SNP (Single Nucleotide Polymorphism) molecular marker related to relative germination rate of lettuce at high temperature as well as detection primer and application of SNP molecular marker

By developing SNP molecular markers and their detection primers at the Chr5:283420978 site in the lettuce genome, the problem of weak evaluation of heat resistance during lettuce germination period was solved, enabling efficient screening of heat-resistant germplasm and improving the germination rate and seedling growth performance of lettuce under high temperature.

CN121137232APending Publication Date: 2025-12-16SHANGHAI AGROBIOLOGICAL GENE CENT
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511400204.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-28
Publication Date
2025-12-16

AI Technical Summary

Technical Problem

Existing technologies for evaluating and screening heat tolerance during lettuce germination are relatively weak, affecting seed germination and seedling growth, leading to a decline in yield and quality. There is a lack of effective molecular markers for screening heat-resistant germplasm.

Method used

SNP molecular markers and their detection primers located at Chr5:283420978 in the lettuce genome were developed. The relative germination rate of lettuce under high temperature was identified by PCR-RFLP method. Utilizing the high germination rate of CC homozygous lettuce population at 27-29℃, specific upstream and downstream primers were designed for PCR amplification and enzyme digestion to distinguish different genotypes.

Benefits of technology

This method enables efficient screening of heat-resistant lettuce germplasm, improves germination rate under high-temperature conditions, cultivates robust early seedlings, and enhances lettuce yield and quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121137232A_ABST
    Figure CN121137232A_ABST
Patent Text Reader

Abstract

The invention provides an SNP (Single Nucleotide Polymorphism) molecular marker related to the relative germination rate of lettuce at high temperature as well as a detection primer and application thereof, and belongs to the technical field of lettuce molecular marker-assisted breeding. The SNP molecular marker is located at a lettuce genome Chr5: 283420978 site, the nucleotide base of the site is C or T, the relative germination rate of a CC homozygous lettuce group at high temperature (27-29 DEG C) is higher than that of TT homozygous lettuce, and the lettuce group with the genotype of CC is selected during breeding, so that high-temperature-resistant lettuce can be cultivated. The invention also provides a primer and a detection method for detecting the SNP site. An upstream primer and a downstream primer for detecting the SNP site are respectively shown as SEQ ID NO.1 and SEQ ID NO.2. The invention also provides a primer and a detection method for detecting the SNP site. The SNP molecular marker, the detection primer and the detection method provided by the invention have important application value for screening high-temperature-resistant lettuce varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular marker-assisted breeding technology for lettuce, and particularly to SNP molecular markers related to the relative germination rate of lettuce at high temperatures, their detection primers, and applications. Background Technology

[0002] Lettuce (Lactuca sativa L.), belonging to the Asteraceae family, is a leafy vegetable primarily consumed for its leafy appearance. Originating in the Mediterranean region, lettuce thrives in cool climates, with an optimal growing temperature of 15–25°C. However, with global warming, high summer temperatures pose an increasing challenge to lettuce production. Temperatures exceeding this range not only affect seed germination but also severely impact seedling growth, subsequent yield, and quality.

[0003] In assessing the heat tolerance of lettuce, field traits such as head formation rate and leaf tip scorch are often used to measure a variety's adaptability to high temperatures. For example, Huo Guotao et al. conducted a comprehensive field evaluation of 253 lettuce resources under high summer temperatures, screening out 14 superior varieties with strong heat tolerance and late bolting. In addition, seedling heat damage index and lethal temperature are also used as important indicators of heat tolerance during the seedling stage. However, existing research mainly focuses on the seedling and mature plant stages, while the evaluation of heat tolerance and germplasm screening during the germination period remains relatively weak, and systematic research urgently needs to be strengthened. Seed germination is a crucial process in the early life cycle of plants and is extremely sensitive to temperature changes. It directly affects seedling establishment, the transition of subsequent growth stages, and ultimately crop yield. Heat-resistant seeds exhibit stronger vigor and higher germination rates under high temperatures, resulting in more uniform seedling emergence and the cultivation of robust early seedlings. Therefore, screening excellent heat-resistant germplasm and cultivating heat-resistant lettuce varieties is of great significance for solving the problem of lettuce heat tolerance. The existence of diverse heat-resistant germplasm resources in natural populations provides an important foundation for further in-depth exploration and utilization.

[0004] In recent years, with the maturation of molecular biology, molecular techniques have been widely applied in breeding. PCR-RFLP is an effective technique for detecting SNPs. After identifying the SNP site, restriction endonucleases are used to cut it, followed by agarose gel or polypropylene gel electrophoresis analysis to accurately identify the SNP site. PCR-RFLP not only possesses the accuracy of DNA sequencing but also overcomes its drawbacks such as high cost, cumbersome operation, and high false positive rate. Furthermore, the sequence sites detected do not have specific requirements. Therefore, developing molecular markers for SNPs that correlate with the relative germination rate of lettuce at high temperatures is of great practical significance for screening heat-resistant lettuce germplasm. Summary of the Invention

[0005] In view of this, the present invention provides SNP molecular markers related to the relative germination rate of lettuce at high temperatures, their detection primers, and applications to solve the above problems.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides the application of SNP molecular markers in identifying the relative germination rate of lettuce under high temperature. The SNP molecular markers are located at the Chr5:283420978 site in the lettuce genome, and the nucleotide bases at this site are C or T. The average relative germination rate of CC homozygous lettuce population is higher than that of TT homozygous lettuce population under high temperature. The high temperature is 27-29℃.

[0008] The present invention also provides SNP molecular marker primers for identifying the relative germination rate of lettuce at high temperatures, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1 and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; the high temperature is 27-29°C.

[0009] The present invention also provides a kit for identifying the relative germination rate of lettuce at high temperature, wherein the SNP molecular marker primers in the kit are used; the high temperature is 27-29°C.

[0010] This invention also provides the application of the SNP molecular marker primers and / or the kit described herein in any of the following:

[0011] (1) Application in lettuce genotyping;

[0012] (2) Application in determining the relative germination rate of lettuce under high temperature;

[0013] (3) Application in screening lettuce with superior germination rate at high temperatures;

[0014] (4) Application in lettuce breeding;

[0015] (5) Application in lettuce germplasm improvement;

[0016] The high temperature is 27–29°C.

[0017] This invention also provides a method for identifying the relative germination rate of lettuce at high temperatures, comprising the following steps:

[0018] S1. Extract genomic DNA from the lettuce sample to be tested;

[0019] S2. Using the genomic DNA as a template, perform PCR amplification using the SNP molecular marker primers to obtain the amplification product;

[0020] S3. Obtain the genotype of the SNP locus corresponding to the lettuce sample to be tested. The average relative germination rate of the lettuce population with genotype CC at the Chr5:283420978 locus in the lettuce genome was higher than that of TT type lettuce at high temperature of 27-29℃.

[0021] Preferably, the PCR amplification reaction system is as follows: 2.5 μL of genomic DNA from the lettuce sample to be tested, 1 μL of upstream primer, 1 μL of downstream primer, 12.5 μL of 2xTSINGKE MasterMix, and ddH2O to a final volume of 25 μL.

[0022] Preferably, the concentration of the upstream primer is 10 mM and the concentration of the downstream primer is 10 mM.

[0023] Preferably, the PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for 35 cycles; 72℃ extension for 5 min.

[0024] Preferably, the method for obtaining the genotype of the corresponding SNP locus in the lettuce sample to be tested is any one of the following:

[0025] (1) Sequencing the amplification products;

[0026] (2) The amplified product was digested with MwoⅠ enzyme and then subjected to agarose gel electrophoresis. If bands appeared at 246bp and 266bp, the genotype was CC; if a band appeared at 512bp, the genotype was TT.

[0027] Preferably, the enzyme digestion system is as follows: 10 μL of PCR product, 2.0 μL of 10× buffer, 0.3 μL of MwoⅠ (5000 units / mL), and dd H2O to a final volume of 20 μL. The enzyme digestion conditions are: 60℃ for 1 h.

[0028] By adopting the above technical solution, the present invention has the following beneficial effects: The SNP molecular marker described in this invention is located at the Chr5:283420978 site in the lettuce genome. The nucleotide base of this site is C or T. The relative germination rate of CC homozygous lettuce populations is higher than that of TT homozygous lettuce at high temperatures (27-29℃). Selecting lettuce populations with the CC genotype during breeding is beneficial for cultivating heat-resistant lettuce. The present invention also provides primers and detection methods for detecting this SNP site. The upstream and downstream primers for detecting this SNP site are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively. The SNP molecular marker, detection primers, and detection methods proposed in this invention have important application value for screening heat-resistant lettuce varieties. Attached Figure Description

[0029] Figure 1 The average relative germination rate of CC homozygous lettuce population and TT homozygous lettuce population among 201 lettuce varieties.

[0030] Figure 2 Genome-wide association analysis diagram of the relative germination rate of 201 lettuce germplasm resources.

[0031] Figure 3 Agarose gel electrophoresis image of a 512bp fragment amplified by SNP molecular marker primers.

[0032] Figure 4 The image shows the polymorphic agarose gel electrophoresis result of the SNP molecular marker primer amplification product after digestion with MwoⅠ enzyme.

[0033] Figure 5 The average relative germination rate of CC homozygous lettuce population and TT homozygous lettuce population among 42 lettuce varieties was determined.

[0034] Figure 6 Genotyping diagram of molecular marker site Chr5:283420978. Detailed Implementation

[0035] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0036] Example 1. High-temperature germination experiment of 201 lettuce populations

[0037] A high-temperature germination experiment was conducted on 201 lettuce population seeds, and their relative germination rates were calculated. The method for determining the relative germination rate was as follows: 201 wild closely related species and modern cultivated lettuce varieties were used as the test subjects. For each material, seeds of consistent origin, year, and plumpness were selected. 100 seeds constituted one replicate, with three replicates. Germination was carried out at 28℃, with germination at room temperature (20℃) serving as a control.

[0038] In the germination experiment, 100 seeds from three replicates of each material were placed on double-layered filter paper in a 120×120mm petri dish, and 10mL of distilled water was added. The petri dishes were covered to prevent evaporation, and then placed in incubators at 20℃ and 28℃ respectively for dark cultivation to simulate soil germination conditions. Germination was defined as when the radicle reached a length of 2mm.

[0039] Germination rate % = Number of seeds that germinated normally on day 3 / Number of seeds tested

[0040] Relative value of traits such as relative germination rate = X H / X N X H X represents the phenotypic value measured at 28℃.N The phenotypic values ​​were measured at 20℃. The genotyping results and relative germination rates of 201 lettuce varieties are shown in Table 1.

[0041] Table 1. Genotyping results and relative germination rates of 201 lettuce germplasms.

[0042]

[0043]

[0044]

[0045] The results are as follows Figure 1 As shown, among the 201 lettuce varieties surveyed, the average relative germination rate of lettuce germplasm with genotype TT (16.70%) was significantly lower than that of germplasm with genotype CC (55.42%). Therefore, it is preliminarily concluded that this locus is related to the germination rate of lettuce at high temperature (28℃).

[0046] Example 2. Localization of the molecular marker site Chr5:283420978 of the SNP associated with the relative germination rate of lettuce at high temperature.

[0047] Whole-genome resequencing was performed on 201 wild relatives and modern cultivated lettuce varieties. Raw data underwent quality control and data cleaning using FastQC and FAP. Clean reads were then aligned to the lettuce reference genome (V8) using BWA. After removing repetitive sequences, variant sites were obtained using the HaplotypeCaller program in GATK. Genome-wide association analysis (GWAS) was performed using the GAPIT3 (https: / / zzlab.net / GAPIT / ) software in R, employing a mixed linear model (MLM). The most significant association sites (those with the highest -LOG10(P) value) were selected from the association analysis results, with a significance threshold set at P = 1 / 7156407 = 1.4E-07. The r² value for each SNP pair was calculated using PopLDdecay software, and genome-wide linkage disequilibrium (LD) analysis was performed to obtain the linkage disequilibrium decay distance (LD decay). Based on the LDdecay results, all genes within 100 kb upstream and downstream of the most significant site were selected. Genes within this region were functionally annotated, and candidate genes were screened. Gene annotations were mainly based on the Phytozome database (http: / / www.phytozome.net).

[0048] The results are as follows Figure 2As shown, the top figure is a Manhattan plot, representing the correlation between all SNP sites on autosomes (chromosomes 1-9) and relative germination rate. The green dashed horizontal line represents the significance threshold line -log10(P) = 7; the green solid horizontal line represents the highly significant threshold line -log10(P) = 9. The bottom figure is a quantile-quantile plot, representing the degree of fit between the actual observed values ​​and the expected values. A missense mutation was identified at position 283,420,978 on chromosome 5 (position 104 of exon 2 of the GT-3b gene). This position encodes a triple-helix transcription factor GT-3b [(LOC111890782)(Lsat_1_v5_gn_5_149380)].

[0049] Example 3. Development of molecular marker primers for detecting SNPs related to relative germination rate of lettuce at high temperatures.

[0050] For the C / T mutation of the base polymorphism Chr5:283420978, primers were designed in the upstream and downstream regions of the mutation site. The specific nucleotide sequences of the primers are as follows:

[0051] GT-3b-SNP-F: 5'-AGGGGTTATAATCGCATGGC-3' (SEQ ID NO. 1);

[0052] GT-3b-SNP-R: 5'-CCACTCCAGCTCCTTCATCC-3' (SEQ ID NO. 2).

[0053] Amplification using the above primers yielded a 512 bp fragment, the nucleotide sequence of which is shown in SEQ ID NO. 3.

[0054] SEQ ID NO.3:

[0055] AGGGGTTATAATCGCAGTGGCGATCAATGTAAAAGCAAGTGGAAGAATCTTGTTACCCGTTACAAGGTTTGTCATAATTATATCTATCTTTTCTTTTAGAAAAAGTGTTTCATGTTTTCTTGGAATTG AACCAGGGATATGAGACGATGGAACAAGAAGGTACGAGGCAACAGTTCCCATTCTACGATGAGTTACAAACGATCTTCGCAAATCGCATGCAAAGGTTACTGTGGATGGAAGCAGAAGGTGYTGCAAG TGGATCCAGGAAAAGAGAGATGAAGTTTGCTTCGGACAATGATGACAGTGATATGGAGAAGGCAAGTGTAAGTAAGATCACAAAGAAGAAGAAGGGTACAGAGAGTAGTAGCCAATGTAACCCTGAAG ATACAAGCTGCATCAACGTGATTAGTAACTTGAAGGATTTATTGGAAGAGTATATGAAACATGAAATGCAATCGATGGAATGGTATAAGGCTAAAGAAGAAGAGAGGAGGATGAAGGAGCTGGAGTGG.

[0056] The average germination rate of lettuce germplasm population with genotype CC was lower than that of lettuce germplasm population with genotype TT at a high temperature of 28℃.

[0057] Genotyping can also be performed using restriction fragment length polymorphism (PCR-RFLP). The 512 bp PCR amplification product contains only one Mwo I restriction enzyme recognition site, which is determined by the sequence of the 104th base of exon 2 of the GT-3b gene. Therefore, when this site is C (no mutation), Mwo I can digest it, producing two fragments of 246 bp and 266 bp; when a C>T mutation occurs, the restriction enzyme site disappears, and the PCR product remains intact at 512 bp and cannot be cleaved. Different genotypes can then be distinguished by electrophoresis.

[0058] Therefore, in the agarose gel electrophoresis results, the CC type showed bands at 246bp and 266bp; the CT type showed bands at 246bp, 266bp, and 512bp; and the TT type only showed a band at 512bp.

[0059] Example 4. Verification of molecular markers for SNPs related to relative germination rate of lettuce at high temperatures.

[0060] Forty-two lettuce germplasms from Example 1 were randomly selected for further validation. Genomic DNA was extracted from these 42 lettuce varieties and amplified using the primers from Example 2. The genotyping results and germination rates were statistically analyzed. The specific steps are as follows:

[0061] (1) Extraction of total DNA from lettuce

[0062] ① Place an appropriate amount of lettuce leaves into a 2mL centrifuge tube;

[0063] ② Add one grinding steel ball, tighten the lid, place it in liquid nitrogen for 60 seconds, and then grind it with a grinding machine for 30 seconds at a grinding frequency of 1400 r / min;

[0064] ③ Add 800 μL of 1.5×CTAB to the ground sample and mix well. Then, heat in a water bath at 65℃ for 20–30 min, inverting the container to mix every 10 min.

[0065] ④ Cool to room temperature and add 600 μL of chloroform / isoamyl alcohol mixture (volume 24:1). Shake for 2 minutes, but not too vigorously, until the lower liquid phase turns dark green. Centrifuge at 10000 r / min for 10 minutes at room temperature.

[0066] ⑤ Add 500 μL of the supernatant to a new 1.5 mL centrifuge tube, add 500 μL of pre-frozen isopropanol, shake well to mix the DNA, centrifuge at 12000 r / min at room temperature for 10 min, and discard the supernatant.

[0067] ⑥ Add 500 μL of 75% ethanol to elute for 3 min, then centrifuge at 12000 rpm for 5 min.

[0068] ⑦ Discard the supernatant, dry it in a fume hood, add 100 μL ddH2O to dissolve the DNA, and store at -20℃ for later use.

[0069] (2) PCR amplification was performed using primers for detecting the SNP site.

[0070] PCR amplification was performed using molecular marker primers GT-3b-SNP-F (SEQ ID NO.1) / GT-3b-SNP-R (SEQ ID NO.2). The reaction system is shown in Table 2, and the reaction procedure is shown in Table 3.

[0071] Table 2 PCR reaction system

[0072] reagents volume Lettuce genomic DNA 2.5μL Upstream primer (10 μM) 1μL Downstream primer (10 μM) 1μL 2×TSINGKEMasterMix 12.5μL <![CDATA[ddH2O]]> Make up to 25μL

[0073] Table 3 PCR reaction procedure

[0074]

[0075] The PCR amplification products were subjected to 1% agarose gel electrophoresis (1×TAE, 120V, 20min). The agarose gel electrophoresis pattern is shown below. Figure 2 As shown in the figure. The results show that the SNP molecular marker primers of the present invention can amplify clear and bright bands in different lettuce germplasm populations, and the fragment size is consistent with the expectation, which is 512 bp.

[0076] (3) MwoI digestion of PCR amplification products

[0077] ① 20 μL MwoⅠ enzyme digestion reaction system:

[0078] 10 μL of PCR product, 2.0 μL of 10× buffer, 0.3 μL of MwoⅠ (5000 units / mL), and sterile pure water (H2O) to a final volume of 20 μL;

[0079] ②Enzymatic digestion conditions: Digest at 60℃ for 1 hour.

[0080] ③ Separate the MwoⅠ enzyme digestion products by electrophoresis on 2.0% agarose gel.

[0081] Electrophoresis patterns of enzyme digestion products from PCR amplification of different lettuce genotypes are shown below. Figure 4 As shown. Since the 512bp fragment amplified by PCR-RFLP does not contain other MwoI restriction enzyme recognition sites, when the C>T mutation does not occur at site 104 of exon 2 of GT-3b, the PCR-amplified GT-3b gene product is recognized by the restriction endonuclease MwoI and the amplified fragment is cut into two segments; however, when this site is mutated, the restriction endonuclease MwoI restriction enzyme recognition site disappears, and the amplified fragment cannot be digested by the enzyme.

[0082] Table 4. Genotyping results and relative germination rates of 42 lettuce germplasms.

[0083]

[0084] The results showed that among the 42 lettuce varieties surveyed, the average relative germination rate of the TT homozygous lettuce germplasm population (24.51%) was significantly lower than that of the CC homozygous lettuce germplasm population (76.17%) (P<0.001). This indicates that selecting lettuce populations with the CC genotype during breeding is beneficial for cultivating heat-resistant lettuce, and this locus can serve as a molecular genetic marker to improve the speed of heat-resistant germination breeding.

[0085] As can be seen from the above embodiments, the present invention provides SNP molecular markers related to the relative germination rate of lettuce at high temperatures, their detection primers, and applications. The SNP molecular markers of the present invention can be used to identify the relative germination rate of lettuce at high temperatures.

[0086] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of SNP molecular markers in identifying the relative germination rate of lettuce at high temperatures, characterized in that... The SNP molecular marker is located at the Chr5:283420978 site in the lettuce genome, and the nucleotide base at this site is C or T; the average relative germination rate of CC homozygous lettuce population is higher than that of TT homozygous lettuce population at high temperature; the high temperature is 27-29℃.

2. SNP molecular marker primers for identifying the relative germination rate of lettuce at high temperatures, characterized in that, The nucleotide sequence of the upstream primer is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; the high temperature is 27–29°C.

3. A reagent kit for determining the relative germination rate of lettuce under high temperature, characterized in that, The kit includes the SNP molecular marker primers as described in claim 2; the high temperature is 27–29°C.

4. The use of the SNP molecular marker primers of claim 2 and / or the kit of claim 3 in any of the following: (1) Application in lettuce genotyping; (2) Application in determining the relative germination rate of lettuce under high temperature; (3) Application in screening lettuce with superior germination rate at high temperatures; (4) Application in lettuce breeding; (5) Application in lettuce germplasm improvement; The high temperature is 27–29°C.

5. A method for determining the relative germination rate of lettuce under high temperature, characterized in that, Includes the following steps: S1. Extract genomic DNA from the lettuce sample to be tested; S2. Using the genomic DNA as a template, perform PCR amplification using the SNP molecular marker primers described in claim 2 to obtain the amplification product; S3. Obtain the genotype of the SNP locus corresponding to the lettuce sample to be tested. The average relative germination rate of the lettuce population with genotype CC at the Chr5:283420978 locus in the lettuce genome was higher than that of TT type lettuce at high temperature of 27-29℃.

6. The method according to claim 5, characterized in that, The PCR amplification reaction system was as follows: 2.5 μL of genomic DNA from the lettuce sample to be tested, 1 μL of upstream primer, 1 μL of downstream primer, 12.5 μL of 2xTSINGKE MasterMix, and ddH2O to a final volume of 25 μL.

7. The method according to claim 6, characterized in that, The concentration of the upstream primer was 10 mM, and the concentration of the downstream primer was 10 mM.

8. The method according to claim 5, characterized in that, The PCR amplification reaction program is as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 45 s, for 35 cycles; 72℃ extension for 5 min.

9. The method according to claim 5, characterized in that, The method for obtaining the genotype of the corresponding SNP locus in the lettuce sample to be tested is any of the following: (1) Sequencing the amplification products; (2) The amplification product was digested with MwoⅠ enzyme and then subjected to agarose gel electrophoresis. If bands appeared at 246bp and 266bp, the genotype was CC. If a band appears at 512bp, the genotype is TT.

10. The method according to claim 9, characterized in that, The enzyme digestion system was as follows: 10 μL of PCR product, 2.0 μL of 10× buffer, 0.3 μL of MwoⅠ (5000 units / mL), and dd H2O to a final volume of 20 μL. The enzyme digestion conditions were: 60℃ for 1 h.