Application of migratory locust rhythm gene Clock in regulation and control of eclosion rhythm

Abstract

The invention relates to application of migratory locust rhythm gene Clock in regulation and control of eclosion rhythm. According to the method, dsRNA of the migratory locust rhythm gene Clock is injected into a migratory locust body cavity, the expression quantity of the migratory locust rhythm gene Clock is remarkably reduced, the circadian rhythm and daily rhythm of migratory locust are both changed by regulating synthesis of 20E, living work and rest formed by long-term coevolution of migratory locust and the external environment are disrupted, serious harm is caused to survival and reproduction of migratory locust, and the migratory locust is prevented from being damaged. And a new way is provided for pest control.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to the application of the locust rhythm gene Clock in regulating the eclosion rhythm. Background Technology

[0002] All living organisms, from lower bacteria to higher plants and animals, possess a biological clock regulation system, an endogenous molecular timing device developed by organisms to adapt to their environment. Organisms adjust their behavior and physiological changes to adapt to constantly changing environments. Insects are the most numerous animal group on Earth, and the behavior of the vast majority of insects is regulated by a biological clock, exhibiting circadian rhythms, such as the emergence and sleep of fruit flies. Besides fruit flies, crickets also exhibit a typical bimodal circadian rhythm. Interference with the clock gene TIM2 using dsRNA altered its activity pattern and decreased its activity intensity. Interference with the PER gene resulted in the disappearance of its circadian rhythm. This indicates that biological clock genes play a crucial role in maintaining the circadian rhythm of cricket activity.

[0003] In desert locusts, the three clock genes PER, TIM, and CLK are highly expressed in reproductive tissues. PER and TIM exhibit similar daily expression rhythms, reaching their first expression peak at ZT12h. However, the expression peak of CLK occurs 12h earlier than the first expression peaks of PER and TIM. dsRNA interference with PER and TIM significantly reduces the number of eggs laid by female desert locusts. In the long-red assassin bug, the biological clock generates rhythmicity through the release of neuropeptide hormones, one of which is prothymocyte-stimulating hormone (PSH), which induces the prothymus to rhythmically synthesize and release ecdysteroids. The receptor for ecdysteroid (20E) is a heterodimer. After binding to the nuclear receptor EcR (Ecdysteroid receptor), 20E binds to the ultraspiracle protein (USP) to form a functional receptor. 20E initiates the transcription of downstream genes through the functional receptor, including the apoptosis of old tissue and the formation of new tissue.

[0004] Locusts, which can swarm and cause outbreaks, are important agricultural pests. The inventors of the locusts have discovered that they emerge in large numbers in the afternoon, but it is still unclear whether the emergence behavior of locusts has a diurnal rhythm or is regulated by clock genes. Summary of the Invention

[0005] The purpose of this invention is to provide the application of the locust rhythm gene Clock in regulating molting rhythm;

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] Application of the locust rhythm gene Clock in regulating molting rhythm.

[0008] The present invention also provides a dsRNA of the locust rhythm gene Clock, wherein the dsRNA consists of a sense strand with a nucleotide sequence as shown in SEQ ID NO:2 and an antisense strand with its reverse complementary sequence.

[0009] This invention also provides the application of the above-described dsRNA in the preparation of reagents that regulate the eclosion rhythm of locusts.

[0010] The present invention also provides the application of the above-described dsRNA in locust control.

[0011] This invention injects dsRNA of the locust rhythm gene Clock into the locust's body cavity, significantly reducing the expression level of Clock. By regulating the synthesis of 20E, the locust's diurnal and diurnal rhythms are altered, disrupting its long-term co-evolutionary lifestyle with the external environment and causing serious harm to its survival and reproduction, thus providing a new approach to pest control. Attached Figure Description

[0012] Figure 1 This is for the prediction of the Clock domain of the rhythm gene.

[0013] Figure 2 The expression rhythm of the rhythm gene Clock in locusts at different 24-hour intervals during the 5th instar is shown.

[0014] Figure 3 The expression level of the rhythm gene Clock in the brain of 5th instar locusts at different time points after interference.

[0015] Figure 4 In the table, a represents the statistics of locust emergence rhythm in the control group, b represents the statistics of locust emergence rhythm after the Clock gene was interfered with, and c represents the time statistics of locust emergence rhythm in the control group and the interference group.

[0016] Figure 5 In the table, a represents the expression level of the Sad gene in the locust 20E synthesis pathway after the Clock gene was disrupted at different time points; b represents the expression level of the Shd gene in the locust 20E synthesis pathway after the Clock gene was disrupted at different time points; c represents the expression level of the USP gene, the receptor gene for the locust 20E after the Clock gene was disrupted at different time points; and d represents the expression level of the EcR gene, the receptor gene for the locust 20E after the Clock gene was disrupted at different time points. Detailed Implementation

[0017] The present invention will be further described below with reference to the accompanying drawings and specific embodiments.

[0018] The insect source used in the following examples was locusts from Hebei Province, which had been continuously reared in the laboratory for multiple generations. The locusts were reared at a photoperiod of 12 L:12 D and a temperature of 28°C, and fed fresh wheat seedlings.

[0019] In the following embodiments, the equipment and materials were obtained from the following companies:

[0020] The artificial climate incubator was purchased from Beijing Luxi, model: MGX-400FP;

[0021] The infrared surveillance camera was purchased from Hangzhou Ezviz, model: CS-C6P-7A3WFR;

[0022] The PCR instrument was purchased from BIO-RAD, model: T100;

[0023] The microplate centrifuge was purchased from TIANGEN, model: OSE-MP25;

[0024] The real-time PCR instrument was purchased from BIO-RAD, model: CFX 384 Touch;

[0025] The handheld electric tissue grinder was purchased from TIANGEN Beijing, item number: OSE-Y30;

[0026] The low-temperature centrifuge was purchased from Eppendorf, model: 5424R;

[0027] cDNA synthesis kit purchased from Promega, catalog number: M1705;

[0028] Oligo (dT) 15 Primers purchased from Promega, item number: C110A;

[0029] The fluorescence quantitative detection kit was purchased from abm, catalog number: G891;

[0030] The quantitative sealing film was purchased from BIO-RAD, item number: MSB1001;

[0031] 1.8 mL external spiral cryopreservation tubes were purchased from Thermo, catalog number: 375418;

[0032] The 1.5 mL EP tubes were purchased from Axygen, part number: MCT-150-C;

[0033] KOD high-fidelity enzyme was purchased from TOYOBO, product number: KMM-201;

[0034] RNA isolation reagent was purchased from Invitrogen, catalog number: 15596018CN;

[0035] The gel recovery kit was purchased from ZYMO, catalog number: D4008;

[0036] Taq DNA polymerase was purchased from TaKaRa, catalog number: R001AM;

[0037] The pEASY-Blunt Zero Cloning Kit was purchased from TransGen, item number: CB501;

[0038] The T7 in vitro transcription kit was purchased from Promega, catalog number: P1700;

[0039] Anhydrous ethanol, isopropanol, glycerol, and other reagents were all domestically produced analytical alcohols.

[0040] Example 1: Obtaining the full length of the locust rhythm gene Clock and predicting its domains.

[0041] 1. Extraction of total RNA from locusts

[0042] RNA was extracted from the brain tissue of locusts using RNA separation reagents. The specific steps are as follows:

[0043] Add 1 mL of TRIzol extraction buffer to a 1.5 mL RNase-Free centrifuge tube. Pour the sample to be tested into the centrifuge tube, add 2 grinding beads to each tube, and grind in a pre-cooled automatic grinder until fully ground. Incubate at room temperature for 5-10 min, then centrifuge at 12,000 g for 10 min at 4 °C. Transfer the supernatant to a new 1.5 mL RNase-Free centrifuge tube, add 200-300 μL of chloroform, shake vigorously for 30-60 s, and incubate at room temperature for 5 min. Centrifuge at 12,000 g for 15 min at 4 °C, and transfer approximately 400 μL of the upper aqueous phase to a new 1.5 mL RNase-Free centrifuge tube. Add an equal volume of isopropanol (400 μL), mix by inversion, and incubate at -20 °C overnight to precipitate. Centrifuge at 12,000 g for 10 min at 4 °C and discard the supernatant. Suspend the RNA at the bottom of the tube in 1 mL of 75% ethanol (prepared with DEPC water) and centrifuge at 8,000 g for 5 min at 4°C. Discard the supernatant, centrifuge at 8,000 g for 1 min at 4°C, aspirate the residual liquid, and allow to air dry. Add 20 μL of DEPC water, allow to dissolve completely at room temperature, and then aspirate 1 μL to test the concentration and total RNA integrity.

[0044] 2. Reverse transcription

[0045] 1) Use the M-MLV Reverse Transcriptase in vitro reverse transcription kit to reverse transcribe total RNA into cDNA. Refer to the kit instructions for reverse transcription steps. Dilute the resulting cDNA 10-fold with RNase-Free water, mix well, and store at -20°C for later use.

[0046] 3. Obtaining the full length of the locust rhythm gene Clock

[0047] 1) Primer design

[0048] Based on the previously obtained locust database, the Clock gene sequence was obtained, and the primers were designed as follows:

[0049] LOCMI00260-F1:ATGTCTAGTTACATTAAAAGAGAACCGT (SEQ ID NO:4);

[0050] LOCMI00260-R1:TCACTGCTGCTGTTGTCCAGA (SEQ ID NO: 5).

[0051] 2) PCR reaction

[0052] Using locust brain cDNA as a template, PCR amplification was performed using primers SEQ ID NO:4 and SEQ ID NO:5 to obtain PCR products. A 50 μL amplification system was used: 25 μL of 2 × PCR Buffer for KOD FX, 3 μL each of F1 and R1, 2 μL of cDNA synthesis product, and RNase-free water to make up to 50 μL. The PCR reaction program was: 94℃ pre-denaturation for 5 min, 98℃ pre-denaturation for 30 s, 60℃ annealing for 30 s, 68℃ extension for 2 min 30 s, and PCR terminated at 68℃ for 10 min. The product was stored at 4℃ until removed from storage. A total of 35 cycles of denaturation, annealing, and extension were performed. PCR products were detected by 2% agarose gel electrophoresis.

[0053] 3) PCR product recovery, cloning, and sequencing

[0054] 3-1) Perform electrophoresis on a 2% agarose gel prepared with TAE. When the target band is well separated, cut off the gel block containing the target band with a blade and place it into a 1.5 mL centrifuge tube. Then, use a gel extraction kit to recover and purify the target band, following the kit instructions.

[0055] 3-2) After PCR product recovery, ligation was performed using the pEASY-Blunt Zero vector to obtain the recombinant vector. The ligation system was as follows: 100 ng of gel-recovered DNA, 1 μL of pEASY-Blunt Zero Vector, and 3 μL of RNase-Free water were added to a total of 5 μL. After mixing and centrifugation, the mixture was incubated at 25°C for 20 min.

[0056] 3-3) Preparation and transformation of competent cells

[0057] Transform 5 μL of the recombinant vector after the reaction into competent cells and screen for positive bacteria. Refer to the reagent instructions for the transformation process.

[0058] 3-4) Bacterial PCR

[0059] Single colonies were selected, and bacterial PCR was performed using M13F / R primers. The PCR reaction system for 20 μL of bacterial culture was as follows: 2 μL bacterial culture, 10 μL 2×Buffer, 1 μL M13F, 1 μL M13R, 0.5 μL Taq enzyme, and 5.5 μL ddH2O. The reaction conditions were as follows: 95℃ for 3 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 90 s, 35 cycles; 72℃ for 10 min; and stored at 4℃. The positive clone strains were sent to Shanghai Sangon Biotech Co., Ltd. for sequencing, and the sequencing results were analyzed. The results showed that PCR amplification yielded a DNA fragment of 2223 bp, the nucleotide sequence of which is shown in SEQ ID NO:1. The gene shown in SEQ ID NO:1 was named the locust rhythm gene Clock.

[0060] 4. Prediction of the Clock domain of locust rhythm genes

[0061] The 740 amino acids of the locust rhythm gene Clock were used to predict its domains using the SMART website (https: / / smart.embl.de / ).

[0062] The results are as follows Figure 1 As shown, Clock contains one HLH structure field, two PAS structure fields, and one PAC structure field.

[0063] Example 2: Expression trend of the circadian rhythm gene Clock in the brain of 5th instar locusts over 24 hours at different times.

[0064] 1. Brain tissue sampling at different time points on days 1, 3, 5, 7, and 9 of the fifth instar of locusts.

[0065] To detect whether the circadian rhythm gene Clock expresses a rhythm within a 24-hour period, brain tissue was collected at time points ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20 on days 1, 3, 5, 7, and 9 of the fifth instar of locusts.

[0066] 2. Expression trend of the circadian rhythm gene Clock in the brain of 5th instar locusts over 24 hours at different times.

[0067] Total RNA was extracted from the brain of locusts, and cDNA was synthesized using a reverse transcription kit. Clock gene expression was then detected. RP49 was used as an internal control gene. Primer sequences are as follows:

[0068] Clock-F2: TTCTTGATCACAGAGCACCTCC (SEQ ID NO: 6);

[0069] Clock-R2:GCTTCATGGCATGTGACAACTT (SEQ ID NO:7);

[0070] RP49-F1:CGTAAACCGAAGGGAATTGA (SEQ ID NO:8);

[0071] RP49-R1:GAAGAAACTGCATGGGCAAT (SEQ ID NO:9).

[0072] Using BlasTaq TM Quantitative detection of candidate genes was performed using 2 × qPCR Master Mix in a 10 μL volume: BlasTaq. TM The reaction mixture was prepared using 5 μL of 2× qPCR Master Mix, 0.3 μL each of forward and reverse primers, 2.4 μL of RNase-free water, and 2 μL of template DNA. PCR was then performed using a real-time quantitative PCR instrument following a program of 95℃ pre-denaturation for 10 min, 95℃ denaturation for 15 s, 60℃ annealing for 20 s, and 60℃ extension for 20 s, for a total of 40 cycles. A melting curve was established at 65℃-95℃ for 15 s. Data was read using CFX Manager and processed using 2- ΔΔct The relative expression levels of each gene can be calculated.

[0073] The results are as follows Figure 2 As shown in the figure, Clock expression peaks were observed within 24 hours on days 1, 3, 5, 7, and 9 of the fifth instar of locusts, indicating a clear overall diurnal rhythm of the Clock gene.

[0074] Example 3: The dsRNA of the locust rhythm gene Clock and its application in molting rhythm

[0075] I. Synthesis of dsRNA

[0076] Uses T7RiboMAX TM The Express RNAi System kit is used to synthesize dsRNA. The specific steps are as follows:

[0077] 1) Synthesis of dsRNA primers

[0078] Primers were designed based on the cloned gene fragment to amplify the target fragment, which is 359 bp. A T7 promoter was introduced at the 5' end of the primers. The primer sequences are as follows:

[0079] Clock-F3: TAATACGACTCACTATAGGAGATCAGTTCAACATGCTCATCA (SEQ ID NO: 10);

[0080] Clock-R3: TAATACGACTCACTATAGGAGAGAGCTGACTGATCCTCCT (SEQ ID NO: 11).

[0081] 2) Preparation of DNA template

[0082] Using bacterial culture containing the gene fragment (the bacterial culture containing the recombinant vector in Example 1) as a template, PCR amplification was performed using Clock-F3 and Clock-R3 to obtain the target fragment containing the T7 promoter sequence. The 50 μL PCR reaction system was as follows: 4 μL bacterial culture, 25 μL 2 × PCR Buffer for KOD FX, 3 μL each of F4 and R4, and 15 μL RNase-Free water. The PCR reaction conditions were as follows: 94℃ for 5 min; 98℃ for 30 s, 60℃ for 30 s, 68℃ for 30 s, 35 cycles; 68℃ for 10 min; and stored at 4℃. The PCR products were electrophoresed on a 2% agarose gel prepared with TAE. When the target band was well separated, the DNA fragment in the gel was recovered, and the concentration of the target DNA was detected using a micro spectrophotometer. The recovered concentration should be greater than 125 ng / μL.

[0083] 3) Synthesis of dsRNA

[0084] Uses T7RiboMAX TM The Express RNAi System kit transcribes the recovered DNA in vitro to synthesize dsRNA of the locust rhythm gene Clock, and detects the dsRNA concentration using a micro spectrophotometer. The dsRNA concentration is then diluted to 2.0 μg / μL to obtain a dsRNA solution (using RNase-free water as the solvent).

[0085] The dsRNA of the locust rhythm gene Clock obtained in this invention is a double-stranded RNA, consisting of a sense strand and an antisense strand. The nucleotide sequence of its sense strand is SEQ ID NO:2, and the nucleotide sequence of its antisense strand is the reverse complementary sequence of SEQ ID NO:2.

[0086] The dsRNA of the locust rhythm gene Clock can also be obtained through artificial synthesis. The dsRNA of the locust rhythm gene Clock is named dsClock.

[0087] 4) dsRNA of control GFP

[0088] The control GFP dsRNA was synthesized according to the above method and named dsGFP, yielding a 2.0 μg / μL dsGFP solution. The control GFP dsRNA is a double-stranded RNA, composed of a sense strand and an antisense strand. The nucleotide sequence of its sense strand is SEQ ID NO:3, and the nucleotide sequence of its antisense strand is the reverse complementary sequence of SEQ ID NO:3. The primers for synthesizing GFP dsRNA are as follows:

[0089] GFP-F1: TAATACGACTCACTATAGGCACAAGTTCAGCGTGTCCG (SEQ ID NO: 12);

[0090] GFP-R1: TAATACGACTCACTATAGGGTTCACCTTGATGCCGTTC (SEQ ID NO: 13).

[0091] II. Application of dsRNA in the Emergence Rhythm of Locusts

[0092] 1. Experimental Methods

[0093] dsRNA was introduced into the brain of fifth-instar locusts. The specific steps were as follows: A microinjection (69 nL) of brain tissue from locust nymphs on day 7 of the fifth instar was performed at a concentration of 2.0 μg / μL. After injection, the nymphs were incubated at 28°C. A control group was injected with dsGFP. 24 h later, brain tissue, hemolymph, and prothymus samples were taken from fifth-instar locust nymphs at ages ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20, with 1-3 nymphs per biological replicate × 5 biological replicates for subsequent qPCR detection.

[0094] 2. Interference efficiency detection

[0095] Total RNA was extracted from the brain of locusts, and cDNA was synthesized using a reverse transcription kit. The expression level of the Clock gene was then detected. The RP49 gene was used as an internal control gene.

[0096] The results are as follows Figure 3 As shown, at ZT0, ZT4, ZT8, ZT12, ZT16 and ZT20, the expression level of Clock in the interference group was significantly reduced compared with the dsGFP group, indicating that Clock interference was successful in the brain of the fifth-instar locust.

[0097] 3. Statistics on the emergence rhythm of locusts

[0098] The disturbed fifth-instar locust nymphs were kept in the climate incubator for further rearing. The number of locusts that emerged at different time points was counted using an infrared camera. The data from every four hours were combined to count the number of locusts that emerged at ZT0-4, ZT4-8, ZT8-12, ZT12-16, ZT16-20, and ZT20-0.

[0099] The results are as follows Figure 4 As shown in Figure A: In the control group, the locust emergence rhythm was more daytime than nighttime; Figure B: After interfering with the Clock gene, the locust emergence rhythm changed to more nighttime than daytime; Figure C: In the control group, the locust emergence peak was at ZT4-8, while in the interference group, the locust emergence peak was at ZT16-20. The results indicate that interfering with the Clock gene altered both the diurnal and diurnal rhythms of the locust.

[0100] 4. Expression trends of the 20E synthetic gene and receptor gene in locust after clock interference.

[0101] Total RNA was extracted from the hemolymph and prothymus of locusts, and cDNA was synthesized using a reverse transcription kit. Clock gene expression was then detected. The RP49 gene was used as an internal control. Primer sequences are as follows:

[0102] Sad-F1: CACATTCTTAGACATCGGGAAATCG (SEQ ID NO: 14);

[0103] Sad-R1:TTTCACACAACTATACGCGTCTCTT (SEQ ID NO:15);

[0104] Shd-F1:AAGGCCGCTGTGATTGACTTCATA (SEQ ID NO:16);

[0105] Shd-R1: CTTGAGGCACTAGGGAAGAGATTT (SEQ ID NO: 17);

[0106] EcR-F1:TTTAAGACGAGTTACGAGTCAACCT (SEQ ID NO: 18);

[0107] EcR-R1: GGAACATGCCTTCAGTAATGCTATC (SEQ ID NO: 19);

[0108] USP-F1: GTTTTGACAGAACTGGTAGCAAAGA (SEQ ID NO: 20);

[0109] USP-R1: GCGGCATATACTTTTTCACGTAGA (SEQ ID NO: 21).

[0110] The results are as follows Figure 5 As shown in Figure A, after interfering with the Clock rhythm gene, compared with the control group, the expression trend of the 20E synthesis pathway gene Sad changed from high expression of ZT6 to high expression of ZT2, and the expression trend of the 20E synthesis gene Shd changed from high expression of ZT18 to high expression of ZT6. The expression trends of the 20E receptor genes USP and EcR remained unchanged, still showing high expression of ZT10. The results indicate that rhythm genes can regulate the synthesis of 20E and thus regulate the emergence rhythm of locusts.

Claims

1. Application of the locust rhythm gene Clock in regulating molting rhythm.

2. A dsRNA of the locust rhythm gene Clock, characterized in that, The dsRNA consists of a sense strand with a nucleotide sequence as shown in SEQ ID NO:2 and an antisense strand with its inverse complementary sequence.

3. The application of the dsRNA according to claim 3 in the preparation of reagents for regulating the eclosion rhythm of locusts.

4. The application of dsRNA in locust control according to claim 3.

Images