Plant universal usgRNA and related applications thereof

By designing universal sgRNAs to target the CLA and SP genes in Malvaceae plants, the cumbersome problem of cross-species sgRNA design has been solved, research efficiency has been improved and costs have been reduced, and the large-scale application of gene editing technology in plants and the development of plant resources have been promoted.

CN121136987BActive Publication Date: 2026-03-03SANYA NATIONAL INSTITUTE OF SOUTHERN BREEDING CHINESE ACADEMY OF AGRICULTURAL SCIENCES +1
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202511692852.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-18
Publication Date
2026-03-03
Estimated Expiration
2045-11-18

AI Technical Summary

Technical Problem

Currently, the widespread application of gene editing technology in plants requires the frequent design and construction of sgRNAs for different species, which increases time and cost and causes off-target problems, hindering the large-scale application of gene editing technology in plants and the development and utilization of plant resources.

Method used

A universal sgRNA (usgRNA) was designed, which utilizes the conserved amino acid coding sequences of the CLA and SP genes of Malvaceae plants to target and cleave the CLA and SP genes of the same family of plants. The number of mismatched bases is ≤2, which simplifies the design process of sgRNA.

Benefits of technology

It has enabled efficient cross-species research, reduced research costs and time, and promoted the large-scale application of gene editing technology in the plant kingdom and the development and utilization of plant resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121136987B_ABST
    Figure CN121136987B_ABST
Patent Text Reader

Abstract

This application belongs to the field of bioengineering technology, specifically relating to plant-specific sgRNAs (usgRNAs) and their related applications. This invention utilizes the sequence similarity between plant homologous genes and the mismatch tolerance of Cas9 to design usgRNAs targeting conserved amino acid regions in genes of the same family of plants. Plants of the same family can share the same usgRNA, thus avoiding the drawback of frequently designing and constructing different sgRNA target vectors for different plants, and greatly improving the efficiency of high-throughput gene editing system development in plants of the same family.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of bioengineering technology, specifically relating to plant-specific usgRNAs and their related applications. Background Technology

[0002] It is estimated that there are over 450,000 species of terrestrial plants on Earth, exhibiting rich trait and genetic diversity. However, current human understanding of the genetic mechanisms related to plant traits mainly stems from a limited number of model plants, which severely hinders the development, utilization, and genetic improvement of plant resources. Gene editing technology is a key technological means to achieve mutant creation and germplasm innovation, but it has only been successfully tested in a small number of plants. Among them, CRISPR / Cas9, as the most widely used gene editing tool, is typically used to establish gene editing technology systems in new species. CRISPR / Cas9 technology consists of two components: sgRNA and Cas9 protein. The complex formed by these two components pairs complementaryly with the target gene sequence via a 20-base spacer sequence on the sgRNA, and Cas9 cuts the DNA double strand. Subsequently, the organism utilizes endogenous repair pathways to introduce the mutation into the target region. When establishing CRISPR / Cas9 gene editing research systems de novo in organisms from different genera, it is usually necessary to first design species-specific sgRNA vectors based on reference genomes, then construct them into gene-editing plasmids and deliver them to plants via Agrobacterium or protoplasts for testing. However, most plants currently lack high-quality reference genomes and gene annotation information, and the time and cost of designing and constructing sgRNAs increase significantly with the increase in the number of species to be tested. Therefore, this seriously hinders the large-scale application of gene editing technology in plants.

[0003] Numerous studies have shown that Cas9 can tolerate a certain degree of base mismatches, leading to concerning off-target effects. However, this tolerance to mismatches also enables Cas9 to simultaneously edit multiple similar sequences. This potential application has not received widespread attention. Throughout evolution, protein-coding genes within the same family of organisms typically exhibit high nucleotide sequence similarity and functional similarity compared to organisms from different families.

[0004] Studies have shown that lethal genes are typically single-copy and have low nucleotide sequence diversity. Therefore, leveraging the mismatch tolerance of Cas9 and the high sequence similarity among plants in the same family holds promise for finding a universal sgRNA for establishing gene editing systems within the same plant family. The Cloroplastos alterados (CLA) gene encodes a 1-deoxy-D-xylulose-5-phosphate synthase (DXS). Mutations in the CLA gene lead to inhibited chlorophyll and carotenoid synthesis, resulting in a whitening phenotype visible to the naked eye. Therefore, CLA is often used as a reporter gene for gene editing events. Searching for a universal sgRNA targeting the CLA gene in Malvaceae plants will significantly reduce the R&D costs of establishing multi-species gene editing research systems and efficiently promote the industrial upgrading of breeding and improvement of related plants.

[0005] The SP gene is a key gene regulating plant architecture in cotton. Mutations in this gene shorten the cotton's growth period and significantly reduce its plant height, thus enabling propagation under laboratory conditions. Searching for a universal sgRNA targeting the SP gene in Malvaceae plants holds promise for creating numerous dwarfing Malvaceae species for research and production applications under laboratory conditions.

[0006] When establishing gene-editing research systems de novo in species from different genera, it is usually necessary to first design and construct target-specific sgRNA vectors based on reference genomes. As the number of species to be tested increases, the time and cost of this work increase significantly. Summary of the Invention

[0007] To address the aforementioned technical problems, this invention proposes a universal sgRNA (usgRNA) design principle and identifies three universal sgRNAs (usgRNAs) for Malvaceae plants. It demonstrates that two of these usgRNAs can target and cleave the CLA gene in all Malvaceae plants, and another can target and cleave the SP gene in all Malvaceae plants. Furthermore, this invention proposes using the conserved amino acid coding sequence of the CLA gene (SEQ ID NO.1: YPHKILTGRR) to rapidly design usgRNAs for widespread application in other plant families. This invention can not only be used for the establishment and breeding improvement of gene editing systems in Malvaceae plants, but also provides a universal strategy for the establishment and breeding improvement of gene editing systems in other families. Taking Malvaceae usgRNAs as an example, this invention experimentally verifies that usgRNAs can target and cleave the CLA and SP gene variant sequences in all Malvaceae plants, which is beneficial for the large-scale application of gene editing technology in the plant kingdom and the large-scale development and utilization of plant resources.

[0008] To achieve the above objectives, this invention first provides a method for finding usgRNAs, namely, firstly, comparing the nucleotide sequences of homologous genes in plants of the same family, finding conserved sites in the protein-coding region, and then designing usgRNAs based on the genus principle (e.g., Figure 1 (As shown). When usgRNA targets different homologous gene sequences in the same family of plants, the number of mismatched bases is ≤2.

[0009] To verify this idea, this invention designed three usgRNAs that are common to Malvaceae plants.

[0010] When the usgRNA targets a conserved region of the CLA gene protein coding region, the amino acid coding sequence corresponding to the selected conserved region is shown in SEQ ID NO.1: YPHKILTGRR;

[0011] The spacer sequence of the usgRNA is shown in SEQ ID NO.2 and SEQ ID NO.3;

[0012] SEQ ID NO.2:TCCCAGTCAAGATTTTGTGA;

[0013] SEQ ID NO. 3:ACCTCACAAAATCTTGACT.

[0014] In this invention, when the usgRNA targets the CLA gene of a plant of the same family, the nucleotide sequence corresponding to the amino acid coding sequence can be extracted from any sequenced genome of the plant of that family. That is, the 2nd to 21st nucleotides can be designed as the spacer sequence of the coding strand usgRNA, and the 6th to 25th nucleotides can be designed as the spacer sequence of the non-coding strand usgRNA.

[0015] When the usgRNA targets a conserved region of the SP gene protein coding region, the spacer sequence of the usgRNA is as shown in SEQ ID NO.4;

[0016] SEQ ID NO. 4: TATGAGATCCTTTTTCACCC.

[0017] In this invention, when the usgRNA targets the conserved regions of homologous gene protein coding regions of different plants in the Malvaceae family, the number of mismatched bases is ≤2.

[0018] This invention also provides the application of the usgRNA described in any of the above claims in establishing a gene editing research system.

[0019] This invention also provides the application of the usgRNA described in any of the above claims in the rapid improvement of traits in species of the same family.

[0020] In practical applications of this invention, core genes related to important agronomic traits can be targeted.

[0021] This invention also provides the application of the usgRNA described in any of the above claims in the development and utilization of plant resources using gene editing technology.

[0022] The beneficial effects of this invention are reflected in:

[0023] The use of usgRNA avoids the tedious process of frequently designing usgRNA and constructing recombinant plasmids for different species, improves the efficiency of cross-species research, and greatly reduces research costs and experimental cycles. This is conducive to the large-scale promotion and application of gene editing technology in the plant kingdom, as well as the large-scale development and utilization of plant resources. Attached Figure Description

[0024] Figure 1 Principles for designing usgRNA;

[0025] Figure 2 Nucleotide sequence alignment of the CLA gene in Malvaceae plants and location of usgRNA;

[0026] Figure 3 A schematic diagram of the SSAr reporter system plasmid pSSAr-EGFP-GhCLA_D;

[0027] Figure 4 To evaluate the cleavage ability of usgRNA / Cas9 on the cotton CLA gene sequence and four other Malvaceae gene CLA sequence variants using the SSAr-EGFP reporter system;

[0028] Figure 5 To detect cotton CLA gene editing events mediated by usgRNA / Cas9 using Hi-Tom sequencing.

[0029] Figure 6 The usgRNA corresponding to the conserved amino acid sequence YPHKILTGRR of the CLA gene in representative terrestrial plants.

[0030] Figure 7 usgRNAs that can be designed for the corresponding positions of the conserved amino acid sequence YPHKILTGRR of the CLA gene in the Poaceae, Cucurbitaceae, and Solanaceae families;

[0031] Figure 8 Nucleotide sequence alignment of SP gene in Malvaceae plants and location of usgRNA;

[0032] Figure 9To evaluate the cleavage ability of usgRNA / Cas9 on the cotton SP gene sequence and five other Malvaceae SP gene sequence variants using the SSAr-EGFP reporter system. Detailed Implementation

[0033] The present application will be further explained below with reference to the embodiments. Before introducing the specific embodiments, the experimental background of some embodiments is briefly described below.

[0034] Biomaterials:

[0035] Vector pUC-2×35S-EGFP (from CN202311522978.X);

[0036] Escherichia coli strain DH5α Chemically Competent Cell, purchased from Shanghai Weidi Biotechnology Co., Ltd.

[0037] The relevant sequence synthesis and sequencing work was provided and completed by Genscript Biotech Inc. and Qingke Biotech Inc.

[0038] Main reagents:

[0039] PCR products and vectors were recovered using an enhanced agarose gel DNA recovery kit and an ultrathin DNA product purification kit, purchased from Beijing Tiangen Biotech Co., Ltd.

[0040] The recombinant reaction kit, ClonExpress® II One Step Cloning Kit, was purchased from Nanjing Novizan Pharmaceutical Co., Ltd.

[0041] All restriction endonucleases were products of New England Biolabs (NEB).

[0042] Plasmid extraction was performed using an endotoxin-free plasmid large-scale extraction kit, purchased from Beijing Tiangen Biotech Co., Ltd.

[0043] Example 1

[0044] We designed usgRNAs targeting the CLA gene in the Malvaceae family and tested the usgRNA / Cas9-mediated target sequence cleavage capability.

[0045] In protoplasts, the ability of usgRNA to target and cleave all variant sequences of the Malvaceae CLA gene was verified using the SSAR-EGFP reporter system, and editing events were detected with the aid of Hi-TOM sequencing.

[0046] The specific implementation process is briefly described below:

[0047] (a) Designing usgRNAs targeting the CLA gene in Malvaceae plants

[0048] CLA gene sequences from sequenced Malvaceae plants were obtained from public databases. Multiple sequence alignment was performed using Jalview software. Conserved regions of the CLA gene were identified, and two usgRNAs were designed, named MCLA usgRNA-T1 and MCLA usgRNA-T2, respectively. These two usgRNAs exhibited only 0-1 base mismatches when targeting the CLA gene sequences of all sequenced Malvaceae plants. Figure 2 The five CLA sequences from four species—cotton (GhCLA_D), okra (AeCLA_1, AeCLA_2), baobab (AdCLA_D), and durian (DzCLA2)—represent all sequence variation types when MCLA usgRNA-T1 and MCLA usgRNA-T2 target CLA genes in Malvaceae plants. Therefore, these five CLA sequence variation types can be used to assess whether usgRNA can target and cleave CLA homologous gene sequences in all Malvaceae plants.

[0049] (II) Synthesis of gene editing plasmids

[0050] The spacer sequences of two usgRNAs were synthesized into a gene editing plasmid with GhU6.9 as the promoter by gene synthesis.

[0051] The spacer sequences of the two usgRNAs are as follows:

[0052] MCLA usgRNA-T1:TCCCAGTCAAGATTTTGTGA, SEQ ID NO. 2.

[0053] MCLA usgRNA-T2:ACCTCACAAAATCTTGACT, SEQ ID NO.3.

[0054] (III) Construction of SSAr-EGFP reporter plasmid

[0055] Single-strand annealing (SSA)-based fluorescent reporter (SSAr) is widely used to detect Cas9 / usgRNA complex cleavage activity. Its main principle is as follows: When a DNA double-strand break occurs between two homologous sequences, the organism initiates SSA repair, annealing the repetitive sequences in the homologous sequences to complete the repair. If the target site is placed between EGFP homologous sequences, cleavage of the target site will repair the EGFP gene sequence and activate fluorescent protein expression. Figure 3 ).

[0056] Using pUC-2×35S-EGFP plasmid as a DNA template, SSAr-EGFP-N and SSAr-EGFP-C were amplified. The CLA target region gene sequence of cotton, “TCTTACCCTCACAAAATCTTGACTGGGAGAAGACATAAG, SEQ ID NO.5”, was introduced into the 5' end of the primers SSA-GFP R1 and SSA-GFP F2. Figure 3 Finally, a reporter plasmid was constructed via two-fragment homologous recombination. The following primer pairs were used for the PCR reactions:

[0057] SSA-GFP F1:

[0058] ATTTACGAACGATAGACTAGTATGGTGAGCAAGGGCGAGGA, SEQ ID NO.6;

[0059] SSA-GFP R1:

[0060] AGTCAAGATTTTGTGAGGGTAAGAGGATCCTTAGTccatgatatagacgttgtggctgt, SEQ IDNO.7;

[0061] SSA-GFP F2:

[0062] ACCCTCACAAAATCTTGACTGGGAGAAGACATAAGTCGAccatgcccgaaggctacgtc, SEQ IDNO.8;

[0063] SSA-GFP R2:

[0064] CGATCGGGGAAATTCTCTAGATTACTTGTACAGCTCGTCCATGCC, SEQ ID NO.9.

[0065] Table 1 PCR reaction system:

[0066]

[0067] Table 2 PCR amplification program

[0068]

[0069] The two PCR products obtained from the amplification were recovered using an enhanced agarose gel DNA recovery kit.

[0070] The vector's backbone plasmid was pUC-2×35s-EGFP. The vector was linearized using restriction endonucleases SpeI and XbaI, and the EGFP gene was excised.

[0071] Table 3 Enzyme digestion system

[0072]

[0073] The reaction system was incubated overnight at 37°C for enzyme digestion.

[0074] Furthermore, the linearized vector was recovered using an ultrathin DNA product purification kit;

[0075] Furthermore, using the ClonExpress® II One Step Cloning Kit, recombinant PCR products SSAr-EGFP-N, SSAr-EGFP-C, and linearized vectors were obtained.

[0076] Furthermore, the recombinant product was transformed into Escherichia coli DH5α, and after overnight growth on plates, single colonies were selected for colony PCR identification to screen for positive transformants.

[0077] Furthermore, using Sanger sequencing, it was confirmed that the SSAr-EGFP-GhCLA_D gene was correctly constructed into the pUC-2×35S-EGFP plasmid, and the successfully constructed plasmid was named pSSAr-EGFP-GhCLA_D.

[0078] The pSSAr-EGFP-GhCLA_D plasmid was linearized using BamHI and SalI. The four CLA sequences, AeCLA_1, AeCLA_2, AdCLA_D, and DzCLA2, were then constructed into the linearized plasmid via primer annealing (refer to CN113215145A) and homologous recombination.

[0079] The following primer pairs are used for introducing annealing:

[0080] AeCLA_1-F:

[0081] atatcatggACTAAGGATCCTCTTACCCTCACAAAATCTTAACTGGGAG, SEQ ID NO.10;

[0082] AeCLA_1-R:

[0083] tagccttcgggcatggTCGACTTATCTCTCCTCCCAGTTAAGATTTTGTG, SEQ ID NO.11;

[0084] AeCLA_2-F:

[0085] atatcatggACTAAGGATCCTCTTACCCTCATAAAATCTTGACTGGGAGA, SEQ ID NO.12;

[0086] AeCLA_2-R:

[0087] tagccttcgggcatggTCGACTTATCTCTTCTCCCAGTCAAGATTTTATGAGG, SEQ ID NO.13;

[0088] AdCLA_D-F:

[0089] atatcatggACTAAGGATCCTCTTACCCTCACAAAATCTTGACCGGGAGGAGAGATA, SEQ IDNO.14;

[0090] AdCLA_D-R:

[0091] tagccttcgggcatggTCGACCTATCTCTCCTCCCGGTCAAG, SEQ ID NO.15;

[0092] DzCLA2-F:

[0093] atatcatggACTAAGGATCCTCTTACCCGCACAAAATCTTGACTGG, SEQ ID NO.16;

[0094] DzCLA2-R:

[0095] tagccttcgggcatggTCGACTTATCTCTTCTCCCAGTCAAGATTTTGTGC, SEQ ID NO. 17.

[0096] Table 4 PCR Amplification Program

[0097]

[0098] The vector's backbone plasmid was pSSAr-EGFP-GhCLA_D. The vector was linearized using restriction endonucleases BamHI and SalI, and the CLA gene fragment from cotton was excised.

[0099] Table 5 Enzyme digestion system

[0100]

[0101] The reaction system was incubated overnight at 37°C for enzyme digestion.

[0102] Furthermore, the linearized vector was recovered using an ultrathin DNA product purification kit;

[0103] Furthermore, the recombinant annealed product and the linearized vector were separately recombined using the ClonExpress® II One Step Cloning Kit.

[0104] Furthermore, the recombinant product was transformed into Escherichia coli DH5α, and after overnight growth on plates, single colonies were selected for colony PCR identification to screen for positive transformants.

[0105] Furthermore, the Sanger sequencing method was used to confirm whether the four genes AeCLA_1, AeCLA_2, AdCLA_D, and DzCLA2 were correctly constructed into the SSAr plasmid.

[0106] (iv) Protoplast transformation

[0107] The SSAr plasmid and gene-editing plasmid were extracted using an endotoxin-free plasmid extraction kit. The ratio of gene-editing plasmid to reporter plasmid was adjusted to 1:1 and added to 100 μL of extracted protoplasts. The mixture was gently tapped to mix and incubated in the dark for 10 minutes. Protoplast transformation solution was then added, gently tapped to mix, and incubated in the dark for 30 minutes. The reaction was terminated by adding W5 solution. The transformation solution was discarded by centrifugation, and the transformed protoplasts were resuspended in W5 solution.

[0108] (v) Observation of transformation results

[0109] The transformed protoplasts were observed under an optical microscope equipped with a fluorescence system.

[0110] like Figure 4 As shown, a high proportion of fluorescent cells were observed in both experimental groups (SSAr+T1 and SSAr+T2), which was significantly different from the negative control group SSAr. This indicates that the two usgRNAs successfully cleaved the Malvaceae CLA target sequence, thus restoring EGFP fluorescence.

[0111] (vi) Editing event detection

[0112] On the third day of transformation, protoplast DNA was extracted for testing. The following primer pairs were used for the PCR reaction:

[0113] Hi-GhCLA2-F: ggagtgagtacggtgtgcTGGCTCTTCATTATGTCTTCAATGCC, SEQ IDNO.18;

[0114] Hi-GhCLA2-R: gagttggatgctggatggCTCTCCGACCGTTTCGTGAATC, SEQ ID NO. 19.

[0115] Table 6 PCR reaction system:

[0116]

[0117] Table 7 PCR Amplification Procedure

[0118]

[0119] The amplified sample was sent to Hi-Tom for sequencing, and the sequencing results are as follows: Figure 5 As shown, different types of insertions and deletions were detected in the usgRNA target region.

[0120] The transformation results and editing event detection described above indicate that MCLA usgRNA-T1 and MCLA usgRNA-T2 can edit all sequence variation types of the CLA gene in Malvaceae plants.

[0121] Example 2

[0122] Rapidly design usgRNAs for the CLA gene in other plant families.

[0123] To facilitate the design of usgRNA for CLA genes in other plant families, this invention extracts CLA gene sequences from representative species in the terrestrial plant evolutionary tree. For example... Figure 6 As shown, all representative terrestrial plant species contain the conserved amino acid sequence SEQ ID NO.1: YPHKILTGRR, indicating that their corresponding nucleotide sequences have few sequence variations. Subsequently, this invention extracted the corresponding nucleotide sequences from representative plants of the Poaceae, Cucurbitaceae, and Solanaceae families, finding even fewer sequence variations in this region within the same family. Figure 7 Therefore, based on the positions designed for MCLA usgRNA-T1 and MCLA usgRNA-T2, usgRNAs targeting the CLA gene of any plant family can be designed at the corresponding positions. Specifically, the nucleotide sequence corresponding to SEQ ID NO.1: YPHKILTGRR, with nucleotides 2-21 designed as the spacer sequence for the coding strand usgRNA and nucleotides 6-25 designed as the spacer sequence for the non-coding strand usgRNA. usgRNAs designed in this way can be used in conjunction with SpCas9 or SpCas9 (NG) for gene editing research.

[0124] Example 3

[0125] We designed usgRNAs targeting the SP gene of the Malvaceae family and tested the usgRNA / Cas9-mediated target sequence cleavage capability.

[0126] In protoplasts, the SSAr-EGFP reporter system was used to verify whether usgRNA could target and cleave all variant sequences of the Malvaceae SP gene.

[0127] The specific implementation process is briefly described below:

[0128] (a) Design of usgRNA targeting the SP gene of Malvaceae plants

[0129] SP gene sequences from sequenced Malvaceae plants were obtained from public databases. Multiple sequence alignment was performed using Jalview software. Conserved regions of the SP gene were identified, and a usgRNA, named MSP usgRNA-T1, was designed. This usgRNA exhibited only 0-1 base mismatches when targeting the SP gene sequences of all sequenced Malvaceae plants. Figure 8 The five SP sequences from five species—cotton (GhSP), okra (AeSP_4), baobab (AdSP_1), jute (CcSP), and ragweed (MpSP)—represent all sequence variation types when MSP usgRNA-T1 targets SP genes in Malvaceae plants. Therefore, these five SP sequence variation types can be used to assess whether usgRNA can target and cleave SP homologous gene sequences in all Malvaceae plants.

[0130] (II) Synthesis of gene editing plasmids

[0131] The spacer sequence of MSP usgRNA-T1 was synthesized into a gene editing plasmid with GhU6.9 as the promoter by gene synthesis.

[0132] The spacer sequence of usgRNA is:

[0133] MSP usgRNA-T1: TATGAGATCCTTTTTCACCC, SEQ ID NO.4.

[0134] (III) Construction of SSAr-EGFP reporter plasmid

[0135] The pSSAr-EGFP-GhCLA_D plasmid was linearized using BamHI and SalI. The spacer sequences of GhSP, AeSP_4, AdSP_1, CcSP, and MpSP were constructed into the linearized plasmid by primer annealing (refer to CN113215145A) and homologous recombination.

[0136] The following primer pairs are used for introducing annealing:

[0137] MSP-SSAr-Ad F:

[0138] atatcatggACTAAGGATCCTATGAGATCCTTTTTtACaCTGGTCG,SEQ ID NO.20;

[0139] MSP-SSAr-Ad R:

[0140] TagccttcgggcatggTCGACCAGtGTaAAAAAGGATCTCATAGG,SEQ ID NO.21;

[0141] MSP-SSAr-Ae F:

[0142] atatcatggACTAAGGATCCTATGAGATCaTTTTTCACCCTGGTCG,SEQ ID NO.22;

[0143] MSP-SSAr-Ae R:

[0144] tagccttcgggcatggTCGACCAGGGTGAAAAAtGATCTCATAGG,SEQ ID NO.23;

[0145] MSP-SSAr-Cc F:

[0146] atatcatggACTAAGGATCCTATGAGAagCTTTTTCACCCTGGTCG,SEQ ID NO.24;

[0147] MSP-SSAr-Cc R:

[0148] tagccttcgggcatggTCGACCAGGGTGAAAAAGctTCTCATAGG,SEQ ID NO.25;

[0149] MSP-SSAr-Gh F:

[0150] atatcatggACTAAGGATCCTATGAGATCCTTTTTCACCCTGGTCG,SEQ ID NO.26;

[0151] MSP-SSAr-Gh R:

[0152] tagccttcgggcatggTCGACCAGGGTGAAAAAGGATCTCATAGG, SEQ ID NO.27;

[0153] MSP-SSAr-Mp F:

[0154] atatcatggACTAAGGATCCTATGAGATgCTTTTTCACCCTGGTCG, SEQ ID NO.28;

[0155] MSP-SSAr-Mp R:

[0156] tagccttcgggcatggTCGACCAGGGTGAAAAAGcATCTCATAGG, SEQ ID NO. 29.

[0157] Table 8 PCR Amplification Procedure

[0158]

[0159] The vector's backbone plasmid was pSSAr-EGFP-GhCLA_D. The vector was linearized using restriction endonucleases BamHI and SalI, and the CLA gene fragment from cotton was excised.

[0160] Table 9 Enzyme digestion system

[0161]

[0162] The reaction system was incubated overnight at 37°C for enzyme digestion.

[0163] Furthermore, the linearized vector was recovered using an ultrathin DNA product purification kit;

[0164] Furthermore, the recombinant annealed product and the linearized vector were separately recombined using the ClonExpress® II One Step Cloning Kit.

[0165] Furthermore, the recombinant product was transformed into Escherichia coli DH5α, and after overnight growth on plates, single colonies were selected for colony PCR identification to screen for positive transformants.

[0166] Furthermore, Sanger sequencing was used to confirm whether the five genes GhSP, AeSP_4, AdSP_1, CcSP, and MpSP were correctly constructed into the SSAr plasmid.

[0167] (iv) Protoplast transformation

[0168] The SSAr plasmid and gene-editing plasmid were extracted using an endotoxin-free plasmid extraction kit. The ratio of gene-editing plasmid to reporter plasmid was adjusted to 1:1 and added to 100 μL of extracted protoplasts. The mixture was gently tapped to mix and incubated in the dark for 10 minutes. Protoplast transformation solution was then added, gently tapped to mix, and incubated in the dark for 30 minutes. The reaction was terminated by adding W5 solution. The transformation solution was discarded by centrifugation, and the transformed protoplasts were resuspended in W5 solution.

[0169] (v) Observation of transformation results

[0170] The transformed protoplasts were observed under an optical microscope equipped with a fluorescence system.

[0171] like Figure 9 As shown, a high proportion of fluorescent cells were observed in both experimental groups (SSAr+T1), which was significantly different from the negative control group SSAr. This indicates that usgRNA T1 successfully cleaved the Malvaceae SP target sequence, restoring EGFP fluorescence.

[0172] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A plant-wide usgRNA, characterized in that, When the usgRNA targets the CLA gene of the Malvaceae family, the spacer sequence of the usgRNA is shown in SEQ ID NO.2 and SEQ ID NO.3, and the amino acid coding sequence corresponding to the selectable conserved region is shown in SEQ ID NO.1; When the usgRNA targets the Malvaceae SP gene, it is characterized in that the spacer sequence of the usgRNA is as shown in SEQ ID NO.

4.

2. The application of the usgRNA described in claim 1 in establishing a gene editing research system, characterized in that, When the usgRNA targets the CLA gene of Malvaceae, the gene editing research system is a CLA gene editing research system for Malvaceae plants; When the usgRNA targets the SP gene of Malvaceae, the gene editing research system is a research system for SP gene editing of Malvaceae plants.

3. The application of the usgRNA described in claim 1 in the rapid improvement of traits in species of the same family, characterized in that, The species in question is a plant belonging to the Malvaceae family.

4. The application of the usgRNA according to claim 1 in the development and utilization of plant resources using gene editing technology, characterized in that, The plant resources mentioned are plants of the Malvaceae family.

Citation Information

Patent Citations

  • Short fragment cloning method independent of PCR reaction

    CN113215145A

  • Visualization plasmids replacing fluorescent proteins and their related applications

    CN117230109B

  • Accurate and efficient editing method of upland cotton genome

    CN110283840A

  • Rape gene BnLYK and application thereof in prevention and control of sclerotiniose

    CN117965556A