Molecular marker identification and application of dwarf round-grain wheat allele

By using KASP technology to detect SNP sites in the wheat genome, we can identify and assist in the breeding of dwarf round-grain wheat, which solves the problems of easy lodging of stems and reduced genetic diversity in wheat breeding, and achieves early screening and improved breeding efficiency.

CN121109645APending Publication Date: 2025-12-12CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511504532.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-21
Publication Date
2025-12-12

AI Technical Summary

Technical Problem

Existing wheat breeding methods rely on a single dwarf gene resource, resulting in reduced stem strength, increased lodging susceptibility, and decreased genetic diversity in plant type and grain type, making it difficult to effectively increase yield.

Method used

KASP technology was used to detect specific SNP sites (T or C) in the wheat genome. PCR amplification and fluorescence detection were performed using primer combinations to identify the plant type and grain type characteristics of short-stemmed, round-grained wheat, and to assist in breeding selection of wheat with the TT genotype as parents.

Benefits of technology

This enabled early screening and identification of dwarf round-grain wheat, improving breeding efficiency and allowing for the selection of lodging-resistant and stable-yielding wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses molecular marker identification and application of dwarf round-grain wheat alleles. The invention belongs to the field of plant breeding, and particularly relates to molecular marker identification and application of dwarf round-grain wheat alleles. The method for identifying or assisting in identifying the wheat dwarf round grains comprises the steps that the genotype of an SNP site in a wheat genome to be detected is detected, the phenotype of the wheat dwarf round grains is identified or assisting in identifying according to the genotype, the SNP site is an SNP site on a wheat 3B chromosome, the nucleotide type of the SNP site is T or C, and the SNP site is the 185th nucleotide of a sequence 1 in a sequence table.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of plant breeding, specifically relating to the molecular marker identification and application of alleles in dwarf round-grain wheat. Background Technology

[0002] Discovering high-yield and high-efficiency wheat genetic resources is of great significance for further increasing wheat production and ensuring the sustainable development of agriculture in my country.

[0004] Because the dwarf gene resources used in global breeding are relatively limited and have been used in most parts of the world for decades, the genetic diversity of wheat plant architecture has also decreased. Rht-B1b and Rht-D1b Although the breeding methods used have lowered the center of gravity of wheat plants, thus mitigating the risk of lodging to some extent, Rht-B1b and Rht-D1b This also leads to thinner wheat stems, reduced stem strength, and increased tillering, making the wheat plant dense and unable to effectively prevent large-scale lodging under special climatic and cultivation conditions. Therefore, exploring new green, high-yielding, and stable-yielding wheat dwarf gene resources and creating new semi-dwarf wheat germplasm has become an important part of wheat breeding and genetic improvement work.

[0005] KASP (Kompetitive Allele Specific PCR) is a genotyping technique based on single nucleotide polymorphisms (SNPs). Due to its high efficiency, accuracy, and cost-effectiveness, it has become an important tool in the field of genotyping. In agriculture, KASP technology has been widely applied to fine mapping of crop trait genes, molecular-assisted breeding, and seed resource identification. Summary of the Invention

[0006] The problem to be solved by this invention is how to identify or assist in the breeding of wheat with short stalks and round grains.

[0007] To address the above technical problems, this invention first provides the application of a substance for detecting KASP polymorphisms or genotypes in the wheat genome in any of the following situations: (1) To identify or assist in the identification of plant type and grain type characteristics of short-stemmed, round-grained wheat; (2) Wheat breeding; (3) Prepare products for identification or to assist in the identification of plant type and grain type characteristics of short-stemmed, round-grained wheat; (4) Prepare products for wheat breeding; The SNP site is a site on wheat chromosome 3B, and its nucleotide type is T or C, which is the 185th nucleotide of sequence 1 in the sequence listing.

[0008] 5'-ggagattatcaaggtactgcctgatgcTTCACATGCAACATTGTCTTTCTTGAGTTCTTCTGCTATGGGTGTTTTTTAAAGCCATGTGATATAATTGCAGGTTCTTGGTACTCCAACCCG TGAGGAAATTCGGTGCATGAACCCCAACTATACTGAGTTCAGGTTTCCTCAGATTAAGGCTCATCyttggcacaaggtagacatacgttaagAGCATGAACTTGGTCACCTTC-3' (sequence 1).

[0009] The SNP site is a SNP site on wheat chromosome 3B (physical location: 146886622, IWGSCv1.0), and its nucleotide type is T or C, which is the 185th nucleotide of sequence 1 in the sequence listing.

[0010] Using the genome sequence of the wheat variety Chinese Spring as the reference genome (IWGSCv1.0), the SNP site is located at 146886622 bp on the wheat chromosome 3B (specifically, position 185 of sequence 1 in the sequence listing, where y represents C or T).

[0011] This invention also provides a method for identifying or assisting in the identification of plant type and grain type characteristics of dwarf, round-grained wheat, including detecting the genotype of the SNP locus in the genome of the wheat to be tested, and identifying or assisting in the identification of plant type and grain type characteristics of dwarf, round-grained wheat based on the genotype, wherein the genotype is TT or CC (based on the ploidy of plant genome chromosomes, wheat is an allohexaploid, 2n=6x=42), wherein TT is the homozygous type of the SNP locus T, and CC is the homozygous type of the SNP locus C.

[0012] As one implementation scheme, the method for identifying or assisting in the identification of plant type and grain type characteristics of short-stemmed, round-grained wheat may include the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, KASP was performed using a primer composition; the primer composition consisted of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing (containing the complementary sequence of the FAM probe) or a single-stranded DNA molecule whose nucleotide sequence is positions 22-48 of sequence 2 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing (containing the complementary sequence of the HEX probe) or a single-stranded DNA molecule whose nucleotide sequence is positions 22-48 of sequence 3 in the sequence listing. Primer C is a single-stranded DNA molecule whose nucleotide sequence is sequence 4 in the sequence listing; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP in the wheat to be tested; (3) Identify the plant height and grain type of the wheat to be tested based on the genotype results: the wheat to be tested with the genotype TT at the SNP site is a short-stemmed round-grained wheat, the wheat to be tested with the genotype CC at the SNP site is a tall-stemmed long-grained wheat, and the wheat to be tested with the genotype CT at the SNP site is an intermediate type of wheat.

[0013] The application of the above methods in wheat breeding also falls within the scope of protection of this invention.

[0014] This invention also provides a method for using the KASP molecular marker to assist in the breeding of short-stemmed, round-grained wheat.

[0015] The present invention also provides a method for assisting the breeding of short-stemmed, round-grained wheat using the KASP molecular marker, comprising detecting the genotype of the SNP locus in the wheat genome, selecting wheat with the genotype TT at the SNP locus as the parent for breeding, wherein TT is the homozygous type of the SNP locus T.

[0016] As an implementation method, wheat breeding methods may include the following steps: (1) Using the genomic DNA of the wheat to be tested as a template, KASP was performed using the above primer set; (2) After completing step (1), perform fluorescence detection to determine the genotype of the SNP site in the wheat to be tested; (3) Select TT genotype wheat for breeding of short-stemmed, round-grained wheat with superior characteristics.

[0017] In the above method, the primer dissolution and preparation method can be as follows: First, dilute the three primers to 100 mM with ddH2O, and then prepare the primer working solution as follows: 12 μL of primer A, 12 μL of primer B, 30 μL of primer C, and 46 μL of ddH2O. This solution is used as the KASP-labeled primer working solution and stored at -20 ℃ for later use.

[0018] In the above method, the KASP reaction system can be: 1.0 μL template DNA (concentration of 100 ng / μL), 4.0 μL 2× KASP reaction mixture, 1.5 μL primer mixture, and 1.5 μL double-distilled water.

[0019] In the above method, KASP can be performed on a Long Gene-A300 PCR amplification instrument.

[0020] In the above method, the KASP reaction procedure can be as follows: First, pre-denaturation is performed at 95°C for 10 minutes; then, a touch-down procedure is performed, including denaturation at 95°C for 20 seconds, followed by annealing and extension at 61°C for 40 seconds, repeated 10 times, with the annealing temperature decreasing by 0.6°C in each cycle; finally, an amplification procedure is performed, including denaturation at 95°C for 20 seconds, followed by annealing at 55°C for 40 seconds, for a total of 33 cycles. PCR products need to be stored at 4°C protected from light, and fluorescence signals should be read within one week.

[0021] The method described above for determining the genotype of the SNP in the wheat sample can be as follows: using a real-time quantitative instrument, such as the Bio-Rad C1000 Touch Thermal Cycler, running the signal reading program at 37°C for 60 seconds, and performing genotyping based on the fluorescence signal. Then, using fluorescence typing software, such as the Bio-Rad CFX Maestro software, to view the genotyped data, the SNP genotype CC type exhibits FAM fluorescence, distributed near the x-axis; the SNP genotype TT type exhibits HEX fluorescence, distributed near the y-axis; and samples with no detected signal are distributed near the origin.

[0022] This invention also provides products for detecting polymorphisms or genotypes of SNP sites in the wheat genome.

[0023] The product provided by this invention for detecting polymorphisms or genotypes of SNP sites in the wheat genome contains any of the aforementioned substances for detecting polymorphisms or genotypes of SNP sites in the wheat genome. C1) Products that detect single nucleotide polymorphisms or genotypes related to wheat plant type and grain type; C2) Products used for identification or auxiliary identification of wheat plant type and grain type; C3) Products used in wheat breeding.

[0024] In the above applications, methods, and products, the substance may be a reagent and / or instrument required to determine the polymorphism or genotype of the SNP site by at least one of the following methods: DNA sequencing, restriction fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and SNP chips. The SNP chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0025] Optionally, the substance is D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

[0026] Optionally, the amplification may be PCR amplification. The primer composition consists of primer A, primer B, and primer C.

[0027] The kit described in D3 may also include KASP Master Mix.

[0028] In the above applications, methods, and products, the primer composition may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive markers, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moiety (positive or negative charge) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling (e.g., direct sequence reading).

[0029] The primer composition described herein may be a primer composition consisting of single-stranded DNA with nucleotide sequences of positions 1-48 of sequence 2 in the sequence listing, single-stranded DNA with nucleotide sequences of positions 1-48 of sequence 3 in the sequence listing, and single-stranded DNA with nucleotide sequences of sequence 4 in the sequence listing. Alternatively, the primer composition may be a primer set consisting of single-stranded DNA shown in sequence 2, sequence 3, and sequence 4 in the sequence listing. Sequence 2 in the sequence listing consists of 48 nucleotides, with nucleotides 1-21 being the FAM sequence (as a marker) and nucleotides 22-48 being the specific sequence; Sequence 3 in the sequence listing consists of 48 nucleotides, with nucleotides 1-21 being the HEX sequence (as a marker) and nucleotides 22-48 being the specific sequence.

[0030] The present invention also provides a DNA molecule, the nucleotide sequence of which is shown in Sequence 1 of the sequence listing.

[0031] The applications of the aforementioned DNA molecules also fall within the scope of protection of this invention. Specifically, the applications are those found in any of the following: (1) To identify or assist in the identification of short-stemmed, round-grained wheat; (2) Wheat breeding; (3) To prepare products for identification or to assist in the identification of short-stemmed, round-grained wheat; (4) Prepare wheat breeding products.

[0032] Optionally, in the above applications, the DNA molecule serves as a detection target.

[0033] The substance that detects the SNP site polymorphism and genotype can be combined with other substances (such as substances that detect single nucleotide polymorphisms or genotypes of other molecular markers related to wheat plant height / grain type) to prepare a product for identifying wheat varieties with wheat plant height / grain type.

[0034] In this document, the purpose of the breeding may include developing wheat with short stalks and round grains. The wheat may be a pure line or an inbred line.

[0035] In this article, the particle shape can be particle length or particle width.

[0036] This invention provides a primer composition and a method for identifying or assisting in the identification of wheat plant height and grain type using the primer composition. The method established by this invention can be used to predict wheat plant height and grain type, to perform early screening of wheat, and to assist in wheat molecular marker-assisted breeding. It has important application value in the research of discovering short-stalked, round-grained wheat germplasm resources and breeding lodging-resistant and stable-yielding wheat varieties. Attached Figure Description

[0037] Figure 1 The greenhouse phenotypic changes (plant height, grain size) of wild-type wheat 'Liangxing 99' LX99 and its mutant wheat L1544 are shown. A shows the difference in plant height between the two; B shows the difference in grain length-to-width ratio.

[0038] Figure 2 On wheat chromosome 3B TaGSK3 A diagram showing the location of the nucleic acid sequence of the gene and the sequence variation sites (i.e., sequence differences) in this invention. Figure 2 In the middle, the mutation site is located TaGSK3 The 914th position of the gene. (Shown above) TaGSK3-B1a C -WT The variant site sequence of the genotype (also known as the CC genotype) is CC, and below it is... TaGSK3-B1bT-MUT The variant site sequence for the genotype (also known as the T genotype) is TT.

[0039] Figure 3 For the F2 segregating population TaGSK3 Results of KASP marker detection for genes.

[0040] Figure 4 The results are statistical analysis of plant height and grain length-to-width ratio for different genotypes (CC, TT, CT) in the F2 segregating population. Detailed Implementation

[0041] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0042] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0043] Unless otherwise specified, the quantitative experiments in the following examples are all repeated three times, and the results are averaged.

[0044] The "L1544 (EMS mutagenic material, background material is Liangxing 99)" and "Jing 411 (J411)" mentioned in the following examples have been described at the National Center for Biotechnology Information (https: / / ngdc.cncb.ac.cn / gsa / browse / CRA030285). This biological material is available to the public from the applicant and is intended solely for the purpose of replicating experiments of this invention; it may not be used for any other purpose.

[0045] The following examples use GraphPad statistical software to process the data. The experimental results are expressed as mean ± standard deviation. One-way ANOVA test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.0001 (****) indicates a highly significant difference.

[0046] Example 1: Development of wheat dwarf gene TaGSK3 Functional KASP molecular markers and their primers Successful cloning via map-based cloning TaGSK3-3B Genes, through gene sequence analysis, were found to be... TaGSK3There are sequence differences between wild-type and mutant materials, therefore the wild-type is named TaGSK3-B1a The mutation type is named TaGSK3-B1b . TaGSK3 The gene is located on the short arm of wheat chromosome 3B, specifically at physical position 146884350-146887848 bp on the wheat Chinese Spring chromosome 3B. This gene is associated with wheat plant height and grain type (wheat LX99 has a tall, long-grain phenotype, while wheat L1544 has a short, round-grain phenotype; see details). Figure 1 (A and B in the middle). TaGSK3 Encoding a serine / threonine protein kinase glycogen synthase kinase 3 (STKc_GSK3) containing a TREE domain, it is a rice... OsGSK2 The homologous gene plays a negative regulatory role in the BR signaling pathway.

[0047] Specifically TaGSK3 A SNP difference of "C" to "T" occurred at base 914 of gene SEQ ID No:5, which resulted in the substitution of amino acid P305L at the 20th amino acid following the TREE domain. Figure 2 This molecular marker was named KASP- Figure 2 Molecular marker KASP- TaGSK3 Located at position 185 of the nucleotide sequence SEQ ID No:1. In SEQ ID No:1, y represents C or T. Molecular marker KASP- TaGSK3 Wheat genotypes with all C nucleotides are classified as CC genotypes, with the molecular marker KASP- TaGSK3 The wheat genotype with all nucleotides being T is the TT genotype.

[0048] Figure 2 The image shows the location of chromosome 3B in wheat. TaGSK3 The nucleic acid sequence of the gene, and the location of the sequence variation site (i.e., sequence difference) in this invention. This variation site is located at... TaGSK3 At position 914 of the DNA in the gene, a substitution occurred from C (wild-type) to T (mutant). The molecular marker KASP- in wheat LX99... TaGSK3 The genotype is CC, and the molecular marker KASP- of wheat L1544 is... TaGSK3 The genotype is TT.

[0049] Example 2: Verification of wheat dwarf gene TaGSK3 Functional molecular marker KASP- TaGSK3 Application in segregating populations Based on wheat dwarf gene TaGSK3 Functional variant sites, developing identifiable molecular markers KASP- GSK3 Genotype-specific primers are used for phenotypic or auxiliary identification of wheat plant height and grain type.

[0050] The functional molecular marker KASP- was validated using the F2 segregating population derived from the hybridization of "L1544 (EMS mutagenesis material, background material is Liangxing 99)" and "Jing 411 (J411)". GSK3 The linkage with dwarf genes was determined for use in genotyping of wheat materials. The specific genotyping steps are as follows: Step 1: Extract total DNA from seedling leaves (1) Take a fresh leaf with a length of 1 cm, put it into a 1.2 ml centrifuge tube, add two steel balls with a diameter of 4 mm, then quickly immerse it in liquid nitrogen for rapid freezing and thoroughly grind it to ensure the release of DNA.

[0051] (2) Add 300 μL of CTAB (hexadecyltrimethylammonium bromide) to the centrifuge tube and mix it in a constant temperature water bath at 65°C for 30 minutes, gently mixing once every 10 minutes.

[0052] (3) Add 300 μL of a mixture of chloroform and isoamyl alcohol (volume ratio 24:1), gently invert to mix, centrifuge at 10,000 rpm for 10 minutes at room temperature, then aspirate 100 μL of the supernatant and transfer it to a new PCR plate.

[0053] (4) Add 100 μL of isopropanol and freeze it at -20°C for 30 minutes to precipitate DNA. Centrifuge at 10,000 rpm for 5 minutes at 4°C to precipitate DNA. Discard the supernatant and wash the precipitate twice with 75% ethanol solution. Finally, place the precipitate in a fume hood to dry.

[0054] (5) Add 100 μL of double-distilled water to dissolve the DNA, use a UV spectrophotometer to determine the concentration of the DNA, and store it in a refrigerator at -20°C for later use.

[0055] The preparation method of CTAB is as follows: 16.7 g CTAB, 639.1 mL water, 83.5 mL 1 M Tris-HCl (pH=8.0), 234 mL 5 M NaCl, 33.4 mL 0.5 M EDTA (pH=8.0).

[0056] Step 2: Primer synthesis and PCR amplification KASP primers (including primer Nor-GSK3-3B-F, primer Fam-GSK3-B1a-R and primer Hex-GSK3-B1b-R) were synthesized by Shanghai Sangon Biotech Co., Ltd.

[0057] Primer Fam-GSK3-B1a-R (primer A for short): 5'- GAAGGTGACCAAGTTCATGCT cttaacgtatgtctaccttgtgccaag-3' (SEQ ID No: 2); Primer Hex-GSK3-B1b-R (primer B for short): 5'- GAAGGTCGGAGTCAACGGATT cttaacgtatgtctaccttgtgccaaa-3' (SEQ ID No: 3); Primer Nor-GSK3-F (primer C for short): 5'-ggagattatcaaggtactgcctgatgc-3' (SEQ ID No: 4).

[0058] Using DNA from the two parents, L1544 and J411, and DNA from the derived F2 segregating population as templates, and ddH2O as a control, PCR amplification was performed using the primer set described above.

[0059] The PCR reaction system (8 μL system) is as follows: 1.0 μL template DNA (concentration of 100 ng / μL), 4.0 μL 2× KASP reaction mixture, 1.5 μL primer mixture, and 1.5 μL double-distilled water.

[0060] The primer mixture (primer composition) includes primers Fam-GSK3-B1a-R and Hex-GSK3-B1b-R, both with a final concentration of 3 μM in the PCR amplification system, while primer Nor-GSK-3B-F has a final concentration of 7.5 μM in the PCR amplification system.

[0061] PCR reaction procedure: First, pre-denaturation was performed at 95°C for 10 minutes; then, a touch-down procedure was performed, consisting of denaturation at 95°C for 20 seconds, followed by annealing and extension at 61°C for 40 seconds, repeated 10 times, with the annealing temperature decreasing by 0.6°C in each cycle; finally, an amplification procedure was performed, consisting of denaturation at 95°C for 20 seconds, followed by annealing at 55°C for 40 seconds, for a total of 33 cycles.

[0062] PCR products need to be stored at 4°C in the dark, and signal reading should be completed within one week.

[0063] Step 3: Determining the Genotyping Results After PCR amplification, real-time quantitative instruments, such as the Bio-Rad C1000 Touch ThermalCycler, can be used to perform genotyping based on fluorescence signals. Then, fluorescence genotyping software, such as Bio-Rad CFXMaestro, is used to view the genotyping data. See Table 1 for detailed genotyping results. Figure 3 .

[0064] Genotyping is determined as follows: 1) If the result shows orange, then the wheat being tested... TaGSK3 The 914th base of the gene is all T. This type of wheat is called... TaGSK3-B1a C-WT Genotype, abbreviated as CC genotype.

[0065] 2) If only orange is displayed, then the wheat being tested... TaGSK3 The 914th base of the gene is all C. This wheat genotype is called... TaGSK3-B1b T-MUT Genotype, abbreviated as TT genotype.

[0066] 3) If only green is displayed, then the wheat being tested... TaGSK3 The 914th base of the gene is a heterozygous C and T. This wheat genotype is called... TaGSK3-B1a C-WT / TaGSK3-B1b T-MUT Genotype, abbreviated as CT genotype.

[0067] Based on the fluorescence signal of the PCR product, the wheat to be identified can be determined. TaGSK3 The type of nucleotide at position 914 of the gene is used to identify wheat plant height and grain type.

[0068] Table 1. Genotypes, plant height, and grain type phenotypes of individual plants from the F2 segregating populations of L1544 and J411.

[0069] Table 2. Statistical results of genotypes and plant height phenotypes of individual plants from the F2 segregating populations of L1544 and J411.

[0070] Table 3. Statistical results of genotypes and seed length-to-width ratios of individual plants from the F2 segregating populations of L1544 and J411.

[0071] KASP marker detection revealed that among the 200 F2 segregating populations of L1544 and J411, 48 were wheat segregating populations. TaGSK3-B1a C-WT Allele type (tall type, average plant height 73.10cm), i.e., SNP locus KASP- GSK3- B1a The genotype is CC; the 28 wheat segregating populations are GSK3-B1b T-MUT Allele type (dwarf type), i.e., SNP locus KASP- GSK3-B1a The genotype is TT, and the average plant height is 42.54 cm. (Carrier) GSK3-B1a C-WT Wheat plants with the CC allele type were all taller than those carrying the CC allele. GSK3-B1b T-MUT Wheat with the TT allele type showed a highly significant difference between the two ( P <0.0001) level (Table 2 and Figure 4 ).

[0072] KASP marker detection revealed that among the 200 F2 segregating populations of L1544 and J411, 48 were wheat segregating populations. TaGSK3-B1a C-WT Allele type (i.e., SNP site KASP-) TaGSK3 The average length-to-width ratio of seeds with genotype CC was 1.91; the segregating population of 28 wheat accessions was... TaGSK3-B1b T-MUT Allele type (i.e., SNP site KASP-) TaGSK3 The genotype is TT, and the average length-to-width ratio of the seeds is 1.40. (Carrier) GSK3-B1a C-WT Wheat with the CC allele type has a longer grain size than wheat with the CC allele type. GSK3-B1b T-MUT Wheat with the TT allele type showed a highly significant difference between the two ( P <0.0001) level (Table 3 and Figure 4 ).

[0073] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A method for identifying or assisting in the identification of short-stemmed, round-grained wheat, characterized in that: This includes detecting the genotype of SNP sites in the genome of the wheat to be tested, and identifying or assisting in the identification of short-stemmed, round-grained wheat based on the genotype. The SNP site is a SNP site on the wheat chromosome 3B, and its nucleotide type is T or C, which is the 185th nucleotide of sequence 1 in the sequence listing.

2. A method for wheat breeding, characterized by: The method includes detecting the genotype of the SNP locus in claim 1 in the wheat genome, selecting wheat with the genotype TT at the SNP locus as a parent for breeding, wherein TT is the homozygous type of the SNP locus T.

3. The application of the method according to claim 1 or 2 in wheat breeding.

4. The application of substances for detecting SNP polymorphisms or genotypes in the wheat genome in any of the following: (1) To identify or assist in the identification of short-stemmed, round-grained wheat; (2) Wheat breeding; (3) To prepare products for identification or to assist in the identification of short-stemmed, round-grained wheat; (4) Prepare products for wheat breeding; The SNP site is a SNP site on wheat chromosome 3B, and its nucleotide type is T or C, which is the 185th nucleotide of sequence 1 in the sequence listing.

5. The method according to claim 1 or 2, or the application according to claim 4, characterized in that: The genotype of the SNP locus is TT or CC, where CC is the homozygous type of the SNP locus C and TT is the homozygous type of the SNP locus T; the wheat to be tested with the genotype TT at the SNP locus is dwarf round-grain wheat, and the wheat to be tested with the genotype CC at the SNP locus is tall long-grain wheat.

6. The product, characterized in that: The product contains the substance described in claim 4, and the product is any one of the following: C1) Products that detect single nucleotide polymorphisms or genotypes associated with short-stemmed, round-grained wheat; C2) Products for identification or auxiliary identification of short-stemmed, round-grained wheat; C3) Products used in wheat breeding.

7. The application according to claim 4 or the product according to claim 6, characterized in that: The substance is either D1), D2), or D3). D1) The substance is a primer composition for amplifying wheat genomic DNA fragments including the SNP sites; D2) The substance is a PCR reagent containing the primer composition described in D1); D3) The substance is a kit containing the primer composition described in D1) or the PCR reagent described in D2).

8. The application or product according to claim 7, characterized in that: The primer composition consists of primer A, primer B and primer C; Primer A is a single-stranded DNA molecule whose nucleotide sequence is sequence 2 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-48 of sequence 2 in the sequence listing; Primer B is a single-stranded DNA molecule whose nucleotide sequence is sequence 3 in the sequence listing or whose nucleotide sequence is single-stranded DNA at positions 22-48 of sequence 3 in the sequence listing. The primer C nucleotide sequence is the single-stranded DNA molecule of sequence 4 in the sequence listing.

9. A DNA molecule, characterized by: The nucleotide sequence of the DNA molecule is sequence 1 in the sequence listing.

10. The use of the DNA molecule of claim 9 in any of the following: (1) To identify or assist in the identification of short-stemmed, round-grained wheat; (2) Wheat breeding; (3) To prepare products for identification or to assist in the identification of short-stemmed, round-grained wheat; (4) Prepare wheat breeding products.