Primer pair, kit and detection method for detecting ganoderma lucidum decay monascus xylogenus and application

Abstract

The invention discloses a primer pair, a kit and a detection method for detecting ganoderma lucidum decay monascus xylophilus and application. The invention discloses a primer pair for detecting ganoderma lucidum spoilage monascus xylogenus. The primer pair is composed of a nucleotide as shown in SEQ ID NO.1 and a nucleotide as shown in SEQ ID NO.2. The invention further discloses a method for detecting ganoderma lucidum spoilage monascus xylogenus. The nucleotide is composed of a nucleotide shown in SEQ ID NO.3 or a nucleotide shown in SEQ ID NO.3 and a nucleotide shown in SEQ ID NO.4. The invention also discloses a kit comprising the primer pair, a method for detecting the ganoderma lucidum spoilage monascus xylogenus in a sample, a method for quantitatively detecting the content of the ganoderma lucidum spoilage monascus xylogenus in the sample and application of the primer pair. The primer and the probe with high specificity are designed, so that pathogenic bacteria causing the yellow foot disease can be accurately and quickly detected from a ganoderma lucidum sample, and the cross reaction with the DNA of the ganoderma lucidum is effectively avoided. The method is high in sensitivity, can realize early diagnosis and quantitative analysis, is matched with a kit for use, is simple and convenient to operate, provides a reliable technical means for timely early warning and accurate prevention and control of the ganoderma lucidum yellow foot disease, and is beneficial to remarkably reducing economic loss caused by the disease.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of rapid detection of pathogenic bacteria of edible and medicinal fungi, and particularly relates to a primer pair for detecting Ganoderma lucidum Aspergillus ustus, a kit, a detection method and purposes. BACKGROUND

[0002] With the expansion of the Ganoderma lucidum industry, continuous cropping obstacles and disease problems are increasingly prominent, especially Ganoderma lucidum yellow foot disease, which seriously restricts the sustainable development of the industry, resulting in serious yield loss and quality decline.

[0003] Traditional morphological observation and pathogenic bacteria isolation and culture techniques have strong subjectivity and long time consumption problems, and are difficult to meet the needs of early diagnosis. Although molecular biology detection techniques provide a more rapid and specific solution, conventional PCR techniques and real-time fluorescent quantitative PCR techniques still have room for improvement in terms of operational simplicity and cost. SUMMARY

[0004] To solve the above technical problems, the present application aims to provide a primer pair for detecting Ganoderma lucidum Aspergillus ustus, a kit, a detection method and purposes, which can quickly and accurately detect whether Ganoderma lucidum Aspergillus ustus exists in Ganoderma lucidum samples, and can quantitatively analyze the content of pathogenic bacteria in the samples.

[0005] To achieve the above-mentioned purposes, the first aspect of the present application provides:

[0006] A primer pair for detecting Ganoderma lucidum Aspergillus ustus, which consists of the nucleotide shown in SEQ ID NO. 1 and the nucleotide shown in SEQ ID NO. 2; or consists of the nucleotide shown in SEQ ID NO. 3 and the nucleotide shown in SEQ ID NO. 4.

[0007] The second aspect of the present application provides:

[0008] A kit for detecting Ganoderma lucidum Aspergillus ustus, which comprises the primer pair described above.

[0009] The third aspect of the present application provides:

[0010] A method for detecting Ganoderma lucidum Aspergillus ustus in a sample, comprising the step of amplifying the nucleic acid of the sample using the primer pair described above or the kit described above.

[0011] The fourth aspect of the present application provides:

[0012] A method for quantitatively detecting the content of Ganoderma lucidum Aspergillus ustus in a sample, comprising the following steps:

[0013] a) Real-time fluorescent quantitative PCR amplification is performed on a standard sample with known DNA content of Ganoderma azaphilum using the primer pair or the kit described above, the Ct value is obtained, and a standard curve of Ganoderma azaphilum DNA content and Ct value is established;

[0014] b) Real-time fluorescent quantitative PCR amplification is performed on the nucleic acid of the unknown sample using the primer pair or the kit described above, and the Ct value is obtained;

[0015] c) The Ct value obtained in step b) is substituted into the standard curve established in step a) to calculate the DNA content of Ganoderma azaphilum in the unknown sample.

[0016] The fifth aspect of the present application provides:

[0017] The use of the primer pair described above in the preparation of a product for detecting Ganoderma yellow foot disease.

[0018] The present application has the following beneficial effects:

[0019] 1. High specificity: The specific primers and probes designed in the present application can accurately recognize and amplify the target sequence of Ganoderma azaphilum, and will not cross-react with the DNA of Ganoderma lucidum or other control fungi, thereby ensuring the accuracy of the detection results and avoiding false positives.

[0020] 2. High sensitivity: The detection method has very high sensitivity and can effectively detect very low pathogen content. Experimental data shows that in samples without pathogenic bacteria, the Ct value is about 29-35, while when the sample contains only 10% pathogenic bacteria DNA, the Ct value is significantly reduced to about 17-21, indicating that the method can quickly and sensitively detect early infection.

[0021] 3. Accurate quantification: By establishing a standard curve (correlation curve) between pathogen DNA concentration and Ct value, the present application can not only qualitatively determine whether the Ganoderma sample is infected, but also can relatively quantify the content of Ganoderma azaphilum in the sample according to the Ct value, providing a scientific basis for disease severity assessment and precise prevention and control.

[0022] 4. Simple operation and rapid detection: The method is based on mature qPCR technology, the experimental process is standardized, and the operation is relatively simple. The entire detection process (from DNA extraction to result analysis) can be completed within 3 hours, greatly shortening the detection period, compared with the traditional 7-15 day separation culture method, the detection time is advanced, which provides the possibility for timely prevention and control measures. BRIEF DESCRIPTION OF DRAWINGS

[0023] Figure 1 is the conventional PCR electrophoretogram of specific primer and ITS primer.

[0024] Figure 2 is the amplification curve diagram based on the fluorescence signal intensity of SYBR method qPCR detection.

[0025] Figure 3 is the relationship diagram between Ct value and Ganoderma lucidum DNA content based on SYBR method qPCR detection.

[0026] Figure 4 is the correlation curve diagram between Ct value and Ganoderma lucidum DNA content based on SYBR method qPCR detection.

[0027] Figure 5 is the amplification curve diagram of specific probe for Ganoderma lucidum and Ganoderma lucidum 3.

[0028] Figure 6 is the amplification curve diagram of specific probe for Ganoderma lucidum and M624 Ganoderma lucidum.

[0029] Figure 7 is the amplification curve diagram of specific probe for Ganoderma lucidum and Shanghai Agricultural Ganoderma lucidum.

[0030] Figure 8 is the amplification curve diagram of specific probe for Ganoderma lucidum and Han Ganoderma lucidum.

[0031] Figure 9 is the amplification curve diagram based on the fluorescence signal intensity of probe method qPCR detection.

[0032] Figure 10 is the relationship diagram between Ct value and Ganoderma lucidum DNA content based on probe method qPCR detection.

[0033] Figure 11 is the correlation curve diagram between Ct value and Ganoderma lucidum DNA content based on probe method qPCR detection. DETAILED DESCRIPTION

[0034] In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions will be described in detail below in combination with specific examples. The described examples are only a part of the embodiments of the present application, and are not all the embodiments. The specific conditions in the following examples are not specified, and are usually implemented according to conventional conditions or according to the conditions recommended by the manufacturer.

[0035] Ganoderma lucidum, as a traditional and precious medicinal fungus, has a wide application prospect in many fields such as modern medicine, health food, cosmetics, etc. With the improvement of people's health consciousness and the vigorous development of traditional Chinese medicine industry, the scale of Ganoderma lucidum industry continues to expand. At present, the artificial cultivation of Ganoderma lucidum has formed a complete industrial chain, from strain breeding, cultivation technology, product processing to market sales, each link is maturing. Ganoderma lucidum cultivation is mainly distributed in Zhejiang, Fujian, Anhui, Shandong, Shaanxi and other provinces, forming a number of characteristic industrial clusters. With the expansion of cultivation scale and the occurrence of continuous cropping obstacles, disease problems have become increasingly prominent, becoming one of the main bottlenecks restricting the sustainable development of Ganoderma lucidum industry. In the production process of Ganoderma lucidum, the harmful bacteria mainly include Chlorosplenic fungus, Monascus, Chain fungus, Mucor and Penicillium, which compete with Ganoderma lucidum for nutrients in the culture medium, affect the normal growth of mycelium and reduce the yield of Ganoderma lucidum. The occurrence of diseases not only directly causes yield loss, but also seriously affects product quality, reduces the content of active ingredients and greatly reduces the value of commodities. Especially in the high-temperature and high-humidity cultivation environment, the disease spreads fast and is difficult to control, often causing devastating losses. According to incomplete statistics, the yield of Ganoderma lucidum caused by diseases reaches 20-30% per year, and even absolute yield in seriously diseased plots, with huge direct economic losses. Ganoderma lucidum yellow foot disease, as the most destructive disease in Ganoderma lucidum cultivation, mainly harms the base of stipe, with no obvious changes in the early stage of infection, but yellow-brown spots appear inside the stipe. With the gradual expansion of the spots and the deepening of the color, the internal tissue of the stipe softens and rots, eventually leading to the stop of growth and even death of the whole fruiting body. This disease has the characteristics of short incubation period, fast transmission and serious damage, not only causing yield reduction (up to 50-70%), but also seriously affecting product quality.

[0036] Traditional Ganoderma lucidum disease diagnosis mainly relies on morphological observation and pathogenic fungus isolation and culture technology. Morphological observation requires experienced technicians to judge according to disease symptoms, pathogenic fungus mycelium and spore morphology, etc., which is subjective and the accuracy is greatly affected by human factors. Although pathogenic fungus isolation and culture is the gold standard for diagnosis, the operation procedure is complicated, requires sterile operation conditions, and the culture period is as long as 7-15 days, often missing the best prevention and control opportunity. Molecular biology detection technology can realize rapid detection, and the specificity and sensitivity are significantly improved, gradually becoming an important means of disease diagnosis. The conventional PCR technology can accurately detect pathogenic fungi by designing specific primers, with a detection time of 3-4 hours, but it needs gel electrophoresis and other subsequent steps and cannot be quantified. Real-time fluorescent quantitative PCR technology realizes the quantitative detection of pathogenic fungi, with a sensitivity of 10-100 CFU / mL, which is the development direction of future detection.

[0037] The inventors of the present application confirmed through previous research that the pathogenic bacteria of Ganoderma lucidum yellow foot disease is Ganoderma lucidum wood-rotting Monascus, and since there is no obvious symptom in the early stage of the disease, it is easy to make mistakes in the key period of prevention and control.

[0038] Based on the above analysis, the development of Ganoderma applanatum Aspergillus ruber molecular probe detection technology has important theoretical significance and practical application value. The present application aims to solve the key problems existing in the existing detection technology, and to establish a set of rapid detection system with strong specificity, high sensitivity, simple operation and low cost. The technical innovation mainly reflects in the following aspects: first, through bioinformatics analysis and experimental verification, specific gene sequences of Ganoderma applanatum Aspergillus ruber compared with Ganoderma are screened, high-specificity molecular probes are designed to ensure no cross reaction with Ganoderma. Secondly, the probe design and reaction conditions are optimized to improve the detection sensitivity and realize early, rapid and accurate diagnosis. Thirdly, a standardized detection procedure is established, including sample processing, DNA extraction, amplification reaction, result interpretation and other aspects, to ensure the reliability and repeatability of the detection results. The successful implementation of the present application will produce significant economic and social benefits. In terms of economic benefits, through early diagnosis and precise prevention and control, the detection time of yellow foot disease can be advanced by 30 days, which can win valuable time for taking prevention and control measures, and is expected to reduce the disease loss by 30-50%. According to the current scale of Ganoderma industry, it is estimated that the direct economic loss of the industry can be recovered by hundreds of millions of yuan per year. In terms of social benefits, the popularization and application of the technology will improve the quality and safety level of Ganoderma products, protect the health of consumers, promote the standardized and large-scale development of Ganoderma industry, and enhance the competitiveness of the industry. It also provides technical reference for the molecular diagnosis of other edible and medicinal fungus diseases, and promotes the technological progress of the entire edible fungus industry. At the same time, the technology is simple to operate and low in cost, which helps to improve the disease prevention and control capacity of Ganoderma cultivation industry.

[0039] To achieve the above purpose, the first aspect of the present application provides:

[0040] A primer pair for detecting Ganoderma applanatum Aspergillus ruber, the primer pair consists of the nucleotide shown in SEQ ID NO. 1 and the nucleotide shown in SEQ ID NO. 2; or consists of the nucleotide shown in SEQ ID NO. 3 and the nucleotide shown in SEQ ID NO. 4.

[0041] SEQ ID NO. 1: TGAGCGAGGTTACACTTT.

[0042] SEQ ID NO. 2: TCCTTACGGACATCAACA.

[0043] SEQ ID NO. 3: GCGGAGGAACGTCGGCAATA.

[0044] SEQ ID NO. 4: ACGGCATTCTGGACATGGAACG.

[0045] The primer pair is specially used for detecting a specific pathogenic bacteria, Ganoderma azaphilus. Two groups of primer pairs, i.e. SEQ ID NO. 1 and SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4, are specially designed based on two different fluorescent quantitative PCR (qPCR) detection methods, i.e. SYBR Green method and TaqMan probe method. The first group of primer pairs (SEQ ID NO. 1 and SEQ ID NO. 2) is used for SYBR Green method qPCR, and SYBR Green is a dye that can be non-specifically combined with all double-stranded DNAs. In the PCR amplification process, as long as double-stranded DNA (whether it is a target product or a non-specific product such as primer dimer) is produced, the dye will be combined and emit fluorescence. The second group of primer pairs (SEQ ID NO. 3 and SEQ ID NO. 4) is used for TaqMan probe method qPCR, and TaqMan probe method uses a sequence-specific fluorescent probe. The probe has a fluorescent reporter group and a quencher group, and the fluorescence is quenched under normal circumstances. In the PCR amplification process, only when the probe is combined with the target sequence that is completely complementary to it, the 5'→3' exonuclease activity of Taq enzyme will hydrolyze the probe, so that the reporter group is separated from the quencher group, thereby emitting a fluorescence signal.

[0046] The first group of primer pairs (SEQ ID NO. 1 and SEQ ID NO. 2) is designed for SYBR Green method, and has low cost and high specificity. The second group of primer pairs (SEQ ID NO. 3 and SEQ ID NO. 4) is designed for TaqMan probe method, and has high precision and high reliability when used with a specific probe.

[0047] The second aspect of the present application provides:

[0048] A kit for detecting Ganoderma azaphilus, the kit comprising the primer pair described above, i.e. a primer pair consisting of a nucleotide represented by SEQ ID NO. 1 and a nucleotide represented by SEQ ID NO. 2; or a primer pair consisting of a nucleotide represented by SEQ ID NO. 3 and a nucleotide represented by SEQ ID NO. 4.

[0049] The kit takes the specific primer pair provided in the present application as the core, standardizes and productizes the molecular biology detection technology, and aims to provide a simple-to-operate and reliable tool for the on-site diagnosis and early warning of Ganoderma azaphilus.

[0050] The kit comprises at least the following key components: a first primer pair, wherein the nucleotide sequence shown in SEQ ID NO: 1 (5'-TGAGCGAGGTTACACTTT-3') is used as an upstream primer (F), and the nucleotide sequence shown in SEQ ID NO: 2 (5'-TCCTTACGGACATCAACA-3') is used as a downstream primer (R). The primer pair is suitable for SYBR Green I dye-based real-time fluorescent quantitative PCR (qPCR) detection. In addition, a second primer pair: the nucleotide sequence shown in SEQ ID NO: 3 (5'-GCGGAGGAACGTCGGCAATA-3') is used as an upstream primer (F), and the nucleotide sequence shown in SEQ ID NO: 4 (5'-ACGGCATTCTGGACATGGAACG-3') is used as a downstream primer (R). The primer pair is suitable for TaqMan probe-based real-time fluorescent quantitative PCR (qPCR) detection, and needs to be used in combination with a specific fluorescent probe.

[0051] According to the instructions, the operator only needs to extract total DNA from the Ganoderma lucidum sample to be tested, and then mix the DNA template with the primers, premix and other components provided in the kit, and then perform amplification on a real-time fluorescent quantitative PCR instrument. Since the primer pair used is designed based on the specific gene sequence of Ganoderma lucidum and Aspergillus ruber, it has high specificity, so specific amplification and significant fluorescence signals will only occur when the sample contains the target pathogen, so that the instrument can accurately capture and identify it.

[0052] The kit of the embodiments of the present application integrates high-specificity molecular detection elements and standardized operation procedures, and realizes rapid (result within a few hours), sensitive (can detect low-abundance pathogens), accurate (high specificity, avoids false positives) and potentially quantifiable detection of Ganoderma lucidum yellow foot disease pathogens. The kit greatly simplifies the complexity of molecular detection, does not require users to design and verify primers themselves, reduces the technical threshold, and is very suitable for large-scale screening and early prevention and control of Ganoderma lucidum yellow foot disease by Ganoderma lucidum planting bases, quality inspection institutions and scientific research units, and provides strong technical support for the healthy development of the Ganoderma lucidum industry.

[0053] As a preferred mode of the embodiments, the kit further comprises a fluorescent probe, and the nucleotide sequence of the fluorescent probe is shown in SEQ ID NO. 5.

[0054] SEQ ID NO. 5: TCAACGGCCAGGCATCTGACGCTGTGC.

[0055] In the present embodiment, the kit not only includes a specific primer pair, but also further includes a sequence-specific fluorescent probe matched therewith, so that higher detection specificity and reliability are achieved. The kit at least includes the following key components: a specific primer pair: the nucleotide sequence shown as SEQ ID NO: 3 (5'-GCGGAGGAACGTCGGCAATA-3') in the sequence listing as an upstream primer (F), and the nucleotide sequence shown as SEQ ID NO: 4 (5'-ACGGCATTCTGGACATGGAACG-3') as a downstream primer (R); and a specific fluorescent probe: this is one of the core features of the kit (TaqMan method) of the present embodiment, and the nucleotide sequence thereof is shown as SEQ ID NO: 5 in the sequence listing, i.e. 5'-TCAACGGCCAGGCATCTGACGCTGTGC-3'. The 5' end of the probe is labeled with a fluorescent reporter group (such as FAM), and the 3' end is labeled with a fluorescent quencher group (such as BHQ1 or TAMRA). In the complete probe molecule, the fluorescence emitted by the reporter group is absorbed by the quencher group, so no signal is generated.

[0056] In the qPCR amplification process, when the temperature of the reaction system is reduced to the annealing stage, the upstream primer, the downstream primer and the TaqMan probe are simultaneously specifically combined with the complementary regions on the target DNA template (the specific sequence of Ganoderma lucidum wood-rotting red yeast). Subsequently, in the extension stage, the Taq DNA polymerase extends along the template strand. When the polymerase encounters and binds to the probe that has been hybridized to the template, its 5'→3' exonuclease activity is activated to hydrolyze the probe one by one from the 5' end. Once the probe is hydrolyzed, the reporter group is separated from the quencher group, and the fluorescence signal is released and captured in real time by the optical detection system of the qPCR instrument. The fluorescence signal accumulates and increases with each cycle, and its intensity is proportional to the number of amplification products.

[0057] The kit of the present embodiment adopts the TaqMan probe method, realizes ultra-high specificity through double recognition of primers and probes, significantly reduces false positives, has high sensitivity and precise quantification capability, and effectively prevents amplification product contamination through closed tube operation, so as to ensure that the detection result is accurate, reliable and safe.

[0058] The third aspect of the present application provides:

[0059] A method for detecting Ganoderma applanatum in a sample, comprising the step of amplifying nucleic acid of the sample using the primer pair described above (a primer pair consisting of the nucleotide shown in SEQ ID NO. 1 and the nucleotide shown in SEQ ID NO. 2; or a primer pair consisting of the nucleotide shown in SEQ ID NO. 3 and the nucleotide shown in SEQ ID NO. 4) or the kit described above (comprising the primer pair described above).

[0060] Using the specific primer pair of the present application, the target sequence of Ganoderma applanatum can be efficiently and accurately amplified from complex biological samples (especially the environment coexisting with Ganoderma lucidum) specifically, without cross-reaction with the DNA of Ganoderma lucidum or other common bacteria. Combined with qPCR technology, the whole detection process is rapid (completed within 3 hours), sensitive, and can realize early diagnosis of the disease. This method can be used for qualitative detection and quantitative analysis, and provides a scientific and reliable technical means for monitoring, early warning and prevention and control of Ganoderma lucidum yellow foot disease.

[0061] As a preferred mode of the present embodiment, the amplification is real-time fluorescent quantitative PCR amplification. The present embodiment realizes rapid, sensitive and specific detection of the target pathogenic bacteria through real-time fluorescent quantitative PCR (qPCR) technology.

[0062] As a preferred mode of the present embodiment, when the primer pair consisting of the nucleotide shown in SEQ ID NO. 1 and the nucleotide shown in SEQ ID NO. 2 is used, the real-time fluorescent quantitative PCR amplification adopts SYBR Green I dye method.

[0063] SYBR Green I dye method: using a primer pair consisting of SEQ ID NO: 1 (5'-TGAGCGAGGTTACACTTT-3') and SEQ ID NO: 2 (5'-TCCTTACGGACATCAACA-3') in the sequence listing. The primer pair is mixed with SYBR Green I premix, dNTPs, Taq DNA polymerase, buffer and nucleic acid template to perform real-time fluorescent quantitative PCR amplification. After amplification, the specificity of the amplification product is confirmed by analyzing the melting curve.

[0064] For the SYBR Green method, if the amplification curve shows typical exponential growth and the melting curve shows a single, sharp peak, the sample is determined to be positive, i.e. containing Ganoderma applanatum; if there is no amplification curve or abnormal melting curve, it is determined to be negative.

[0065] The SYBR Green I dye method of the present embodiment is low in cost and easy to operate, and only specific primers are needed to realize rapid detection, which is suitable for large-scale preliminary screening sensitive to cost.

[0066] As a preferred mode of the present embodiment, when a primer pair consisting of the nucleotides shown in SEQ ID NO. 3 and SEQ ID NO. 4 is used, the real-time fluorescent quantitative PCR amplification uses TaqMan probe method, and the nucleotide sequence of the probe is shown in SEQ ID NO. 5.

[0067] TaqMan probe method: a primer pair consisting of SEQ ID NO: 3 (5'-GCGGAGGAACGTCGGCAATA-3') and SEQ ID NO: 4 (5'-ACGGCATTCTGGACATGGAACG-3') is used, and a specific fluorescent probe shown in SEQ ID NO: 5 (5'-TCAACGGCCAGGCATCTGACGCTGTGC-3') is used. The primers, probes, and corresponding qPCR premix and nucleic acid templates are mixed to perform real-time fluorescent quantitative PCR amplification. During the amplification process, the presence of the target sequence is determined by monitoring the real-time growth of the fluorescence signal.

[0068] For TaqMan probe method, if the amplification curve shows typical exponential growth, the sample is determined to be positive; if no obvious amplification curve appears within the set number of cycles (such as 40 or 45 cycles), it is determined to be negative. In addition, according to the Ct value of the sample, the content of the pathogenic bacteria in the sample can be relatively quantitatively analyzed by comparing with the standard curve.

[0069] The TaqMan probe method of the present embodiment has high specificity and reliable results, effectively avoids false positives through double recognition of primers and probes, reduces pollution through closed tube operation, and is suitable for high-precision detection and quantitative analysis.

[0070] As a preferred mode of the present embodiment, the sample is a ganoderma sample.

[0071] The detection method, primer pair and kit provided by the present application are mainly applied to ganoderma (Ganoderma lucidum) samples. Here, the "ganoderma sample" refers to various samples that may be infected by Monascus azaphilus during the cultivation, processing or flow process of ganoderma. Specifically, the ganoderma sample includes but is not limited to ganoderma fruiting bodies, ganoderma mycelium, cultivation substrates, and ganoderma spore powder or extracts, etc.

[0072] The fourth aspect of the present application provides:

[0073] A method for quantitatively detecting the content of M. azaphilus in a sample, comprising the following steps:

[0074] a) using the primer pair or the kit, real-time fluorescent quantitative PCR amplification is performed on a standard sample with known Ganoderma applanatum DNA content, Ct value is obtained, and a standard curve of Ganoderma applanatum DNA content and Ct value is established;

[0075] As a preferred mode of the present embodiment, first, a series of standard samples with known pathogenic fungus DNA content ratio (such as 0%, 10%, 20%,..., 100%) are prepared by mixing pure Ganoderma applanatum and Ganoderma DNA; then, real-time fluorescent quantitative PCR amplification is performed on the standard samples using the primer pair or the kit of the present application, and the Ct value of each sample is recorded; finally, linear regression analysis is performed with the pathogenic fungus DNA content (or the logarithmic value thereof) as the abscissa and the corresponding average Ct value as the ordinate, and a standard curve with good linear relationship (R² close to 1) is drawn, which is used for subsequent quantitative estimation of the pathogenic fungus content in unknown samples.

[0076] b) using the primer pair or the kit, real-time fluorescent quantitative PCR amplification is performed on a standard sample with known Ganoderma applanatum DNA content, Ct value is obtained, and a standard curve of Ganoderma applanatum DNA content and Ct value is established;

[0077] As a preferred mode of the present embodiment, first, total DNA is extracted from the Ganoderma sample to be tested as the nucleic acid template; then, according to the standard operating procedure of real-time fluorescent quantitative PCR (qPCR), the DNA template is mixed with the specific primer pair of the present application (or all necessary components in the kit including the primer pair, such as premix, probe, etc.) to prepare a qPCR reaction system; finally, the reaction system is placed in a qPCR instrument, and a set amplification program (including pre-denaturation and 40-45 cycles of denaturation-annealing / extension) is run, the instrument will monitor the fluorescence signal in real time and automatically analyze and generate an amplification curve, thereby obtaining the Ct value (threshold cycle number) of the unknown sample.

[0078] c) the Ct value obtained in step b) is substituted into the standard curve established in step a) to calculate the DNA content of Ganoderma applanatum in the unknown sample.

[0079] As a preferred mode of the present embodiment, the specific operation of substituting the Ct value of the unknown sample into the standard curve for quantification is as follows: after completing the qPCR amplification of the unknown sample and obtaining its Ct value, the Ct value is substituted as the ordinate (Y value) into the linear regression equation (Y = aX + b) of the standard curve of "Ganoderma applanatum DNA content and Ct value" established in step a), the corresponding abscissa value (X value) is calculated by back calculation, and the X value is the relative content (%) of Ganoderma applanatum DNA in the unknown sample or the logarithmic value thereof, thereby realizing quantitative analysis of the pathogenic fungus content.

[0080] The fifth aspect of the present application provides:

[0081] The use of the primer pair (i.e. the primer pair consisting of the nucleotide shown in SEQ ID NO. 1 and the nucleotide shown in SEQ ID NO. 2; or the primer pair consisting of the nucleotide shown in SEQ ID NO. 3 and the nucleotide shown in SEQ ID NO. 4) in the preparation of a product for detecting Ganoderma yellow foot disease.

[0082] The specific primer pair (consisting of SEQ ID NO: 1 and SEQ ID NO: 2, or consisting of SEQ ID NO: 3 and SEQ ID NO: 4) provided by the present application not only can be used for direct molecular detection, but also has important application value, and can be used for preparing a product for detecting Ganoderma yellow foot disease. For example, it can be a detection product, as a core molecular element, including but not limited to a kit, a gene chip or a high-throughput sequencing probe for preparing a diagnostic kit for Ganoderma yellow foot disease. By amplifying the specific target sequence of Ganoderma azaphilus, these products can quickly and accurately detect the pathogenic bacteria from Ganoderma samples, realize early warning and accurate diagnosis of the disease, and provide a scientific basis for prevention and control decision-making.

[0083] Example 1

[0084] A method for quantitatively detecting the content of Ganoderma azaphilus in a sample, comprising the following steps:

[0085] 1. Aligning Ganoderma azaphilus with Ganoderma genome, screening out the difference sequence specific to Ganoderma azaphilus, and designing specific primers accordingly, and verifying the specific primers by conventional PCR and electrophoresis detection. For nucleic acid samples containing Ganoderma azaphilus but with different DNA concentrations, using SYBR qPCR amplification based on the above primers, detecting the fluorescence signal, drawing the melting curve and the standard curve of Ganoderma azaphilus DNA concentration and Ct value.

[0086] 2. Designing specific primers and probes according to the difference sequence specific to Ganoderma azaphilus, verifying the qPCR amplification effect of the probe on each Ganoderma, and detecting the fluorescence signal. For nucleic acid samples containing Ganoderma azaphilus but with different DNA concentrations, using Taqman probe qPCR amplification based on the above primers, detecting the fluorescence signal, drawing the melting curve and the standard curve of Ganoderma azaphilus DNA concentration and Ct value.

[0087] Results:

[0088] 1. Two specific sequences were selected (see attached sequence information g5612.t1 and g12646.t1). Based on g5612.t1, a pair of specific primers were designed to amplify only the *Monascus purpureus* sample from decaying wood of Ganoderma lucidum, as shown in Table 1 below.

[0089] Table 1 Specific primer pairs

[0090]

[0091] First, a standard PCR experiment was performed. The reaction system consisted of 20 μl of 2×Rapid Taq Master Mix, as shown in Table 2 below.

[0092] Table 2 Conventional PCR reaction system

[0093]

[0094] Reaction program: 94°C for 3 min; 94°C for 15 s, 58°C for 15 s, 72°C for 30 s, 32 cycles; 72°C for 5 min

[0095] Four types of Ganoderma lucidum (namely "Guangzhi No. 3", "M624", "Hunong Ganoderma lucidum", and "Hanzhi") were selected as control samples. Amplification was performed on samples treated with *Monascus purpureus* from decaying Ganoderma lucidum wood. ITS-PCR products were used as supplementary controls. Electrophoretic detection of the products was performed (e.g.,...). Figure 1 As shown in the figure, the results showed that only Monascus purpureus from decaying Ganoderma lucidum could amplify specific bands.

[0096] Figure 1 Among them, No. 1 is Ganoderma lucidum decaying wood with Monascus purpureus, and Nos. 2-5 are Guangzhi No. 3, M624, Hu Nong Ganoderma lucidum, and Hanzhi, respectively.

[0097] 2. DNA was extracted from Monascus purpureus and Ganoderma lucidum separately. The concentration was measured using an ultra-micro spectrophotometer and diluted to a uniform concentration (40 ng / μl). Samples containing different concentrations of Monascus purpureus DNA were prepared by sequentially mixing the samples in 96-well plates. Specifically, the DNA of Monascus purpureus and Ganoderma lucidum were mixed in a certain proportion to prepare DNA mixtures with a concentration of Monascus purpureus DNA ranging from 0% to 100%, corresponding to groups G0, G1, G2, G3, G4, G5, G6, G7, G8, G9, and G10, as shown in Table 3 below.

[0098] Table 3. DNA percentage of *Monascus purpureus* in the mixed sample of *Ganoderma lucidum*.

[0099]

[0100] Based on SYBR qPCR detection, the reaction system (20 μl) is shown in Table 4 below, and the reaction conditions are shown in Table 5 below:

[0101] Table 4. qPCR detection reaction system based on SYBR method

[0102]

[0103] Table 5. qPCR detection reaction procedure based on SYBR method

[0104]

[0105] Results with large differences in each group were removed, and the Ct values ​​were calculated as shown in Table 6 below:

[0106] Table 6. Ct values ​​based on SYBR qPCR detection

[0107]

[0108] Plot the amplification curve, such as Figure 2 As shown.

[0109] A scatter plot was plotted based on the DNA content of *Monascus purpureus* from decaying Ganoderma lucidum wood in the samples and the Ct values ​​of qPCR. (See attached image) Figure 3 As shown.

[0110] Further, a correlation curve was plotted between the Ct value and the DNA content of *Monascus purpureus* from decaying Ganoderma lucidum wood, such as... Figure 4 As shown.

[0111] The results showed that when the template DNA did not contain Monascus purpureus DNA, the Ct value was approximately 29, while when the template DNA contained 10% Monascus purpureus DNA, the Ct value decreased to approximately 17. The difference in Ct values ​​between the two was significant, and the Ct value decreased as the Monascus purpureus content increased. This indicates that once Ganoderma lucidum is infected with Monascus purpureus, this detection method can rapidly detect it, and the Monascus purpureus DNA content can be estimated based on the Ct value.

[0112] 3. To further improve detection accuracy, specific amplification primers and TaqMan probe sequences were designed based on the specific sequence g12646.t1, as shown in Table 7 below. The reaction system (20 μl) for qPCR detection using the TaqMan probe method is shown in Table 8 below, and the reaction conditions are shown in Table 9 below.

[0113] Table 7 TaqMan qPCR Primer and Probe Sequences

[0114]

[0115] Table 8. Probe-based qPCR detection reaction system

[0116]

[0117] Table 9. Reaction conditions for probe-based qPCR detection

[0118]

[0119] The qPCR amplification effects of the primer and probe sequences on *Monascus purpureus* and various *Ganoderma* species were verified separately, as follows: Figure 5 , 6 As shown in Figures 7 and 8.

[0120] The qPCR Ct values ​​of *Monascus purpureus* and various *Ganoderma lucidum* samples are shown in Table 10 below:

[0121] Table 10. Ct values ​​of specific probes against Monascus purpureus and various Ganoderma lucidum samples.

[0122]

[0123] When using the TaqMan probe method for qPCR detection, *Monascus purpureus* (with signal) was successfully amplified and a specific fluorescent signal was detected, indicating that the primer and probe design was effective and that the target sequence of this species was present in the sample. However, no obvious amplification curve was observed for *Ganoderma lucidum* (including Guangzhi 3, M624, Hu Nong Ganoderma, and Hanzhi) (without signal). This demonstrates that the primers used in this system (including common primers and probes) can effectively distinguish *Monascus purpureus* from *Ganoderma lucidum*.

[0124] 4. The TaqMan probe method was used to detect samples containing different concentrations of *Monascus purpureus* from *Ganoderma lucidum*. DNA was extracted from both *Monascus purpureus* and *Ganoderma lucidum*, and the concentrations were measured using an ultra-micro spectrophotometer and diluted to a uniform concentration (30 ng / μl). Samples containing different concentrations of *Monascus purpureus* DNA were prepared sequentially in 96-well plates. Specifically, the DNA from *Monascus purpureus* and *Ganoderma lucidum* was mixed in a certain proportion to create DNA mixtures with concentrations ranging from 0% to 100%, corresponding to groups G0, G1, G2, G3, G4, G5, G6, G7, G8, G9, and G10, as shown in Table 11 below.

[0125] Table 11. DNA percentage of Monascus purpureus in Ganoderma lucidum decay samples (for probe method detection)

[0126]

[0127] Results with large differences in each group were removed, and the Ct values ​​were calculated as shown in Table 12 below. Amplification curves were plotted based on fluorescence signal intensity. Figure 9 .

[0128] Table 12 Ct values ​​based on probe-based qPCR detection

[0129]

[0130] A scatter plot was drawn based on the DNA content of *Monascus purpureus* in the rotten wood of *Ganoderma lucidum* in the samples and the Ct value of qPCR (see...). Figure 10 Further, a correlation curve was plotted between the Ct value and the DNA content of *Monascus purpureus* on decaying wood of Ganoderma lucidum (see...). Figure 11 ).

[0131] The results showed that when the template DNA did not contain Monascus purpureus DNA, the Ct value was approximately 35, while when the template DNA contained 10% Monascus purpureus DNA, the Ct value decreased to approximately 21. The difference between the two Ct values ​​was significant, and the Ct value generally decreased as the Monascus purpureus DNA content increased. This indicates that once Ganoderma lucidum is infected with Monascus purpureus, this detection method can quickly detect it, and the Monascus purpureus DNA content in the template can be roughly estimated based on the Ct value.

[0132] Attached sequence information:

[0133] a) g5612.t1

[0134] TCCATTGTCGGTCGCCCCCGTCACCATGGTATCATGATTGGTATGGGTCAGAAGGACTCCTACGTTGGTGATGAGGCACAGTCGAAGCGTGGTATCCTTACCCTCAGATATCCTATCGAGCACGGTGTCGTTACCAACTGGGACGACATGGAGAAGATCTGGCATCACACCTTCTACAATGAGCTCCGTGTGGCTCCTGAGGAACACCCAGTCTTGCTCACTGAGGCTCCTATCAACCCTAAGTCCAACAGAGAGAAGATGACCCAGATTGTTTTCGAGACCTTCAACGCCCCAGCCTTCTATGTCTCCATCCAAGCTGTCCTGTCTTTGTACGCTTCCGGTCGTACCACTGGTATTGTGCTCGACTCCGGTGACGGAGTTACCCACGTTGTCCCCATCTACGAAGGTTTCTCTCTTCCTCACGCCATTGCTCGTGTCGATATGGCTGGTCGTGATTTGACCGACTACTTGATGAAGATCTTGGCTGAGCGAGGTTACACTTTCTCTACCACTGCCGAGCGAGAAATTGTCCGTGACATTAAGGAGAAGCTTTGCTATGTTGCTCTTGACTTCGAGCAAGAAATCCAGACTGCTAGCCAGAGCTCTACCTTGGAGAAGTCCTACGAACTTCCTGATGGGCAGGTCATCACTATTGGTAATGAGCGTTTCCGTGCTCCTGAGGCTCTCTTCCAGCCAAGCGTCTTGGGTCTCGAGTCTGGCGGTATCCACGTCACCACCTTCAACTCCATCATGAAGTGTGATGTTGATGTCCGTAAGGATCTATATGGTAACATTGTTATGTCTGGTGGAACCACCATGTACCCAGGTATCTCCGACCGTATGCAGAAGGAAATCACTGCTCTTGC

[0135] b) g12646.t1

[0136] ATGACCCAACAGTCGCTCGACATGGGCTACGAGAAGGCTTTCGGTCCCAAGGACTGGCGGAGGAACGTCGGCAATACGGTCAACGGCCAGGCATCTGACGCTGTGCGAGACCAGATCATGCGTCACAACAACCACTCCAACGTCTTCCAGGACGCGTACCTCAACGCTCAC GTGACGTTCCATGTCCAGAATGCCGTTCTCGGCGAGCCCCTAGAGGCGCAGATGCTCCAAATGTTGTCCCACGTTGGCCATACCCGCGACCCCCGTGCTAGCAGCGATATGGTCCCTGACGAGCTATGGGCTCNATCTCCCGCCGGATGCCGAGATCCAGGCGCTCGAGAAG CAGAGGGAGGTGCTGAAGGGCGGCAAGTTCCATATCAAGGGTTCTCCGACGAGGATGCCATCAAGCATCTGACTACCCTCATCGCGNCGCGCGAAAGCCGCGCGGAAGAGGCGGGTCAAGCNGCGACTACCGCGCCTACTATTTCGAAAACCGCCCCACGTGGGACTTGC AACGGCAGGCCAACGGCGACGCACCGGTCCGGGCCGACAAGCCTCCGCGGAACCTCCTGCTGCCCGAGCGTGCTCGCCTGGCCAGTCTTCTCTGCGACCAGCCTGGCGANCTTGGACCCTGACGAGCTCCACCAGCGTCGCATCGAGGCCGGCACGTGCATGGTCAACCTCG

[0137] The above description is only a preferred embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any equivalent substitutions or modifications made by those skilled in the art within the scope of the technology disclosed in the present invention, based on the technical solution and concept of the present invention, should be covered within the scope of protection of the present invention.

Claims

1. A primer pair for detecting Monascus purpureus on decaying Ganoderma lucidum wood, characterized in that, The primer pair consists of the nucleotides shown in SEQ ID NO.1 and SEQ ID NO.2; or consists of the nucleotides shown in SEQ ID NO.3 and SEQ ID NO.

4.

2. A kit for detecting Monascus purpureus on decaying Ganoderma lucidum wood, characterized in that, The kit includes the primer pair as described in claim 1.

3. The reagent kit according to claim 2, characterized in that, It also includes a fluorescent probe, the nucleotide sequence of which is shown in SEQ ID NO.

5.

4. A method for detecting Monascus purpureus on decaying Ganoderma lucidum wood in a sample, characterized in that, The step includes amplifying the nucleic acid of the sample using the primer pair as described in claim 1 or the kit as described in any of claims 2-3.

5. The method according to claim 4, characterized in that, The amplification was performed using real-time quantitative PCR.

6. The method according to claim 5, characterized in that, When using primer pairs consisting of the nucleotides shown in SEQ ID NO.1 and SEQ ID NO.2, the real-time quantitative PCR amplification is performed using the SYBR Green I dye method.

7. The method according to claim 5, characterized in that, When using primer pairs consisting of the nucleotides shown in SEQ ID NO.3 and SEQ ID NO.4, the real-time quantitative PCR amplification employs the TaqMan probe method, and the nucleotide sequence of the probe is shown in SEQ ID NO.

5.

8. The method according to any one of claims 4 to 7, characterized in that, The sample was a Ganoderma lucidum sample.

9. A method for quantitatively detecting the content of *Monascus purpureus* in decaying wood of *Ganoderma lucidum* in a sample, characterized in that... Includes the following steps: a) Using the primer pair described in claim 1 or the kit described in any of claims 2-3, perform real-time quantitative PCR amplification on standard samples with known Ganoderma lucidum decay wood rotten Monascus DNA content, obtain Ct values, and establish a standard curve of Ganoderma lucidum decay wood rotten Monascus DNA content versus Ct values. b) Using the primer pair described in claim 1 or the kit described in any of claims 2-3, perform real-time fluorescence quantitative PCR amplification on the nucleic acid of the unknown sample to obtain the Ct value; c) Substitute the Ct value obtained in step b) into the standard curve established in step a) to calculate the DNA content of Monascus purpureus in the unknown sample.

10. Use of the primer pair according to claim 1 in the preparation of a product for detecting Ganoderma lucidum yellow foot disease.

Images