuroprotective effects. In order to improve the yield of gamma-aminobutyric acid in the production fermentation process, it is crucial to find appropriate fermentation strategies.
[0003] Monascus purpureus is a saprophytic fungus with a life cycle including a sexual stage and an asexual stage. Asexual reproduction is generated by mycelium to form conidial stalks, and conidial stalks at the top generate conidia, which are spherical or pear-shaped and can germinate to form mycelium. Sexual reproduction is performed by antheridia and ascogonia, and is surrounded by mycelium to form an initial closed ascus. After maturation, it is orange-red and contains multiple ascospores. The normal mycelial growth and spore formation of Monascus affect the synthesis of secondary metabolites such as gamma-aminobutyric acid. Therefore, revealing the biological process of Monascus and mining functional genes is of great significance for finding potential targets for gamma-aminobutyric acid synthesis.
[0004] The genome size of Monascus purpureus is about 22.6 Mb, and it is predicted to contain 9998 genes. The annotation of the genome lays a solid foundation for subsequent functional gene research. According to genome analysis, the synthesis of GABA is mainly through the action of glutamate decarboxylase on glutamate, and under the catalysis of GABA permease, transaminase and succinate semialdehyde dehydrogenase, GABA metabolites and their metabolites succinate enter the tricarboxylic acid cycle. The synthesis of gamma-aminobutyric acid in Monascus purpureus can be regulated by gene editing strategies, but there are few reports on key factors regulating the synthesis of gamma-aminobutyric acid. SUMMARY
[0005] In order to solve the above technical problems, the present application provides a gene that positively regulates the synthesis of gamma-aminobutyric acid in Monascus and its application.
[0006] The present application provides the application of Mpswd3 or its gene expression regulation substance in regulating the expression of aminobutyric acid in Monascus purpureus.
[0007] The application also provides a purple-red yeast producing aminobutyric acid, which contains the substance overexpressing the Mpswd3 gene or has the exogenous Mpswd3 gene integrated into the genome.
[0008] The application also provides a method for increasing the expression amount of aminobutyric acid in purple-red yeast, which comprises overexpressing the Mpswd3 gene in the purple-red yeast.
[0009] The application brings the beneficial effects, which include but are not limited to: the application identifies that the Mpswd3 gene in the purple-red yeast can positively regulate the synthesis of gamma-aminobutyric acid in the red yeast. After knocking out the Mpswd3 gene, the synthesis amount of gamma-aminobutyric acid in the purple-red yeast is significantly reduced (reduced by 66%), and the expression amount of the key synthesis enzyme glutamate decarboxylase encoding gene Mpgad1 is also significantly reduced; and when the gene is overexpressed, the synthesis amount of gamma-aminobutyric acid is significantly increased (increased by 45.4%). This finding provides a key target and application basis for regulating the yield of gamma-aminobutyric acid in red yeast through genetic engineering means, and has important industrial application value for improving the fermentation production efficiency of gamma-aminobutyric acid. BRIEF DESCRIPTION OF DRAWINGS
[0010] The application will be further described in the form of exemplary embodiments, which will be described in detail with reference to the accompanying drawings. These embodiments are not limiting, wherein:
[0011] Figure 1 A schematic diagram for knocking out the red yeast MpSwd3 gene and verifying the transformant, Figure 1 A is a schematic diagram for knocking out strategy; Figure 1 B is PCR detection of MpSwd3 gene knockout and overexpression transformant.
[0012] Figure 2 A diagram for detecting the expression amount of Mpswd3 gene, Figure 2 A is the detection of the expression amount of Mpswd3 gene in the ΔMpswd3 strain, Figure 2 B is the detection of the expression amount of Mpswd3 gene in the Mpswd3-OE strain.
[0013] Figure 3 Mpswd3 gene regulates the growth of red yeast mycelium, Figure 3 A is the growth phenotype of red yeast colony, Figure 3 B is the growth diameter statistics of red yeast.
[0014] Figure 4 Knocking out the Mpswd3 gene reduces the expression amount of glutamate decarboxylase encoding gene Mpgad1.
[0015] Figure 5A is that Mpswd3 gene knockout leads to decrease of γ-aminobutyric acid synthesis amount, Figure 5 A is that Mpswd3 gene knockout leads to decrease of γ-aminobutyric acid synthesis amount, Figure 5 B is that Mpswd3 gene overexpression leads to increase of γ-aminobutyric acid synthesis amount. DETAILED DESCRIPTION
[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present specification, the drawings needed to be used in the embodiment description will be briefly introduced as follows. Obviously, the drawings in the following description are only some examples or embodiments of the present specification, and for those skilled in the art, the present specification can also be applied to other similar scenarios without creative labor on the basis of these drawings. Unless the context clearly indicates otherwise or otherwise stated, the same reference numbers in the drawings represent the same structures or operations.
[0017] As shown in the specification and claims, unless the context clearly indicates otherwise or otherwise stated, "one", "a", "an", and / or "the" do not refer to the singular, but can also include the plural. Generally speaking, the terms "comprise" and "include" only indicate the inclusion of the steps and elements explicitly identified, and these steps and elements do not constitute an exclusive list, and the method or device can also include other steps or elements.
[0018] Flowcharts are used in the present specification to illustrate the operations performed by the system according to the embodiments of the present specification. It should be understood that the preceding or subsequent operations are not necessarily performed in sequence. On the contrary, each step can be processed in reverse order or simultaneously. At the same time, other operations can also be added to these processes, or one or more steps of operations can be removed from these processes.
[0019] The present application provides the application of Mpswd3 or its gene expression regulation substance in regulating the expression of aminobutyric acid in Monascus purpureus.
[0020] In some embodiments, the aminobutyric acid can be γ-aminobutyric acid.
[0021] In some embodiments, the amino acid sequence of Mpswd3 can be as shown in SEQ ID NO. 1.
[0022] In the present specification, "sequence" should be generally understood to include both the relevant amino acid sequence and the nucleic acid sequence or nucleotide sequence encoding the amino acid sequence, unless a more limited interpretation is required in the context.
[0023] In some embodiments, the regulation of aminobutyric acid expression can increase the expression amount of aminobutyric acid, and the gene expression regulation substance can be a substance overexpressing Mpswd3 gene.
[0024] In some embodiments, the substance overexpressing the Mpswd3 gene can be a vector. In some embodiments, preferably, the vector can be an Agrobacterium vector.
[0025] In some embodiments, the vector can comprise an expression cassette, which can comprise a nucleotide sequence of the Mpswd3 gene and a regulatory element regulating the expression of the Mpswd3 gene. In some embodiments, preferably, the nucleotide sequence of the Mpswd3 gene can be as shown in SEQ ID NO. 2.
[0026] As used herein, the terms "polynucleotide", "nucleotide", "oligonucleotide" and "nucleic acid" can be used interchangeably to refer to nucleic acids including DNA, RNA, derivatives thereof or combinations thereof.
[0027] An expression cassette is a functional DNA sequence module used in genetic engineering to drive the specific transcription and expression of foreign genes in host cells, usually composed of promoters, coding regions (target genes), transcription terminators and other regulatory elements.
[0028] As used herein, the terms "expression vector", "vector" can be used interchangeably to refer to a polynucleotide capable of carrying at least one polynucleotide fragment. The vector can deliver the fragments of nucleic acid, individual polynucleotides into host cells. It can comprise at least one expression cassette containing regulatory sequences for the correct expression of polynucleotides incorporated therein. The polynucleotides to be introduced into cells (such as polynucleotides encoding the product of interest or selection markers) can be inserted into the expression cassette of the vector for expression therefrom. The expression vector according to the present application can exist in a circular or linear (linearized) form, and also includes expression construct fragments. The term "vector" also includes artificial chromosomes or similar individual polynucleotides that allow the transfer of exogenous nucleic acid fragments.
[0029] The present application also provides a purple-red yeast containing the substance overexpressing the Mpswd3 gene described in the above application, or the genome of which has integrated an exogenous Mpswd3 gene.
[0030] In some embodiments, the amino butyric acid can be gamma-aminobutyric acid.
[0031] In some embodiments, the Mpswd3 gene encodes an amino acid sequence which can be as shown in SEQ ID NO. 1. In some embodiments, preferably, the nucleotide sequence of the Mpswd3 gene can be as shown in SEQ ID NO. 2.
[0032] The present application also provides a method for increasing the expression amount of amino butyric acid in purple-red yeast, comprising overexpressing the Mpswd3 gene in purple-red yeast.
[0033] In some embodiments, the overexpression of the Mpswd3 gene in Monascus purpureus can include transforming a vector overexpressing the Mpswd3 gene into Monascus purpureus by Agrobacterium-mediated transformation.
[0034] In some embodiments, the aminobutyric acid can be gamma-aminobutyric acid.
[0035] In some embodiments, the Mpswd3 gene can encode an amino acid sequence as shown in SEQ ID NO. 1. In some embodiments, preferably, the nucleotide sequence of the Mpswd3 gene can be as shown in SEQ ID NO. 2.
[0036] In the following examples, the experimental methods are conventional unless otherwise specified. In the following examples, the test materials used are commercially available from conventional biochemical reagent companies unless otherwise specified. In the following examples, the quantitative tests are set up with three repeated experiments, and the average value is taken.
[0037] Example 1 - Identification and knockout of Monascus purpureus Mpswd3 gene
[0038] 1.1 Knockout of Monascus purpureus Mpswd3 gene
[0039] The amino acid sequence of the Monascus purpureus Mpswd3 gene is shown in SEQ ID NO. 1, and the gene sequence of the Monascus purpureus Mpswd3 gene is shown in SEQ ID NO. 2. An example of homologous recombination knockout is shown in Figure 1 (A).
[0040] The construction of the knockout vector was carried out as follows: the length of the Mpswd3 gene is 1749 bp, and the Agrobacterium-mediated homologous recombination method is used to replace the target gene fragment with a hygromycin resistance gene fragment, and the PCR and qRT-PCR methods are used for verification, and the mutant strain with complete knockout of the target gene is obtained.
[0041] The wild-type Monascus purpureus strain NRRL1596 preserved in the laboratory was used as a template to amplify the flanking sequences above and below the target gene by PCR, wherein the upstream fragment of the Mpswd3 gene is 1192 bp, named Mpswd3-5'; the downstream fragment of the Mpswd3 gene is 1124 bp, named Mpswd3-3'. The primer sequences are as follows:
[0042] Mpswd3-5'-F: ATTATGGAGAAACTCGAGAAGCATTCCTCCCGTCTCCGA (SEQ ID NO. 3)
[0043] Mpswd3-5'-R:TGCGAGCCCACCCTCGAGCCAGTGCTGTCTTCTCCCAGCT(SEQ ID NO.4)
[0044] Mpswd3-3'-F:TCTAGAGTCGACCTGCAGATCACCAACGGTGCTTAGTTATCGAC(SEQ ID NO.5)
[0045] Mpswd3-3'-R:ACGGCCAGTGCCAAGCTTGAATCCAAGAGGTATGGATCACGGA (SEQ ID NO.6)
[0046] The fragment was amplified using KOD one PCR Master Mix. The amplification reaction system was as follows:
[0047] KOD one PCR Master Mix 25μL
[0048] DNA template: 2μL
[0049] Primer F (10μm): 1.5μL
[0050] Primer R (10μm): 1.5μL
[0051] ddH2O: 20μL
[0052] Total 50μL
[0053] The amplification reaction procedure is as follows:
[0054]
[0055] The Mpswd3-5' and Mpswd3-3' fragments obtained in the above experiments were purified using a DNA purification and recovery kit. The purified fragments were cloned into the upstream and downstream of the hygromycin resistance gene of the pXEH8279 vector by homologous recombination. The correctly sequenced vector was transformed into wild-type strain NRRL1596 of Monascus purpureus using Agrobacterium-mediated transformation, and hygromycin-resistant transformants were screened on PDA medium containing hygromycin.
[0056] 1.2 Construction of strains overexpressing the Mpswd3 gene in Monascus purpureus
[0057] The Mpswd3 gene fragment was amplified using the following primer sequences:
[0058] Mpswd3-OE-F: CTCGACTCTAGAGGATCCATGGATGATTTCGATCATCCACC (SEQ ID NO. 7)
[0059] Mpswd3-OE-R: CTTGCTCACCATGGATCCTTCGGGTGCATTCGACAATTCTC (SEQ ID NO. 8)
[0060] The amplification reaction system and conditions are the same as 1.1
[0061] The Mpswd3 gene fragment obtained in the experiment is cloned into the pXEH8281 vector containing the GPDA promoter upstream of the G418 resistance gene. The correct vector is transformed by the agrobacterium-mediated transformation method to verify the correct Mpswd3 gene mutant, and the G418-resistant transformants are screened on the PDA medium containing G418.
[0062] The pXEH8281 vector containing the GPDA promoter is modified from pXEH8279. According to the prior art, the G418 resistance gene is replaced with the hygromycin resistance gene, and the GPDA promoter is cloned upstream of the G418 resistance gene.
[0063] 1.3 Verification of Monascus Mpswd3 gene knockout mutant and overexpression strain
[0064] 1.3.1 PCR verification of Mpswd3 gene knockout
[0065] The DNA of the transformants obtained in 1.1 is extracted for PCR verification. The verification primer is the internal primer of the target gene. The successfully knocked out mutant cannot be amplified to the corresponding fragment, and the wild type strain can be amplified to the corresponding fragment. The primer is:
[0066] Mpswd3-test-F: CAGATAATGCGCTTATTGCCTCG (SEQ ID NO. 9)
[0067] Mpswd3-test-R: ATCCTCGCTCCCACTCACAGC (SEQ ID NO. 10)
[0068] The detection system is:
[0069] DNA: 1 ul
[0070] Rtaq PCR mix: 10 μL
[0071] Primer F (10 μm): 0.3 μL
[0072] Primer F (10 μm): 0.4 μL
[0073] DdH2O: 8.4 μL
[0074] Reaction condition:
[0075]
[0076] The detection results are shown in Figure 1 (B). The DNA of Mpswd3 gene mutant (ΔMpswd3) strain as a template can not amplify the target band, indicating that the Mpswd3 gene is successfully knocked out. The DNA of Mpswd3 gene overexpression (Mpswd3-OE) strain as a template can amplify the target band, indicating that the Mpswd3 gene is restored.
[0077] 1.3.2 qRT-PCR verification of Mpswd3 gene expression amount
[0078] The real-time fluorescent quantitative PCR primers qMpswd3-F / R and the primers of the internal reference β-tubulin qβ-tubulin-F / R were designed in the CDS region of the Mpswd3 gene of Monascus ruber. The primers are as follows:
[0079] qMpswd3-F: CGCGGACGGAAACGTGAACATG (SEQ ID NO. 11)
[0080] qMpswd3-R: GGTGCATTCGACAATTCT (SEQ ID NO. 12)
[0081] qβ-tubulin-F: CTTGCTCCGCCATCTTCCGTG (SEQ ID NO. 13)
[0082] qβ-tubulin-R: AGCTCCTGGATAGAGGTGGAGTTGC (SEQ ID NO. 14)
[0083] The detection system is as follows:
[0084] cDNA: 2 μL
[0085] SYBR Premix 2×Taq: 10 μL
[0086] Primer F (10 μm): 0.4 μL
[0087] Primer R (10 μm): 0.4 μL
[0088] ddH2O: 7.2 μL
[0089] The detection results are shown inFigure 2 (A) shows that the expression of Mpswd3 gene in the ΔMpswd3 strain is significantly reduced, indicating that the Mpswd3 gene is successfully knocked out. As shown in Figure 2 (B) shows that the expression of Mpswd3 gene in the Mpswd3-OE strain is significantly increased, indicating that the Mpswd3 gene is successfully overexpressed.
[0090] Example 2 - Effect of Monascus Mpswd3 gene knockout on Monascus growth and development
[0091] WT, ΔMpswd3 and Mpswd3-OE strains were inoculated into PDA medium respectively, and cultured at 28°C for 7 days. The colony growth morphology was photographed and the growth diameter was counted. The results are shown in Figure 3 (A) shows that compared with the WT strain, the mycelial growth of the ΔMpswd3 strain is inhibited, and the mycelial growth of the Mpswd3-OE strain is restored. The growth diameter of the strains is counted as shown in Figure 3 (B) shows that the growth diameter of the ΔMpswd3 strain is significantly reduced.
[0092] Example 3 - Effect of Monascus Mpswd3 gene knockout on glutamate decarboxylase Mpgad1 expression
[0093] WT and ΔMpswd3 strains were inoculated into PDA respectively, and cultured at 28°C for 7 days. Then 5mm puncher was used to punch 5 fungus cakes respectively, and the tissues were inoculated into PDB medium after crushing. The mycelium was cultured at 28°C, 150rpm for 2 days, and the total RNA was collected for reverse transcription into cDNA for qRT-PCR.
[0094] Glutamate decarboxylase Gad1 is a key enzyme for the synthesis of γ-aminobutyric acid in eukaryotes, and positively regulates the synthesis of γ-aminobutyric acid. The qRT-PCR detection results are shown in Figure 4 As shown in (A), compared with the WT strain, the expression of Mpgad1 in the ΔMpswd3 strain is significantly reduced.
[0095] Example 4 - Effect of Monascus Mpswd3 gene knockout on γ-aminobutyric acid synthesis
[0096] WT, ΔMpswd3 and Mpswd3-OE strains were inoculated into PDA respectively, and cultured at 28°C for 7 days. Then 5mm puncher was used to punch 5 fungus cakes respectively, and the tissues were inoculated into PDB medium after crushing. The mycelium was cultured at 28°C, 150rpm for 2 days, and the content of ergosterol was detected by high performance liquid chromatography. The results are shown in Figure 5 (A) shows that compared with the WT strain, the synthesis of γ-aminobutyric acid in the ΔMpswd3 strain is significantly reduced by 66%. The results are shown in Figure 5(B) showed that the synthesis of γ-aminobutyric acid in Mpswd3-OE strain was significantly increased, increased by 45.4%.
[0097] SEQ ID NO. 1:
[0098] MDDFDHPPKRRRLDNGYTGSPAESSSDELAATSDHEEAERRRTSWTVKKAVYTPKRTYPHPRRFSESESSDELAVDADVYWGRKARQSSPQQNGRPSSRRRSLSRSSRRSESAEPYDRDNDYGAVEEENDEEKISPQEEPVDHSEPTPIPAETPVPPPPPPKPERLNYKRKFLLRGHLRGVSTVQFSRDGSMLASGGADGAVKVWDTLSGKLIHTFEGHLAGISTISWGPDNALIASGSDDKTIRLWNVLTGKAHPVPFVGHHNYVYQIAFSPKGNMLVSGSYDEAVFLWDVRSATVMRSLPAHSDPVAGVDVVFDGTLIVSCALDGLIRVWDTATGQCLRTLVHEDNPPVTAVKFSPNGKFVLAWTLDDCVRLWNYVEGRCIKTYQGHTNRKYSISGGFGVYSAPNGPPEAFAVSGSEDGSVLCWDVVSKKILQRIEAHTDVVLGVDTCSIGGKRLMASCSLDRTVRVWEEVSEDKEPEEAADDNHATTATAVVNGDHPVTPANPTSTDADGNVNMNGTTPNGELSNAPE
[0099] SEQ ID NO. 2:
[0100]
[0101] The foregoing detailed description has set forth various embodiments of the application via the use of specific terminology. As is understood by those skilled in the art, however, the application is not intended to be limited to the particulars described, and as such, modifications, improvements, and additions to the embodiments described herein are possible. Such modifications, improvements, and additions are intended to fall within the spirit and scope of the application, as defined by the appended claims.
[0102] Also, the use of "one embodiment," "an embodiment," or "some embodiments," "one implementation," "an implementation," or "some implementations," throughout the specification, does not necessarily refer to the same embodiment, implementation or particle. Additionally, features, structures or characteristics described in one or more embodiments can be combined in an appropriate manner in other embodiments.
[0103] Some embodiments use numerical terms to describe quantities of ingredients, properties, and the like. It is understood that such numerical terms are used in some examples to describe the embodiments and are not to be construed as limiting. Unless otherwise indicated, the numerical values are approximations. Accordingly, unless otherwise indicated, numerical parameters are approximations. Although the numerical ranges and parameters setting forth the broadest scope of the embodiments of the application are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values set forth in the specific examples are reported as precisely as practicable.
[0104] Finally, it should be understood that the embodiments described herein are merely exemplary of the application. Other variations of the embodiments described herein can also be possible. Accordingly, modifications, improvements and additions to the embodiments described herein are possible. Such modifications, improvements and additions are intended to fall within the spirit and scope of the application.
Claims
1. Use of Mpswd3 or a gene expression regulating substance thereof in regulating expression of aminobutyric acid in Monascus purpureus.
2. Use according to claim 1, wherein The aminobutyric acid is γ-aminobutyric acid. The amino acid sequence of the Mpswd3 is shown in SEQ ID NO.
1.
3. The use according to claim 1, wherein The gene expression regulating substance is a substance overexpressing the Mpswd3 gene.
4. The use according to claim 3, wherein the compound is ###0002### The substance overexpressing the Mpswd3 gene is a vector.
5. The use according to claim 4, wherein the compound is ###0002### The vector comprises an expression cassette comprising a nucleotide sequence of the Mpswd3 gene and a regulatory element regulating expression of the Mpswd3 gene.
6. A strain of Monascus purpureus producing aminobutyric acid, characterized in that, The vector comprises an expression cassette comprising a nucleotide sequence of the Mpswd3 gene and a regulatory element regulating expression of the Mpswd3 gene.
7. The GABA-producing Monascus purpureus as described in claim 6, characterized in that, The aminobutyric acid is γ-aminobutyric acid. The amino acid sequence of the Mpswd3 is shown in SEQ ID NO.
1.
9. The method of claim 8, wherein, 8. A method for increasing expression of aminobutyric acid in Monascus purpureus, comprising overexpressing the Mpswd3 gene in Monascus purpureus.
10. The method of claim 9, wherein, The overexpression of the Mpswd3 gene in Monascus purpureus comprises transforming a vector overexpressing the Mpswd3 gene into Monascus purpureus by Agrobacterium-mediated transformation. The aminobutyric acid is γ-aminobutyric acid. The amino acid sequence of the Mpswd3 is shown in SEQ ID NO.
1. The amino acid sequence of the Mpswd3 is shown in SEQ ID NO. 1.