Nucleic acid molecule for coding wheat stripe rust effect protein Pst13248 and application thereof

Abstract

The invention provides a nucleic acid molecule for coding wheat stripe rust effect protein Pst13248 and application of the nucleic acid molecule, and belongs to the technical field of biological agriculture. The invention provides a nucleic acid molecule for coding wheat stripe rust effect protein Pst13248. According to the invention, Pst13248 of puccinia striiformis is silenced by an RNAi transgenic technology to obtain a Pst13248 silenced wheat material, and a wheat plant with wheat stripe rust resistance is obtained. In an infection experiment of stripe rust CYR32 on wheat, compared with a contrast Fielder, the Pst13248-RNAi wheat plant has the advantage that the Pst13248-RNAi wheat plant shows obvious resistance. Specifically, Pst13248-RNAi is a macroscopic phenotype that a large area of allergic necrosis reaction is generated at a leaf infected part of a wheat plant and uredospores of puccinia striiformis are reduced; the active oxygen area is increased, the cell necrosis area is increased, and strip rust hypha infection is blocked.

Description

Technical Field

[0001] This invention belongs to the field of bio-agricultural technology, and in particular relates to a nucleic acid molecule encoding the wheat stripe rust effector protein Pst13248 and its application. Background Technology

[0002] Wheat stripe rust is a common disease of wheat caused by the fungus *Puccinia striiformis* f.sp. tritici (Pst). Pst mutates frequently, and the emergence of new virulent races leads to the continuous overcoming of resistance genes, causing resistant wheat varieties to lose their resistance. Therefore, obtaining new resources resistant to wheat stripe rust is an urgent problem to be solved. Summary of the Invention

[0003] The purpose of this invention is to provide a nucleic acid molecule encoding the wheat stripe rust effector protein Pst13248 and its application. Silencing the nucleic acid molecule Pst13248 can enable wheat plants to acquire higher resistance to stripe rust and can be used to obtain new wheat stripe rust resistant resources.

[0004] This invention provides a nucleic acid molecule encoding the wheat stripe rust effector protein Pst13248, comprising at least one of the following:

[0005] (1) A gene comprising the nucleotide sequence shown in SEQ ID NO.1;

[0006] (2) A gene that has more than 80% identity with the gene shown in (1) and encodes the wheat stripe rust effector protein Pst13248 by substituting, deleting and / or adding one or more nucleotides of the gene described in (1);

[0007] (3) A fusion gene obtained by connecting the gene of (1) or the gene of (2) to the 3' end and / or the 5' end of the gene to which the protein tag is encoded.

[0008] The present invention also provides a silencing fragment design site for silencing the nucleic acid molecules described in the above scheme, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0009] The present invention also provides an RNAi expression vector for silencing the nucleic acid molecules described in the above scheme, wherein the silencing fragment design site described in the above scheme is inserted.

[0010] Preferably, the RNAi expression vector comprises the pDONR221 intermediate vector and the pC336 final vector.

[0011] The present invention also provides a recombinant bacterium containing the RNAi expression vector described in the above scheme.

[0012] This invention also provides reagents for silencing the nucleic acid molecules described in the above-described scheme, the design site for the silencing fragment, the RNAi expression vector, or the recombinant bacteria for improving resistance to stripe rust in cereal crops.

[0013] Preferably, the improvement of stripe rust resistance in cereal crops is achieved by at least one of the following:

[0014] 1) Increases reactive oxygen species in the areas infected by stripe rust fungi on leaves;

[0015] 2) Increase the area of ​​cell necrosis at the site of stripe rust infection on leaves;

[0016] 3) Inhibit the mycelial infection of stripe rust fungi and / or reduce the area of ​​mycelial infection of stripe rust fungi;

[0017] 4) Reduce stripe rust fungus urediniospores.

[0018] Preferably, the cereal crop includes wheat.

[0019] The present invention also provides a method for constructing plant germplasm that silences the nucleic acid molecules described in the above scheme, comprising the following steps: transferring the RNAi expression vector described in the above scheme into the target plant, and further screening to obtain plant germplasm that silences the nucleic acid molecules described in the above scheme.

[0020] Preferably, the target plant includes wheat.

[0021] This invention provides a nucleic acid molecule encoding the wheat stripe rust effector protein Pst13248, comprising at least one of the following: (1) a gene comprising the nucleotide sequence shown in SEQ ID NO.1; (2) a gene encoding the wheat stripe rust effector protein Pst13248 obtained by substituting, deleting, and / or adding one or more nucleotides to the gene described in (1); (3) a fusion gene obtained by connecting a protein tag encoding gene to the 3' and / or 5' ends of the gene described in (1) or (2). Transient co-expression of the disease resistance protein NLR in *Nicotiana benthamiana*. Moro And Pst13248, it was found that Pst13248 can reduce the effects of NLR Moro This leads to the accumulation of reactive oxygen species (ROS) and cell necrosis, and the hydrogen peroxide (H2O2) content and ion leakage rate are higher compared to NLR. Moro The expression levels of tobacco-related genes (PRs) decreased.

[0022] This invention also utilizes RNAi transgenic technology to silence the stripe rust fungus Pst13248, obtaining Pst13248-RNAi wheat material, thus producing wheat plants resistant to wheat stripe rust. In experiments involving infection with the stripe rust fungus CYR32, Pst13248-RNAi wheat plants exhibited significant resistance compared to the control Fielder. Specifically, Pst13248-RNAi wheat plants showed macroscopic phenotypes of large-area hypersensitive necrosis at the infection sites on the leaves and reduced stripe rust urediniospores; and microscopic phenotypes of increased reactive oxygen species area, increased cell necrosis area, and inhibited stripe rust mycelial infection. Therefore, silencing Pst13248 can induce higher stripe rust resistance in wheat plants and can be used to obtain novel stripe rust-resistant resources for wheat. Attached Figure Description

[0023] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0024] Figure 1 Transient co-expression of NLR in Tobacco Benzovia Moro The results are compared with those of Pst13248; where A represents the tobacco phenotype and its DAB staining results at 48 h, the tobacco phenotype and its trypan blue staining results at 120 h, and the Western blot detection results; B represents the statistical results of reactive oxygen species content at 48 h; and C represents the statistical results of ion leakage rate at 120 h.

[0025] Figure 2 Transient co-expression of NLR in Tobacco Benzovia Moro The statistical results of the expression levels of tobacco-related proteins in tobacco at Pst13248; where A is NbPR1, B is NbPR2, and C is NbPR4.

[0026] Figure 3 The results of silencing Pst13248 in wheat are shown in Figure A, which is a comparison of the resistance and susceptibility phenotypes of leaves in Pst13248-RNAi plants and Fielder plants; Figure B is a statistical graph of the relative expression level of Pst13248 in plants; and Figure C is a statistical graph of biomass.

[0027] Figure 4These are microscopic images of Pst13248-RNAi and Fielder wheat after infection with stripe rust fungus. A represents typical photographs of H2O2 accumulation near the infection site in Pst13248-RNAi and Fielder wheat at 48 hpi and 96 hpi; B represents the statistical results of the H2O2 accumulation area; C represents typical photographs of cell necrosis near the infection site in Pst13248-RNAi and Fielder wheat at 48 hpi and 96 hpi; D represents the statistical results of the cell necrosis area; E represents typical photographs of the growth and development of stripe rust fungus in Pst13248-RNAi and Fielder wheat at 48 hpi and 96 hpi; and F represents the mycelial area of ​​stripe rust fungus at 48 hpi and 96 hpi. Detailed Implementation

[0028] This invention provides a nucleic acid molecule, Pst13248, encoding the wheat stripe rust effector protein Pst13248, comprising at least one of the following:

[0029] (1) A gene comprising the nucleotide sequence shown in SEQ ID NO.1;

[0030] (2) A gene that has more than 80% identity with the gene shown in (1) and encodes the wheat stripe rust effector protein Pst13248 by substituting, deleting and / or adding one or more nucleotides of the gene described in (1);

[0031] (3) A fusion gene obtained by connecting the gene of (1) or the gene of (2) to the 3' end and / or the 5' end of the gene to which the protein tag is encoded.

[0032] In this invention, the nucleotide sequence shown in SEQ ID NO.1 is specifically as follows:

[0033] As one implementation method, some genes in different stripe rust physiological races have individual nucleotide sequences that are slightly different from the above nucleic acid molecules but still encode the wheat stripe rust effector protein Pst13248, and are still included in the nucleic acid molecule Pst13248.

[0034] In this invention, the wheat stripe rust effector protein Pst13248 negatively regulates wheat stripe rust resistance, and silencing Pst13248 can enable wheat plants to acquire higher stripe rust resistance; the wheat stripe rust effector protein Pst13248 is derived from wheat stripe rust fungus (Puccinia striiformis f.sp.tritici).

[0035] This invention also provides a silencing fragment design site for silencing the nucleic acid molecules described in the above scheme, the nucleotide sequence of which is shown in SEQ ID NO.2, specifically:

[0036] 5'-gcctcaaccaacaagcatccacacaaacgtttaatcccagatcacacttaccgaaaaaatcccactcactcacaaccttacggccca aacgccccttcaagacaataccccgaatcctccttcaccgtttttcgacagcaatgtttacttcgcgattgctcttgtcgtcggtcctctgcgtgatcg cagccgtggtaactgccactaccccggccccccttggccccttgaaccttt-3'.

[0037] In this invention, wheat that has its nucleic acid molecule Pst13248 silenced exhibits higher resistance to wheat stripe rust.

[0038] The present invention also protects RNAi transgenic materials for constructing RNAi expression vectors to silence Pst13248 using fragments in the nucleotide sequence described in SEQ ID No. 1, including but not limited to SEQ ID No. 2.

[0039] The present invention also provides an RNAi expression vector for silencing the nucleic acid molecules described in the above scheme, wherein the silencing fragment design site described in the above scheme is inserted.

[0040] In one embodiment, the RNAi expression vector includes the pDONR221 intermediate vector and the pC336 final vector.

[0041] As one implementation method, the method for constructing the RNAi expression vector includes the following steps:

[0042] The nucleotide sequence of the designed silencing fragment site was constructed into the intermediate vector pDONR221 using Gateway cloning technology via a BP reaction. After successful construction, it was inserted into the final vector pC336 via an LR reaction to obtain the RNAi expression vector.

[0043] The present invention also provides a recombinant bacterium containing the RNAi expression vector described in the above scheme.

[0044] In one embodiment, the original bacteria of the recombinant bacteria include Agrobacterium. This invention utilizes Agrobacterium-mediated genetic transformation technology to create RNAi transgenic materials to obtain durable disease-resistant materials.

[0045] This invention also provides reagents for silencing the nucleic acid molecules described in the above-described scheme, the design site for the silencing fragment, the RNAi expression vector, or the recombinant bacteria for improving resistance to stripe rust in cereal crops.

[0046] In this invention, silencing Pst13248 enables wheat plants to acquire higher resistance to stripe rust and can be used to obtain new wheat stripe rust resistant resources.

[0047] As one implementation method, the improvement of stripe rust resistance in cereal crops is achieved through at least one of the following:

[0048] 1) Increases reactive oxygen species in the areas infected by stripe rust fungi on leaves;

[0049] 2) Increase the area of ​​cell necrosis at the site of stripe rust infection on leaves;

[0050] 3) Inhibit the mycelial infection of stripe rust fungi and / or reduce the area of ​​mycelial infection of stripe rust fungi;

[0051] 4) Reduce stripe rust fungus urediniospores.

[0052] As one implementation, the necrosis includes allergic necrosis.

[0053] In one implementation, the cereal crop includes wheat.

[0054] The present invention also provides a method for constructing plant germplasm that silences the nucleic acid molecules described in the above scheme, comprising the following steps: transferring the RNAi expression vector described in the above scheme into the target plant, and further screening to obtain plant germplasm that silences the nucleic acid molecules described in the above scheme.

[0055] In one implementation, the target plant includes wheat.

[0056] The present invention also provides plant germplasm (RNAi transgenic plants) obtained by the method described in the above scheme.

[0057] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes a nucleic acid molecule encoding the wheat stripe rust effector protein Pst13248 and its applications, but these descriptions should not be construed as limiting the scope of protection of the present invention.

[0058] Example 1

[0059] Obtaining the Pst13248 gene

[0060] Sampling of Chinese spring wheat at the two-leaf stage was performed 48 hours after inoculation with stripe rust fungus CYR32. Approximately 100 mg of fresh leaves were cut with clean scissors and placed into 2 mL RNA-specific centrifuge tubes containing sterile steel beads. The tubes were labeled with the plant number from which the samples were taken, and then rapidly immersed in liquid nitrogen for quick freezing. The leaves were then disrupted using a plant tissue disruptor, maintaining a low temperature throughout the process to prevent tissue melting and potential explosion of the centrifuge tubes due to liquid nitrogen expansion. Total RNA extraction from wheat was performed using the Huayueyang Rapid Universal Plant RNA Extraction Kit 3.0 (CAT: 0416-50GK). Due to the instability of RNA, the entire process was carried out at the lowest possible temperature and as quickly as possible. RNA was reverse transcribed into cDNA using Novizan Biotechnology. IIQ RT SuperMix for qPCR (CAT: R223), extraction method as per company instructions.

[0061] Using this cDNA as a template, PCR amplification was performed using primers shown in SEQ ID No. 3 and SEQ ID No. 4. The amplification product was subjected to agarose gel electrophoresis, and the DNA fragment with a length of 543 bp was isolated, purified, and sequenced. The sequencing result is shown in SEQ ID No. 1, i.e., Pst13248.

[0062] SEQ ID No.3: 5'-ATGTTTACTTCGCGATTGCTC-3';

[0063] SEQ ID No. 4: 5'-TCAACACTTATTAGTTTGACGA-3'.

[0064] Example 2

[0065] Overexpression of Pst13248 in Example 1 of *Tobacco Benzoinus* can inhibit NLR-mediated NLR. Moro The resulting reactive oxygen species and cell necrosis.

[0066] Pst13248 was ligated to the SpeI restriction site in the pBinGFP2.0 vector using a one-step cloning technique. A SpeI recognition sequence and three consecutive HA tag sequences were inserted after GFP into the pBinGFP2.0 vector backbone. GFP was then excised using SpeI, and NLR was added using a one-step cloning technique. Moro The gene is ligated into the vector (pBinGFP2.0 vector backbone sequence SEQ ID No. 5, NLR). Moro The sequence is shown in SEQ ID No. 6, and the sequence of 3HA is shown in SEQ ID No. 7.

[0067] The pBinGFP2.0 sequence is shown in SEQ ID No. 5:

[0068] tgagcgtcgcaaaggcgctcggtcttgccttgctcgtcggtgatgtacttcaccagctccgcgaagtcgctcttcttgatggagcgcatggggac

[0069] gtgcttggcaatcacgcgcaccccccggccgttttagcggctaaaaaagtcatggctctgccctcgggcggaccacgcccatcatgaccttgcc

[0070] aagctcgtcctgcttctcttcgatcttcgccagcagggcgaggatcgtggcatcaccgaaccgcgccgtgcgcgggtcgtcggtgagccagag

[0071] tttcagcaggccgcccaggcggcccaggtcgccattgatgcgggccagctcgcggacgtgctcatagtccacgacgcccgtgattttgtagcc

[0072] ctggccgacggccagcaggtaggccgacaggctcatgccggccgccgccgccttttcctcaatcgctcttcgttcgtctggaaggcagtacac

[0073] cttgataggtgggctgcccttcctggttggcttggtttcatcagccatccgcttgccctcatctgttacgccggcggtagccggccagcctcgcag

[0074] agcaggattcccgttgagcaccgccaggtgcgaataagggacagtgaagaaggaacacccgctcgcgggtgggcctacttcacctatcctgc

[0075] ccggctgacgccgttggatacaccaaggaaagtctacacgaaccctttggcaaaatcctgtatatcgtgcgaaaaaggatggatataccgaaaa

[0076] aatcgctataatgaccccgaagcagggttatgcagcggaaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcgg

[0077] cagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttga

[0078] gcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggcctttttacggttcctggccttttgctggcctttt

[0079] gctcacatgttctttcctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccg

[0080] agcgcagcgagtcagtgagcgaggaagcggaagagcgccagaaggccgccagagaggccgagcgcggccgtgaggcttggacgctag

[0081] ggcagggcatgaaaaagcccgtagcgggctgctacgggcgtctgacgcggtggaaagggggaggggatgttgtctacatggctctgctgta

[0082] gtgagtgggttgcgctccggcagcggtcctgatcaatcgtcaccctttctcggtccttcaacgttcctgacaacgagcctccttttcgccaatccat

[0083] cgacaatcaccgcgagtccctgctcgaacgctgcgtccggaccggcttcgtcgaaggcgtctatcgcggcccgcaacagcggcgagagcgg

[0084] agcctgttcaacggtgccgccgcgctcgccggcatcgctgtcgccggcctgctcctcaagcacggccccaacagtgaagtagctgattgtcat

[0085] cagcgcattgacggcgtccccggccgaaaaacccgcctcgcagaggaagcgaagctgcgcgtcggccgtttccatctgcggtgcgcccggt

[0086] cgcgtgccggcatggatgcgcgcgccatcgcggtaggcgagcagcgcctgcctgaagctgcgggcattcccgatcagaaatgagcgccagt

[0087] cgtcgtcggctctcggcaccgaatgcgtatgattctccgccagcatggcttcggccagtgcgtcgagcagcgcccgcttgttcctgaagtgcca

[0088] gtaaagcgccggctgctgaacccccaaccgttccgccagtttgcgtgtcgtcagaccgtctacgccgacctcgttcaacaggtccagggcggc

[0089] acggatcactgtattcggctgcaactttgtcatgcttgacactttatcactgataaacataatatgtccaccaacttatcagtgataaagaatccgcgc

[0090] gttcaatcggaccagcggaggctggtccggaggccagacgtgaaacccaacatacccctgatcgtaattctgagcactgtcgcgctcgacgct

[0091] gtcggcatcggcctgattatgccggtgctgccgggcctcctgcgcgatctggttcactcgaacgacgtcaccgcccactatggcattctgctggc

[0092] gctgtatgcgttggtgcaatttgcctgcgcacctgtgctgggcgcgctgtcggatcgtttcgggcggcggccaatcttgctcgtctcgctggccg

[0093] gcgccagatctggggaaccctgtggttggcatgcacatacaaatggacgaacggataaaccttttcacgcccttttaaatatccgattattctaata

[0094] aacgctcttttctcttaggtttacccgccaatatatcctgtcaaacactgatagtttgtgaaccatcacccaaatcaagttttttggggtcgaggtgccg

[0095] taaagcactaaatcggaaccctaaagggagcccccgatttagagcttgacggggaaagccggcgaacgtggcgagaaaggaagggaagaa

[0096] agcgaaaggagcgggcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagg

[0097] gggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgaattgttaattaagaattc

[0098] gagctccttgcatgcctgcaggtcaacatggtggagcacgacacacttgtctactccaaaaatatcaaagatacagtctcagaagaccaaaggg

[0099] caattgagacttttcaacaaagggtaatatccggaaacctcctcggattccattgcccagctatctgtcactttattgtgaagatagtggaaaaggaa

[0100] ggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaagatgcctctgccgacagtggtcccaaagatggacccccaccc

[0101] acgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagcaagtggattgatgtgataacatggtggagcacgacacacttgtct

[0102] actccaaaaatatcaaagatacagtctcagaagaccaaagggcaattgagacttttcaacaaagggtaatatccggaaacctcctcggattccatt

[0103] gcccagctatctgtcactttattgtgaagatagtggaaaaggaaggtggctcctacaaatgccatcattgcgataaaggaaaggccatcgttgaa

[0104] gatgcctctgccgacagtggtcccaaagatggacccccacccacgaggagcatcgtggaaaaagaagacgttccaaccacgtcttcaaagca

[0105] agtggattgatgtgatatctccactgacgtaagggatgacgcacaatcccactatccttcgcaagacccttcctctatataaggaagttcatttcattt

[0106] ggagaggacctcgagaattctcaacacaacatatacaaaacaaacgaatctcaagcaatcaagcattctacttctattgcagcaatttaaatcattt

[0107] cttttaaagcaaaagcaattttctgaaaattttcaccatttacgaacgatagactagtcccatggtgagcaagggcgaggagctgttcaccggggt

[0108] ggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaa

[0109] gctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcag

[0110] ccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacga

[0111] cggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggagga

[0112] cggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtga

[0113] acttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgct

[0114] gctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtga

[0115] ccgccgccgggatcactctcggcatggacgagctgtacaagggtacccccggggtcgacggatcctctagatgaactagagtccgcaaaaat

[0116] caccagtctctctctacaaatctatctctctctatttttctccagaataatgtgtgagtagttcccagataagggaattagggttcttatagggtttcgctc

[0117] atgtgttgagcatataagaaacccttagtatgtatttgtatttgtaaaatacttctatcaataaaatttctaattcctaaaaccaaaatccagtgacaagct

[0118] tggcgcgccagcttggcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataa

[0119] agtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagc

[0120] tgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggccaaagacaaaagggcgacattcaaccgattgaggggaggga

[0121] aggtaaatattgacggaaattattcattaaaggtgaattatcaccgtcaccgacttgagccatttgggaattagagccagcaaaatcaccagtagc

[0122] accattaccattagcaaggccggaaacgtcaccaatgaaaccatcgatagcagcaccgtaatcagtagcgacagaatcaagtttgcctttagcgt

[0123] cagactgtagcgcgttttcatcggcattttcggtcatagcccccttattagcgtttgccatcttttcataatcaaaatcaccggaaccagagccacca

[0124] ccggaaccgcctccctcagagccgccaccctcagaaccgccaccctcagagccaccaccctcagagccgccaccagaaccaccaccagag

[0125] ccgccgccagcattgacaggaggcccgatctagtaacatagatgacaccgcgcgcgataatttatcctagtttgcgcgctatattttgttttctatcg

[0126] cgtattaaatgtataattgcgggactctaatcataaaaacccatctcataaataacgtcatgcattacatgttaattattacatgcttaacgtaattcaac

[0127] agaaattatatgataatcatcgcaagaccggcaacaggattcaatcttaagaaactttattgccaaatgtttgaacgatcggggatcatccgggtct

[0128] gtggcgggaactccacgaaaatatccgaacgcagcaagatatcgcggtgcatctcggtcttgcctgggcagtcgccgccgacgccgttgatgt

[0129] ggacgccgggcccgatcatattgtcgctcaggatcgtggcgttgtgcttgtcggccgttgctgtcgtaatgatatcggcaccttcgaccgcctgtt

[0130] ccgcagagatcccgtgggcgaagaactccagcatgagatccccgcgctggaggatcatccagccggcgtcccggaaaacgattccgaagcc

[0131] caacctttcatagaaggcggcggtggaatcgaaatctcgtgatggcaggttgggcgtcgcttggtcggtcatttcgaaccccagagtcccgctca

[0132] gaaactcgtcaagaaggcgatagaaggcgatgcgctgcgaatcgggagcgggataccgtaaagcacgagaagcggtcagcccattc

[0133] gccgccaagctcttcagcaatatcacgggtagccaacgctatgtcctgatagcggtccggccacaccagccggccacagtcgatgaatccaga

[0134] aaagcggccattttccaccatgatattcggcaagcaggcatcgccatgggtcacgacgagatcatcgccgtcgggcatgcgcgccttgagcct

[0135] ggcgaacagttcggctggcgcgagcccctgatgctcttcgtccagatcatcctgatcgacaagaccggcttccatccgagtacgtgctcgctcg

[0136] atgcgatgtttcgcttggtggtcgaatgggcaggtagccggatcaagcgtatgcagccgccgcattgcatcagccatgatggatactttctcggc

[0137] aggagcaaggtgagatgacaggagatcctgccccggcacttcgcccaatagcagccagtcccttcccgcttcagtgacaacgtcgagcacag

[0138] ctgcgcaaggaacgccccgtcgtggccagccacgatagccgcgctgcctcgtcctgcagttcattcagggcaccggacaggtcggtcttgaca

[0139] aaaagaaccgggcgcccctgcgctgacagccggaacacggcggcatcagagcagccgattgtctgttgtgcccagtcatagccgaatagcct

[0140] ctccacccaagcggccggagaacctgcgtgcaatccatcttgttcaatcatgcgaaacgatccagatccggtgcagattatttggattgagagtg

[0141] aatatgagactctaattggataccgaggggaatttatggaacgtcagtggagcatttttgacaagaaatatttgctagctgatagtgaccttaggcg

[0142] acttttgaacgcgcaataatggtttctgacgtatgtgcttagctcattaaactccagaaacccgcggctgagtggctccttcaacgttgcggttctgt

[0143] cagttccaaacgtaaaacggcttgtcccgcgtcatcggcgggggtcataacgtgactcccttaattctccgctcatgatcagattgtcgtttcccgc

[0144] cttcagtttgtgggccatcgccctgatagacggtttttcgccctttgacgttggagtccacgttctttaatagtggactcttgttccaaactggaacaa

[0145] cactcaaccctatctcgggctattcttttgatttataagggattttgccgatttcggaaccaccatcaaacaggattttcgcctgctggggcaaacca

[0146] gcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccccag

[0147] tacattaaaaacgtccgcaatgtgttattaagttgtctaagcgtcaatttgtttacaccacaatatatcctgccaccagccagccaacagctccccga

[0148] ccggcagctcggcacaaaatcaccactcgatacaggcagcccatcagtccgggacggcgtcagcgggagagccgttgtaaggcggcagac

[0149] tttgctcatgttaccgatgctattcggaagaacggcaactaagctgccgggtttgaaacacggatgatctcgcggagggtagcatgttgattgtaa

[0150] cgatgacagagcgttgctgcctgtgatcaaatatcatctccctcgcagagatccgaattatcagccttcttattcatttctcgcttaaccgtgacagg

[0151] ctgtcgatcttgagaactatgccgacataataggaaatcgctggataaagccgctgaggaagctgagtggcgctatttctttagaagtgaacgttg

[0152] acgatatcaactcccctatccattgctcaccgaatggtacaggtcggggacccgaagttccgactgtcggcctgatgcatccccggctgatcgac

[0153] cccagatctggggctgagaaagcccagtaaggaaacaactgtaggttcgagtcgcgagatcccccggaaccaaaggaagtaggttaaaccc

[0154] gctccgatcaggccgagccacgccaggccgagaacattggttcctgtaggcatcgggattggcggatcaaacactaaagctactggaacgag

[0155] cagaagtcctccggccgccagttgccaggcggtaaaggtgagcagaggcacgggaggttgccacttgcgggtcagcacggttccgaacgcc

[0156] atggaaaccgcccccgccaggcccgctgcgacgccgacaggatctagcgctgcgtttggtgtcaacaccaacagcgccacgcccgcagttc

[0157] cgcaaatagcccccaggaccgccatcaatcgtatcgggctacctagcagagcggcagagatgaacacgaccatcagcggctgcacagcgcc

[0158] taccgtcgccgcgaccccgcccggcaggcggtagaccgaaataaacaacaagctccagaatagcgaaatattaagtgcgccgaggatgaag

[0159] atgcgcatccaccagattcccgttggaatctgtcggacgatcatcacgagcaataaacccgccggcaacgcccgcagcagcataccggcgac

[0160] ccctcggcctcgctgttcgggctccacgaaaacgccggacagatgcgccttgtgagcgtccttggggccgtcctcctgtttgaagaccgacagc

[0161] ccaatgatctcgccgtcgatgtaggcgccgaatgccacggcatctcgcaaccgttcagcgaacgcctccatgggctttttctcctcgtgctcgtaa

[0162] acggacccgaacatctctggagctttcttcagggccgacaatcggatctcgcggaaatcctgcacgtcggccgctccaagccgtcgaatctgag

[0163] ccttaatcacaattgtcaattttaatcctctgtttatcggcagttcgtagagcgcgccgtgcgtcccgagcgatactgagcgaagcaagtgcgtcga

[0164] gcagtgcccgcttgttcctgaaatgccagtaaagcgctggctgctgaacccccagccggaactgaccccacaaggccctagcgtttgcaatgc

[0165] accaggtcatcattgacccaggcgtgttccaccaggccgctgcctcgcaactcttcgcaggcttcgccgacctgctcgcgccacttcttcacgcg

[0166] ggtggaatccgatccgcacatgaggcggaaggtttccagcttgagcgggtacggctcccggtgcgagctgaaatagtcgaacatccgtcggg

[0167] ccgtcggcgacagcttgcggtacttctcccatatgaatttcgtgtagtggtcgccagcaaacagcacgacgatttcctcgtcgatcaggacctgg

[0168] caacgggacgttttcttgccacggtccaggacgcggaagcggtgcagcagcgacaccgattccaggtgcccaacgcggtcggacgtgaagc

[0169] ccatcgccgtcgcctgtaggcgcgacaggcattcctcggccttcgtgtaataccggccattgatcgaccagcccaggtcctggcaaagctcgta

[0170] gaacgtgaaggtgatcggctcgccgataggggtgcgcttcgcgtactccaacacctgctgccacaccagttcgtcatcgtcggcccgcagctc

[0171] gacgccggtgtaggtgatcttcacgtccttgttgacgtggaaaatgaccttgttttgcagcgcctcgcgcgggattttcttgttgcgcgtggtgaac

[0172] agggcagagcgggccgtgtcgtttggcatcgctcgcatcgtgtccggccacggcgcaatatcgaacaaggaaagctgcatttccttgatctgct

[0173] gcttcgtgtgtttcagcaacgcggcctgcttggcctcgctgacctgttttgccaggtcctcgccggcggtttttcgcttcttggtcgtcatagttcctc

[0174] gcgtgtcgatggtcatcgacttcgccaaacctgccgcctcctgttcgagacgacgcgaacgctccacggcggccgatggcgcgggcagggc

[0175] agggggagccagttgcacgctgtcgcgctcgatcttggccgtagcttgctggaccatcgagccgacggactggaaggtttcgcggggcgcac

[0176] gcatgacggtgcggcttgcgatggtttcggcatcctcggcggaaaaccccgcgtcgatcagttcttgcctgtatgccttccggtcaaacgtccga

[0177] ttcattcaccctccttgcgggattgccccgactcacgccggggcaatgtgcccttattcctgatttgacccgcctggtgccttggtgtccagataatc

[0178] caccttatcggcaatgaagtcggtcccgtagaccgtctggccgtccttctcgtacttggtattccgaatcttgccctgcacgaataccagcgaccc

[0179] cttgcccaaatacttgccgtgggcctcggcctgagagccaaaacacttgatgcggaagaagtcggtgcgctcctgcttgtcgccggcatcgttg

[0180] cgccacatctaggtactaaaacaattcatccagtaaaatataatattttattttctcccaatcaggcttgatccccagtaagtcaaaaaatagctcgac

[0181] atactgttcttccccgatatcctccctgatcgaccggacgcagaaggcaatgtcataccacttgtccgccctgccgcttctcccaagatcaataaa

[0182] gccacttactttgccatctttcacaaagatgttgctgtctcccaggtcgccgtgggaaaagacaagttcctcttcgggcttttccgtctttaaaaaatc

[0183] atacagctcgcgcggatctttaaatggagtgtcttcttcccagttttcgcaatccacatcggccagatcgttattcagtaagtaatccaattcggctaa

[0184] gcggctgtctaagctattcgtatagggacaatccgatatgtcgatggagtgaaagagcctgatgcactccgcatacagctcgataatcttttcagg

[0185] gctttgttcatcttcatactcttccgagcaaaggacgccatcggcctcactcatgagcagattgctccagccatcatgccgttcaaagtgcaggac

[0186] ctttggaacaggcagctttccttccagccatagcatcatgtccttttcccgttccacatcataggtggtccctttataccggctgtccgtcatttttaaat

[0187] ataggttttcattttctcccaccagcttatataccttagcaggagacattccttccgtatcttttacgcagcggtatttttcgatcagttttttcaattccggt

[0188] gatattctcattttagccatttattatttccttcctcttttctacagtatttaaagataccccaagaagctaattataacaagacgaactccaattcactgtt

[0189] ccttgcattctaaaaccttaaataccagaaaacagctttttcaaagttgttttcaaagttggcgtataacatagtatcgacggagccgattttgaaacc

[0190] acaattatgggtgatgctgccaacttactgatttagtgtatgatggtgtttttgaggtgctccagtggcttctgtgtctatcagctgtccctcctgttcag

[0191] ctactgacggggtggtgcgtaacggcaaaagcaccgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaactgcagttcac

[0192] ttacaccgcttctcaacccggtacgcaccagaaaatcattgatatggccatgaatggcgttggatgccgggcaacagcccgcattatgggcgttg

[0193] gcctcaacacgattttacgtcacttaaaaaactcaggccgcagtcggtaacctgctgccagtggcgataagtcgtgtcttaccgggttggactcaa

[0194] gacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccagcttggagcgaacgacctacaccgaact

[0195] gagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcggacaggtatccggtaagcggcagggtcggaac

[0196] aggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtcctgtcgggtttcgccacctctgacttgagcgtcgattttgtg

[0197] atgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcggccttttacggttcctggccttttgctggccttttgctcacatgttcttt

[0198] cctgcgttatcccctgattctgtggataaccgtattaccgcctttgagtgagctgataccgctcgccgcagccgaacgaccgagcgcagcgagtc

[0199] agtgagcgaggaagcggaagagcgcctgatgcggtatttctccttacgcatctgtgcggtatttcacaccgcatagtaacctcgcgcatacagc

[0200] cgggcagtgacgtcatcgtctgcgcggaaatggacgaacagtggggctatgtcggggctaaatcgcgccagcgctgctgttttacgcgtatg

[0201] acagtctccggaagacggttgttgcgcacgtattcggtgaacgcactatggcgacgctggggcgtcttatgagcctgctgtcaccctttgacgtg

[0202] gtgatatggatgacggatggctggccgctgtatgaatcccgcctgaagggaaagctgcacgtaatcagcaagcgatatacgcagcgaattgag

[0203] cggcataacctgaatctgaggcagcacctggcacgggctgggacggaagtcgctgtcgttctcaaaatcggtggagctgcatgacaaagtcatc

[0204] gggcattatctgaacataaaacactatcaataagttggagtcattacccaattatgatagaatttacaagctataaggttattgtcctgggtttcaagc

[0205] attagtccatgcaagtttttatgctttgcccattctatagatatattgataagcgcgctgcctatgccttgccccctgaaatccttacatacggcgatatc

[0206] ttctatataaaagatatattatcttatcagtattgtcaatatattcaaggcaatctgcctcctcatcctcttcatcctcttcgtcttggtagctttttaaatatg

[0207] gcgcttcatagagtaattctgtaaaggtccaattctcgttttcatacctcggtataatcttacctatcacctcaaatggttcgctgggtttatcgcacccc

[0208] cgaacacgagcacggcacccgcgaccactatgccaagaatgcccaaggtaaaaattgccggccccgccatgaagtccgtgaatgccccgac

[0209] ggccgaagtgaagggcaggccgccacccaggccgccgccctcactgcccggcacctggtcgctgaatgtcgatgccagcacctgcggcac

[0210] gtcaatgcttccgggcgtcgcgctcgggctgatcgcccatcccgttactgccccgatcccggcaatggcaaggactgccagcgctgccattttt

[0211] ggggtgaggccgttcgcggccgaggggcgcagcccctggggggatgggaggcccgcgttagcgggccgggagggttcgagaaggggg

[0212] ggcaccccccttcggcgtgcgcggtcacgcgcacagggcgcagccctggttaaaaacaaggtttataaatattggtttaaaagcaggttaaaag

[0213] acaggttagcggtggccgaaaaacgggcggaaacccttgcaaatgctggattttctgcctgtggacagcccctcaaatgtcaataggtgcgccc

[0214] ctcatctgtcagcactctgcccctcaagtgtcaaggatcgcgcccctcatctgtcagtagtcgcgcccctcaagtgtcaataccgcagggcactta

[0215] tccccaggcttgtccacatcatctgtgggaaactcgcgtaaaatcaggcgttttcgccgatttgcgaggctggccagctccacgtcgccggccga

[0216] aatcgagcctgcccctcatctgtcaacgccgcgccgggtgagtcggcccctcaagtgtcaacgtccgcccctcatctgtcagtgagggccaagt​​​​​​​​​​​​​​​​tgagatcaagttcctcaaagcagagctggagagcatggaggctgccctcatcaagatctcggaggcacccttggatcagccacctaacattcag

[0222] gtcaagctctgggcgagggacgtcaaggacctgtcctatgagatcgaagatggcatcgacaaattccgggtgcaccttgagtgccggcaacaa

[0223] aagaagccacacagctttatgggtttcatccacaaaagcatggacatgctgacaaagggcaagatccgacacaaaataggcatcgatatcaaa

[0224] gacatcaagagccgcatcaaggaggtcagtgacaggcgtgaaaggtacaaggttgatagcgttgcgcccaagcccaccggcacaagtactg

[0225] atacacttcgccagttagccttgttcaaaaaggcggaagagcttattggcaccaaagaaaagagccttgacatagtcaagatgctgacggaagg

[0226] agatgaggtcttcaagaaacatcttaagatggtctctattgttggctttggaggcttagggaagacaactcttgctaacgtggtatatgagaagcttc

[0227] gcggggactttgattgtgcagcttttgtctctgtgtctcttaatcctgacatgaagaagcttttcaagtgtttgctccatcagcttgacaagggcgagt

[0228] acaagaacatcatggacgagtcagcgtggagcgaaacacaactcataagtgagataagagatttccttcgagacaagaggtacttcattctcatt

[0229] gatgadataggataaatctgtgtggaataatattagatgtgctctgattgagaatgaatgtggtagtagagtaatcgcaacaactcgcattctaga

[0230] tgttgccaaagaagttggtggtgtttatcagcttaaacctctttctactagtgactcaagacaattattctatcaaagaatatttggaattggcgacaag

[0231] cgtcctcctattcagttggctgaagtaagtgagaaaattttagggaaatgtggcggagtaccattagctatcattacactggctagtatgttggctgg

[0232] taaaaaggaacatgaaaatadataacttattggtacaaggtgtaccaatctatgggttctgggctagaaaataatcctggcctgatggacatgag

[0233] gaggatactacatgtcagttactatgacctacctccaaatctgaagacttgtttactgtatctcagtttgtatccagaggattataatattgaaaccaaa

[0234] gagttgatatggaaatggataggcgaaggattcattcatgaagagcaagggaagagcttgtatgaagtaggagaggattacattgctgagctcat

[0235] taacaaaagcttggtccaaccaatgtatatcaatattgctaataaggcgagctctgtccgtgtacacgacatggtgcttgaccttatcacttccttgtc

[0236] aaatgaggagaactttctcgcaacattgggtggtcagcagaccaggtcactgccaagtaagatccgtcgactgtctctccaaagcagtaatgaa

[0237] gaggatgtccagccaatgccaaccatgagcagcttgtcccatgtgaggtcacttactgtgttcagtaaagacctcagtttgctgtcggcactttcag

[0238] gttttcttgtcctgcgtgcattggatttaagtggttgtgaggaagtgggtaatcatcacatgaaggacatttgcaatttatttcacttgaggtatctgagt

[0239] ctagaagggacatctatcactgagatcccgaaagagataagcaatctacggcttctgcaattgctagtcataaggtccacaaaaatgaaaaaattt

[0240] ccatcaacctttgttcagctaggacaactggtgttcattgacatgggtaatagggaagtctctagattgcttctaaaatcaatgtccaccttgccctcc

[0241] ctctcttcacttgcaatcggaataggagaactgagagaggaagacctccaaatacttgggagcatgccgtctctgcatgacctctctattgatgta

[0242] ggttattgggaaagaggcagagataaaaggctagtcattgacagtggttctcccttccggtctctgacaaggttcagtataaagggttgcggcttc

[0243] attgatttcatgtttgcacaaggaaccttgcaaaagctccagatcctggagttaagtatttttggtaaggcaataaaagacagatttggtgattttcaat

[0244] ttgggctggagaatctctcatcacttgagcatgtctatgtggacgctcgtggtcgtggtataatcccaagtcaagaagctgagctgagcggtgcac

[0245] ttgagaaagagcttgatattaatcccaacaagcccacactgacggtgaaggtgggcagctggtctagggacttgaactcggtgctacatattcggtgggttggaccacgagagctgtccatagaggaataa.

[0246] SEQ ID No. 7:

[0247] tacccatacgatgttcctgactatgccgagtatccatatgacgttccagattacgctgtctacccatacgatgttccagattacgct.

[0248] The above vector was transformed into Agrobacterium EHA105 (pSoup). The transformation procedure was followed according to the instruction manual. After transformation, single clones were picked and colony transformation plasmids were detected using primers 35S-F and M13-R (SEQ ID No. 8 and SEQ ID No. 9).

[0249] SEQ ID No.8: 5'-TGACGCACAATCCCACTATC-3';

[0250] SEQ ID No. 9: 5'-CAGGAAACAGCTATGAC-3'.

[0251] Positive clones were picked in a clean bench and placed in 10 mL of sterile LB broth containing an appropriate concentration of Rif+Kan resistance. The culture was then incubated at 28°C with a shaker at 220 rpm for 1–3 days. Agrobacterium activation was then performed using the following method:

[0252] 1) Centrifuge the cultured Agrobacterium tumefaciens solution at 4000-5000 rpm for 4-5 minutes;

[0253] 2) Discard the supernatant, add 5-8 mL of sterile 10 mM MgCl2 solution, mix well by pipetting, and centrifuge at 4000-5000 rpm for 4-5 min. Repeat this step 3 times.

[0254] 3) Discard the supernatant, add an appropriate amount of sterile As buffer solution (1 mL 1M MgCl2, 2 mL 0.5M MES, 20 μL 0.1MAS, and bring the volume to 100 mL with sterile water), mix well by pipetting, measure the OD600 of the bacterial culture using a Nanodrop 2000 UV spectrophotometer, dilute the OD600 to 0.6 with As buffer, and store in the dark for 40 min to 1 h.

[0255] Select healthy, mature *Nicotiana benthamiana* (generally about 5-6 weeks old). Gently puncture a small hole on the underside of a leaf using a needle, being careful not to pierce the leaf. Draw a syringe into a well-mixed solution of activated *Agrobacterium*, gently press the syringe nozzle against the punctured hole, and slowly inject the solution until it spreads between the leaf blades, avoiding the veins as much as possible. When injecting different solutions into a single leaf, prevent overlapping of injection areas by marking the injection areas with a marker. Return the tobacco to the cultivation area for further culture. When injecting two solutions into the same location, inject one solution first, and then inject the other solution at the same location 24 hours later.

[0256] 48 h after infection, infected leaves were taken and photographed for macroscopic phenotype. Then, DAB (3,3'-Diaminobenzidine tetrahydrochloride) was used to stain the infected area for H2O2. 120 h after infection, infected leaves were taken and photographed for macroscopic phenotype. Then, trypan blue staining solution was used to stain the infected area for cell necrosis.

[0257] DAB staining procedure: 1) Immerse the leaves in a 1 mg / mL DAB (pH 3.6-3.8) staining solution and use a vacuum pump to aspirate for 10-15 minutes to accelerate the binding of the staining solution;

[0258] 2) Soak in the dark for 12 hours, and after the staining is complete, use anhydrous ethanol in a boiling water bath for 10 minutes;

[0259] 3) Soak the leaves in anhydrous ethanol until they are bleached and decolorized, then place them in 75% ethanol or water for photographing.

[0260] Trypan blue staining procedure: 1) Immerse the leaves in trypan blue staining solution and boil in water for 10 minutes until the leaves turn blue;

[0261] 2) Soak for 12 hours, then rinse with clean water to remove excess trypan blue staining solution;

[0262] 3) Add chloral hydrate solution to decolorize until the tissue is bleached, changing the chloral hydrate solution several times during the process, and take pictures in clean water.

[0263] In order to quantitatively detect the H2O2 content, the H2O2 content was quantitatively detected using the Solarbio Hydrogen Peroxide Content Detection Kit (CAT: BC3595). The specific method is described in the instruction manual.

[0264] When the structure of a plant protoplast is affected, its permeability changes, causing organic matter and salts to seep out of the cells. The degree of cell damage can be reflected by measuring electrical conductivity, quantifying the extent of plant cell death. The method is as follows:

[0265] 1) At the appropriate time, use a punch to punch 6 leaf discs at the sampling location, completely immerse them in 4 mL of sterile deionized water for 5-6 hours, and take 6 biological replicates for each combination.

[0266] 2) Use a conductivity meter to measure the conductivity C1 of the sample solution, boil in a water bath for 5 minutes, let it cool to room temperature, and then use the conductivity meter again to measure the conductivity C2 of the sample solution.

[0267] 3) Calculation results. Electrolyte extravasation rate = C1 / C2 × 100%.

[0268] To verify whether the protein was expressed in tobacco leaves, Western blot analysis was performed using GFP and HA tags, as follows:

[0269] 1) Cut off leaves infected with Agrobacterium at the appropriate time, wrap them in aluminum foil and flash freeze them with liquid nitrogen;

[0270] 2) Prepare a sterilized mortar in advance and freeze it in liquid nitrogen. Take out the leaves and pour them into the mortar containing liquid nitrogen. Grind the leaves thoroughly at low temperature until they are powdery (the main vein of the leaves can be removed).

[0271] 3) Mix the ground leaf with 1 mL of cell lysis buffer (Western and IP cell lysis buffer, Beyotime) [add 10 μL of phenylmethylsulfonyl fluoride (PMSF) protease inhibitor (100 mM)] in a 2 mL centrifuge tube by vortexing. PMSF should not be added in advance.

[0272] 4) Incubate at 4℃ with rotation for 30 minutes;

[0273] 5) Centrifuge at 4℃, 10000~12000rpm for 10~15min to centrifuge the precipitate as thoroughly as possible;

[0274] 6) Transfer the supernatant to a new centrifuge tube on ice using a pipette, discard the precipitate, and repeat the centrifugation once more;

[0275] 7) Take an appropriate amount of supernatant and add it to SDS-PAGE protein loading buffer (5×) (Beyotime) according to the ratio. Boil in water for 10 min and store at -20℃ or use protein marker as a control for SDS-polyacrylamide (SDS-PAGE) gel electrophoresis.

[0276] After electrophoresis, the gel is used to determine the location of the target protein based on the protein marker. The protein at the corresponding location is then cut out for Western blot protein detection.

[0277] To demonstrate that this inhibitory effect is related to the disease resistance process, the expression levels of tobacco disease progression-related genes NbPRs were detected using the following method:

[0278] Approximately 100 mg of tobacco leaves infected with Agrobacterium tumefaciens for 120 hours were selected. RNA was extracted using the Huayueyang Rapid Universal Plant RNA Extraction Kit 3.0 (CAT: 0416-50GK). The RNA was then reverse transcribed into cDNA using a cDNA analyzer from Novizan Biotechnology Co., Ltd. IIQ RT SuperMix for qPCR (CAT: R223) was used, and the extraction method followed the company's instructions. Quantitative primers were designed using PrimerPremier5 to detect the expression levels of tobacco disease-related genes NbPR1, NbPR2, and NbPR4. The primer sequences are shown in SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15. The relative expression levels of tobacco disease-related genes were detected using real-time PCR. The tobacco gene NbActin (actin) was selected as the internal control gene, with sequences shown in SEQ ID No. 16 and SEQ ID No. 17. The expression levels of both the internal control and the gene were simultaneously detected in each cDNA sample, using 2... –ΔΔCt Calculation by method.

[0279] NbPR1-F (SEQ ID No. 10): 5'-CCGCCTTCCCTCAACTCAAC-3';

[0280] NbPR1-R (SEQ ID No. 11): 5'-GCACAACCAAGACGTACTGAG-3';

[0281] NbPR2-F (SEQ ID No. 12): 5'-AGGTGTTTGCTATGGAATGC-3';

[0282] NbPR2-R (SEQ ID No. 13): 5'-TCTGTACCCACCATCTTGC-3';

[0283] NbPR4-F (SEQ ID No. 14): 5'-GGCCAAGATTCCTGTGGTAGAT-3';

[0284] NbPR4-R (SEQ ID No. 15): 5'-CACTGTTGTTTGAGTTCCTGTTCCT-3';

[0285] NbActin-F (SEQ ID No. 16): 5'-TGGTCGTACCACCGGTATTGTGTT-3';

[0286] NbActin-R (SEQ ID No. 17): 5'-TCACTTGCCCATCAGGAAGCTCAT-3';

[0287] The results are as follows Figures 1-4 As shown, transient overexpression of Pst13248 and NLR in Nicotiana benthamiana. Moro Protein, discovered NLR Moro The protein can induce cell necrosis; Pst13248 (carrying a GFP tag) and NLR Moro The reduced degree of cell necrosis after co-expression indicates that Pst13248 can inhibit NLR-mediated cell death. Moro Protein-induced cell necrosis ( Figure 1 (A and C in the text), and Pst13248 can suppress NLR. Moro Induced accumulation of reactive oxygen species (ROS) Figure 1 (A and B in the text). Western blot analysis showed that all proteins were expressed normally. Figure 1 (A) Tobacco-related genes NbPR1, NbPR2, and NbPR4 in Pst13248 and NLR Moro The expression levels were significantly downregulated during co-expression. Figure 2 This indicates that this inhibitory effect is related to plant disease resistance.

[0288] Example 3

[0289] The Pst13248 described in Example 1 of wheat silencing method can enhance wheat's resistance to stripe rust.

[0290] The nucleotide sequence of the selected silencing fragment design site (SEQ ID No. 2) was cloned using Gateway cloning technology and ligated using the Gateway Reaction Ligation Kit (Gateway). TM BP Clonase TM II & Gateway TM LR Clonase TM II. Invitrogen) was used to insert the recombinant RNAi transgenic vector into the intermediate vector pDONR221 and the final vector pC336. The target gene fragment was amplified using SEQ ID No. 18 and SEQ ID No. 19, and then inserted into the intermediate vector pDONR221 via a BP reaction. After successful construction, it was inserted into the final vector pC336 via an LR reaction. Detection was performed using SEQ ID No. 20 and SEQ ID No. 21, and positive plaques were selected and tested using SEQ ID No. 22 and SEQ ID No. 23, confirming the successful construction of the recombinant RNAi transgenic vector.

[0291] SEQ ID No. 18: 5'-ggggacaagtttgtacaaaaaagcaggcttcgcctcaaccaacaagcat-3';

[0292] SEQ ID No.19:ggggaccactttgtacaagaaagctgggtcaaaggttcaaggggcca;

[0293] SEQ ID No.20: 5'-TTTAGCCCTGCCTTTCATACG-3';

[0294] SEQ ID No.20: 5'-TTTAGCCCTGCCTTTCATACG-3';

[0295] SEQ ID No. 21: 5'-CACGCAAGTCCGCATCTTCA-3';

[0296] SEQ ID No.22: 5'-TTTTAGCCCTGCCTTTCATACGCT-3';

[0297] SEQ ID No.23: 5'-GACCTCGCAAGGCATATTG-3';

[0298] After successful detection, Agrobacterium EHA105 was transformed, and positive plaques were selected to transform Fielder wheat embryos to create transgenic materials. DNA was extracted from the transformed wheat and positive transgenic lines were detected using primers SEQ ID No. 24, SEQ ID No. 18 and primers SEQ ID No. 25, SEQ ID No. 19.

[0299] SEQ ID No.24: 5'-TTTTAGCCCTGCCTTTCATACGCT-3';

[0300] SEQ ID No.25: 5'-GACCTCGCAAGGCATATTG-3';

[0301] Relative expression levels can intuitively reflect the degree of silencing of the Pst13248 gene in Pst13248-RNAi materials. The specific method is as follows:

[0302] Approximately 100 mg of wheat leaves at the two-leaf-one-heart stage before stripe rust inoculation were collected. RNA was extracted using the Huayueyang Rapid Universal Plant RNA Extraction Kit 3.0 (CAT: 0416-50GK). The RNA was further reverse transcribed into cDNA using a cDNA analyzer from Novizan Biotechnology Co., Ltd. IIQ RT SuperMix for qPCR (CAT: R223) was used, and the extraction method followed the company's instructions. Quantitative primers were designed using Primer Premier5, sequences of which are SEQ ID No. 26 and SEQ ID No. 27. The relative expression level of the Pst13248 gene was detected using real-time PCR, with the wheat gene NACT (actin) selected as the internal control gene, sequences of which are SEQ ID No. 28 and SEQ ID No. 29. The expression levels of both the internal control and the gene were simultaneously detected in each cDNA sample, using 2... –ΔΔCt The gene silencing efficiency was calculated by comparing the relative expression levels of the two methods with those of Fielder.

[0303] SEQ ID No.26: 5'-GCCAACCCGATAACCAACAA-3';

[0304] SEQ ID No. 27: 5'-TGACGATTAGCACAGAAGACCAA-3';

[0305] SEQ ID No.28: 5'-GTTCTACAACGAGCTCCGTGTC-3';

[0306] SEQ ID No. 29: 5'-GACATACATTGCTGGGCAAC-3'.

[0307] This invention further identified the phenotype of RNAi transgenic wheat, determined the phenotypic changes of Pst13248-RNAi compared to Fielder at 14 days post-contraction (dpi), and calculated the biomass on leaves. Biomass can visually reflect the infection status of the pathogen within the host by providing data. The relative DNA content of the pathogen and the host reflects the infection status of the pathogen within the host. The specific method is as follows:

[0308] DNA was extracted from leaf samples. DNA fragments were amplified using TaEF (SEQ ID No. 30 and SEQ ID No. 31) and PsEF (SEQ ID No. 32 and SEQ ID No. 33), and then TA cloned. The clones were ligated and transformed into *E. coli* DH5α. Plasmid concentration was extracted, and the plasmid copy number was calculated based on the concentration.

[0309]

[0310] SEQ ID No.30: 5'-TGACCAGATCAACGAGCC-3';

[0311] SEQ ID No.31: 5'-CTCCAGGAGAGACTCATG-3';

[0312] SEQ ID No. 32: 5'-TTCGCCGTCCGTGATATGAGACAA-3';

[0313] SEQ ID No. 33: 5'-ATGCGTATCATGGTGGTGGAGTGA-3'.

[0314] Based on the calculated plasmid copy number, the plasmid concentration was diluted with deionized water to create different concentration gradients. qRT-PCR was then performed using quantitative primers with each of the diluted plasmids. The logarithm of the plasmid copy number (log) was plotted on the x-axis, corresponding to the C-value. T The value is used to perform linear fitting on the ordinate to obtain the copy number logarithm and C. T The linear curve equation for the value.

[0315] The DNA concentration in leaf samples was measured and diluted to 20 ng / μL with deionized water. qRT-PCR was performed on the same samples using TaEF (SEQ ID No. 30 and SEQ ID No. 31) and PsEF (SEQ ID No. 32 and SEQ ID No. 33), respectively. Based on the obtained C... T Substitute the values ​​into the corresponding linear equations to calculate the copy numbers of TaEF and PsEF in the same sample, and obtain the PsEF / TaEF ratio. Using the ratio of the control group Fielder as a reference, compare the infection status of stripe rust mycelia in wheat.

[0316] After inoculation with stripe rust fungus CYR32, wheat leaves were sampled at 48 hpi and 96 hpi to detect the production of reactive oxygen species at the infection site, the degree of necrosis in the leaves, and the degree of mycelial infection.

[0317] DAB staining was used to detect reactive oxygen species in wheat leaves, as follows:

[0318] To verify the resistance changes resulting from silencing the Pst13248 gene, leaf samples were cut 6–8 hours before sampling. The morphologically lower part of the leaf was immersed in a 1 mg / mL LDAB staining solution (pH 3.6–3.8), while the rest of the leaf was exposed to strong light at room temperature for 6–8 hours. Staining was complete when the veins turned reddish-brown, reddish-brown exudate appeared from the morphologically upper cut, and black spots were distributed on the leaf surface. The leaves were then cut into segments approximately 2 cm in length and placed in new 2 mL centrifuge tubes. Fixation and clearing solution [anhydrous ethanol: glacial acetic acid = 1:1, (V:V)] was added to completely submerge the leaf segments, and the fixation and clearing solution was changed several times during this process. Chloral hydrate solution was added until the leaf segments were completely submerged, and this decolorization process was repeated multiple times until the leaf segments were transparent. Before microscopic observation, the leaf segments were stored in a 50% glycerol solution.

[0319] Trypan blue staining was used to detect necrosis, as follows:

[0320] Cut off leaf samples, add trypan blue staining solution until the leaves are submerged, and stain at room temperature for 8-12 hours; rinse the leaves with distilled water, add chloral hydrate solution to decolorize until the tissue is bleached, and change the chloral hydrate solution several times during the process; change to 50% glycerol solution for preservation before microscopic observation.

[0321] The status of mycelial infection was detected using WGA-Alexa 488 staining, as follows:

[0322] Cut leaf samples and add a fixation and clearing solution [anhydrous ethanol: glacial acetic acid = 1:1, (V:V)] to completely submerge the leaf segments. Fix and decolorize the leaf segments, changing the fixation and clearing solution several times during this process. Add chloral hydrate solution until completely submerged in the leaf segments, repeating the decolorization process multiple times until the leaf segments are transparent. Rinse twice with 50% ethanol, 5–15 min each time, followed by rinsing 2–3 times with distilled water. Add 1M KOH solution, ensuring the leaf segments are submerged, and boil for about 5 min until the leaves soften (the boiling time depends on the condition of the leaves; observe the leaves constantly. Excessive boiling time may cause the leaves to disintegrate and damage the mycelial structure). Soak the leaves three times in 50mM Tris-HCl (pH 7.5), 5 min each time. Stain with WGA-Alexa 488 buffer in the dark for 10–20 min (extend the staining time if the staining solution is too long). Soak the leaves three times with 50mM Tris-HCl (pH 7.5), each time for 5 minutes. The leaves are then stored in the last Tris-HCl solution at 4°C until use.

[0323] The results are as follows Figure 3 and Figure 4 As shown. According to the test results, both lines of Pst13248-RNAi were significantly silenced ( Figure 3(B in the text). Compared to Fielder, Pst13248-RNAi wheat produces a large number of hypersensitivity responses and fewer urediniospores (B in the text). Figure 3 (A) Biomass analysis results showed that the content of stripe rust fungi in wheat leaves of Pst13248-RNAi was significantly reduced ( Figure 3 (C in the middle).

[0324] To investigate the resistance changes induced by silencing Pst13248, this invention statistically observed the host cell defense response and fungal growth in Pst13248-RNAi wheat after stripe rust infection. DAB staining was used to observe and statistically analyze the accumulation of reactive oxygen species (ROS) in Pst13248-RNAi wheat. The results showed that at 48 hpi and 96 hpi after stripe rust infection, the accumulation of ROS in Pst13248-RNAi wheat was significantly increased compared to Fielder wheat. Figure 4 (A and B in the text). After stripe rust infection for 48 hpi and 96 hpi, trypan blue staining of wheat leaves revealed a small amount of cell necrosis in Fielder leaves, while Pst13248-RNAi wheat leaves showed a large amount of cell necrosis. Figure 4 (C and D in the text). Simultaneously, by staining stripe rust mycelia with WGA and observing and statistically analyzing them, the mycelial infection area of ​​Pst13248-RNAi wheat was significantly reduced after 48 hpi and 96 hpi of stripe rust infection (C and D in the text). Figure 4 (E and F in the text).

[0325] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A nucleic acid molecule encoding the wheat stripe rust effector protein Pst13248, characterized in that, Includes at least one of the following: (1) A gene comprising the nucleotide sequence shown in SEQ ID NO.1; (2) A gene that has more than 80% identity with the gene shown in (1) and encodes the wheat stripe rust effector protein Pst13248 by substituting, deleting and / or adding one or more nucleotides of the gene described in (1); (3) A fusion gene obtained by connecting the gene of (1) or the gene of (2) to the 3' end and / or the 5' end of the gene to which the protein tag is encoded.

2. A silencing site for silencing a nucleic acid molecule of claim 1, characterized in that, The nucleotide sequence is shown in SEQ ID NO.

2.

3. An RNAi expression vector for silencing the nucleic acid molecule of claim 1, characterized in that, Insertion site with the silencing fragment design as described in claim 2.

4. The RNAi expression vector according to claim 3, characterized in that, The RNAi expression vectors include the pDONR221 intermediate vector and the pC336 final vector.

5. A recombinant bacterium, characterized in that, It includes the RNAi expression vector as described in claim 3 or 4.

6. The application of the reagent for silencing the nucleic acid molecule of claim 1, the silencing fragment design site of claim 2, the RNAi expression vector of claim 3 or 4, or the recombinant bacteria of claim 5 in improving the stripe rust resistance of cereal crops.

7. The application according to claim 6, characterized in that, The improvement of stripe rust resistance in cereal crops is achieved through at least one of the following: 1) Increases reactive oxygen species in the areas infected by stripe rust fungi on leaves; 2) Increase the area of ​​cell necrosis at the site of stripe rust infection on leaves; 3) Inhibit the mycelial infection of stripe rust fungi and / or reduce the area of ​​mycelial infection of stripe rust fungi; 4) Reduce stripe rust fungus urediniospores.

8. The application according to claim 6, characterized in that, The cereal crops include wheat.

9. A method for constructing plant germplasm that silences the nucleic acid molecule of claim 1, characterized in that, The method includes the following steps: transferring the RNAi expression vector of claim 3 or 4 into the target plant, and further screening to obtain plant germplasm that silences the nucleic acid molecule of claim 1.

10. The method according to claim 9, characterized in that, The target plant includes wheat.

Images