SIGLEC15 targeting nucleic acid aptamer probe and related application
By developing nucleic acid aptamer probes targeting SIGLEC15, the problem of detecting SIGLEC15 expression levels in existing technologies has been solved, realizing an efficient and non-invasive detection method to guide cancer treatment.
Patent Information
- Application Number
- CN202511309637.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-15
- Publication Date
- 2025-12-23
AI Technical Summary
Current technologies lack efficient and non-invasive methods to detect SIGLEC15 expression levels in cancer patients, which affects the precision and efficacy of immunotherapy.
Develop nucleic acid aptamer probes targeting SIGLEC15, including nucleic acid aptamers, coupling agents, and radionuclides, for the preparation of nuclear medicine molecular probes and fluorescent probes, to achieve high affinity and high specificity detection of SIGLEC15 through imaging and in vitro detection.
It achieves efficient, non-invasive, dynamic detection of SIGLEC15, guiding the formulation of clinical treatment plans and monitoring treatment effects, breaking through the detection difficulties of existing technologies, and has economic and social value.
Smart Images

Figure CN121182811A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biology and molecular imaging technology, and in particular to a nucleic acid aptamer probe targeting SIGLEC15 and its related applications. Background Technology
[0002] Cancer is a major global public health problem, posing a huge threat to human life and health. It is reported that cancer causes 10 million deaths annually. Cancer prevention and treatment face severe challenges and have always been a hot topic of global concern. Today, the emergence of immunotherapy has opened a new chapter in cancer treatment. For example, immune checkpoint-related biologics such as blocking cytotoxic T-lymphocyte-associated protein 4 (CTLA-4), programmed cell death-1 (PD-1) / programmed cell death ligand 1 (PD-L1), and sialic acid-binding immunoglobulin-like lectin 15 (SIGLEC15) have been proven to be effective strategies for cancer immunotherapy.
[0003] SIGLEC15, an adhesion molecule belonging to the immunoglobulin superfamily, has been shown to be a novel immunosuppressive target and a potential target for normalizing cancer immunotherapy, and it is non-redundant with the well-known PD-1 / PD-L1 pathway. SIGLEC15 interacts with the adaptor protein DAP12, activating the Syk signaling pathway and regulating the RANKL / RANK-mediated PI3K, AKT, and ERK signaling pathways. It plays a crucial role in regulating the tumor microenvironment by activating the SYK / MAPK signaling pathway. Therefore, SIGLEC15 has the potential to become an alternative therapeutic target for cancers unresponsive to PD-L1 / PD-1 immunotherapy.
[0004] Multiple studies have shown that SIGLEC15 is widely overexpressed in human cancer cells and can serve as a prognostic biomarker for cancer patients. Numerous clinical trials have confirmed the significant anti-tumor effects of anti-SIGLEC15 therapy on patients with malignant tumors. Precise screening of patients with positive SIGLEC15 expression is crucial for the efficacy of immunotherapy. Therefore, there is an urgent need to establish an efficient, accurate, and non-invasive detection method. Summary of the Invention
[0005] In light of this, this invention analyzed the expression levels of SIGLEC15 in pan-cancer and tumor cell lines. Using overlap assays, IFA, and the Vector Builder database, a novel nucleic acid aptamer ts3 (a single-stranded DNA) targeting SIGLEC15 was provided, and different probes were developed for pan-cancer analysis, surgical navigation, and radionuclide imaging. Based on the forefront of nuclear medicine and translational medicine, preclinical basic research and clinical translational research were conducted, providing new directions for cancer diagnosis and treatment.
[0006] This invention provides the application of a nucleic acid aptamer targeting SIGLEC15 in the preparation of molecular probes targeting SIGLEC15, characterized in that the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1;
[0007] SEQ ID NO.1: AGCGGGTTGGTGGGCAAGAGGATGTTTATTTCATTGGTGTGCTGT;
[0008] The molecular probes include nuclear medicine molecular probes and fluorescent probes.
[0009] The present invention also provides the application of a nucleic acid aptamer targeting SIGLEC15 in the preparation of nuclear medicine molecular probes targeting SIGLEC15, characterized in that the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.
[0010] The present invention also provides the application of a nucleic acid aptamer targeting SIGLEC15 in the preparation of a fluorescent probe targeting SIGLEC15, characterized in that the nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.
[0011] This invention provides a molecular probe comprising a nucleic acid aptamer targeting SIGLEC15;
[0012] The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1.
[0013] The present invention also provides a nuclear medicine molecular probe comprising a nucleic acid aptamer targeting SIGLEC15, a coupling agent, and a radionuclide;
[0014] The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1;
[0015] The coupling agents include DOTA, NOTA, HYNIC, and DTPA.
[0016] The radionuclides include 99 Tc, 68 Ga、 18 F, 123 I, 125 I, 131 I, 111 In、 67 Ga、 64 Cu、 89 Zr、 11 C 177 Lu and 188 Re.
[0017] The present invention also provides a fluorescent probe comprising a nucleic acid aptamer targeting SIGLEC15 and a labeling substance;
[0018] The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1;
[0019] The labeling substances include small organic molecule dyes, fluorescent proteins, and luminescent macromolecular complexes.
[0020] In this invention, the above-mentioned molecular probe and fluorescent probe are used in in vitro detection.
[0021] In this invention, the above-mentioned nuclear medicine molecular probes are used in imaging detection.
[0022] The present invention also provides a biomaterial targeting SIGLEC15, the biomaterial comprising nucleic acid aptamers, antibodies, peptides and small molecules.
[0023] In this invention, the application of the above-mentioned molecular probes, nuclear medicine molecular probes, fluorescent probes and biomaterials in the preparation of products for targeted screening, diagnosis, treatment or prognosis assessment of diseases is characterized in that the diseases include glioma, lung cancer, melanoma, pancreatic cancer, breast cancer, ovarian cancer, esophageal cancer, liver cancer, thyroid cancer, gastric cancer, colorectal cancer and cervical cancer.
[0024] SIGLEC15 is a human gene highly expressed on tumor cells and tumor-associated macrophages, acting as a transmembrane protein that regulates tumor progression. This invention targets SIGLEC15 and prepares its associated ligands, namely SIGLEC15-targeting ligands. These ligands can be antibodies, nucleic acid aptamers (DNA or RNA single-stranded molecules), peptides, nanobodies, small molecules, and other biomaterials. Based on these aptamers, this invention labels the SIGLEC15-targeting nucleic acid aptamer ts3 with fluorescent materials such as CY5 and FITC to prepare fluorescent molecular probes. Simultaneously, ts3 is labeled with NOA (a coupling agent) and a radionuclide to prepare radioactive molecular probes.
[0025] This invention provides a high-affinity, high-specificity molecular probe targeting SIGLEC15. It is a fluorescent molecular probe of SIGLEC15 nucleic acid aptamers labeled with FITC and CY5, which can be used for in vitro detection of SIGLEC15 in cells and tissues. Simultaneously, it also provides a nuclear medicine molecular probe targeting SIGLEC15, suitable for in vivo PET / CT, SPECT / CT, and other imaging detection. The probe provided by this invention has advantages in synthesis, including readily available raw materials, low cost, simple labeling methods, mild reaction conditions, and stable products that are easy to store and transport, facilitating widespread adoption. In practical applications in in vivo imaging, it exhibits good pharmacokinetics and excellent SIGLEC15 targeting, enabling non-invasive dynamic detection of SIGLEC15 expression on the surface of tumor cells and in lesions with abnormal SIGLEC15 expression, guiding the formulation of clinical treatment plans, and monitoring treatment efficacy. This invention overcomes key problems existing in current technologies, effectively fills a gap in the industry, is beneficial for clinical research and translation, and has certain economic and social value. Attached Figure Description
[0026] Figure 1 The expression levels of SIGLEC15 in cancer types and tumor cell lines;
[0027] Figure 2 Preparation of SIGLEC15-targeting nucleic acid aptamers;
[0028] Figure 3 For the screening and identification of fluorescent aptamer probes;
[0029] Figure 4 FITC-labeled aptamer probes were used to detect their affinity for tumor tissue and tumor cells;
[0030] Figure 5 For animal fluorescence imaging and biological distribution studies;
[0031] Figure 6 For SIGLEC15 targeted aptamer nuclear medicine probes [ 68 Preparation of Ga]-NOTA-ts3;
[0032] Figure 7 for[ 68 Ga]-NOTA-ts3 small animal PET-CT imaging. Detailed Implementation
[0033] For reagents or instruments used in the following text where specific technical or conditional specifications are not given, standard experimental conditions shall apply. If no reagent company instructions are explicitly provided, the conditions recommended in those instructions shall be followed. Reagents or instruments whose manufacturers are not specified are all commercially available standard products.
[0034] Example 1
[0035] High expression of SIGLEC15 in tumor tissues and cells
[0036] 1. HeLa, U87, BEAS-2B, PC9, and Hepa1-6 cell lines were purchased from BIOWING Biotechnology Co., Ltd. All chemical reagents were of analytical grade.
[0037] 2. Animal experiments were conducted using 4-week-old female nude mice (Beijing Hanfei Biotechnology Co., Ltd., China). 1×10⁻⁶ mice were subcutaneously injected into the right shoulder. 7 HeLa cells or U87 cells. When the tumor diameter reaches approximately 0.7 cm, in vivo studies are conducted on animals.
[0038] 3. Expression of SIGLEC15
[0039] The expression levels of SIGLEC15 in all cancer types and tumor cell lines were preliminarily analyzed using the Human Protein Atlas Database (HPA) (http: / / gepia.cancer-pku.cn / ). Specifically... Figure 1 As shown.
[0040] 4. RT-qPCR
[0041] Total RNA was extracted from HeLa, U87, and BEAS-2B cells using the TRIeasy™ Total RNA Extraction Reagent (YEASEN) according to the manufacturer's instructions. cDNA was obtained by qPCR (YEASEN) using the Hifair R III 1st Strand cDNA Synthesis Super Mixture. The quantitative PCR platform used in this study was a 7500 Rapid Real-Time PCR instrument. The genes SIGLEC15 (ID 284266) and GAPDH (ID 2597) were obtained from the National Center for Biotechnology Information database (https: / / www.ncbi.nlm.nih.gov / ).
[0042] The reaction mixture was 20 μL, consisting of 10 μL HieffUNICONR and 0.4 μL of universal qPCR SYBR Green major mixture (YEASEN). The transcriptional level of the SIGLEC15 gene was calculated using the "-ΔΔCt" method.
[0043] Specific primers are as follows:
[0044] SIGLEC15 forward primer: 5'-CGCGGATCGTCAACATCTC-3', SEQ ID NO.2,
[0045] SIGLEC15 reverse primer: 5'-GTTCGGCGGTCACTAGGTG-3', SEQ ID NO.3,
[0046] GAPDH forward primer: 5'-ACAACTTTGGTATCGTGGAAGG-3', SEQ ID NO.4
[0047] GAPDH reverse primer: 5'-GCCATCACGCCACAGTTTC-3', SEQ ID NO.5.
[0048] The primers mentioned above were synthesized by Henan Shangya Biotechnology Co., Ltd.
[0049] 5. Western blotting
[0050] The experimental procedure for Western blotting is briefly described below. Total protein (30 μg) was extracted from PC9, HeLa, and BEAS-2B cells, boiled in loading buffer for 10 min, and then analyzed by 12% SDS-PAGE. The protein was then transferred to a polyvinylidene fluoride (PVDF) membrane. The PVDF membrane was blocked overnight at 4°C with 5% skim whey protein, and then incubated at 37°C for 1 h with anti-SIGLEC15 (Affinity) or anti-GAPDH human monoclonal antibody (Sigma-Aldrich) (diluted 1:1000 with PBST solution). After three washes with PBST, the binding of specific antibodies was monitored by incubation at 37°C for 1 h with HRP-chelated goat anti-mouse IgG. Five washes were then performed, and the target band was detected using an ECL kit (YEASEN).
[0051] 6. Clinical samples
[0052] Clinical samples were obtained from an existing sample bank approved by the Ethics Committee of Henan Cancer Hospital, with ethics number 2021-KY-0183. These clinical samples included paraffin-embedded tissue sections from tumors of 32 cervical cancer patients, with a median age of 55 years (age range 25-69 years, female), and clinical stages II, III, and IV (a+b). The histological types of tumors were squamous cell carcinoma (7 cases) and adenocarcinoma (25 cases). These tissues were used for immunohistochemical (IHC) analysis.
[0053] 7. Immunohistochemistry (IHC)
[0054] The immunohistochemical procedure is briefly described as follows: Paraffin sections were incubated at 65°C for 3 hours, then soaked in xylene for 20 minutes, followed by dehydration in 100%, 100%, 85%, and 75% ethanol for 5 minutes each. After rinsing with deionized water (ddw), the sections were treated with EDTA antigen retrieval solution (pH 9.0) in a microwave oven. After rinsing with PBS, the paraffin sections were soaked in 3% H2O2 at room temperature (RT) for 20 minutes, then rinsed with PBS. The paraffin sections were incubated with anti-SIGLEC15 antibody or Ki67 antibody for 1 hour at 37°C. They were then rinsed three times with PBS, and then incubated with 1:1000 diluted HRP-chelated goat anti-mouse IgG for 1 hour at 37°C. After rinsing with PBS, the sections were stained with DAB solution. The results were detected using an automated slide scanner (KF-PRO-020). All images were viewed and analyzed using NDP.view 2.0 software.
[0055] Samples were analyzed and evaluated by three pathologists, and a composite score was derived based on the Immunoreactivity Score (IRS) system. The intensity of pathological staining (negative = 0, weakly positive = 1, moderately positive = 2, strongly positive = 3) and the percentage of positive cells (<5% = 0, 5%–25% = 1, 25%–50% = 2, 50%–75% = 3, >75% = 4) were both taken into account. The scores were then multiplied. The final staining result (IRS score) was categorized as: negative (0–3 points), low (3–6 points), moderate (6–9 points), and high (≥9 points).
[0056] Example 2
[0057] 1. Design of SIGLEC15 targeted nucleic acid aptamers
[0058] A novel truncated version of the previously reported SIGLEC15-targeting nucleic acid aptamer WXY3 was obtained using an overlap method. Continuous overlapping truncated sequences (ts1, ts2, ts3) covering the entire region of WXY3 were designed, such as... Figure 2 As shown in A, the secondary structure of these aptamers is predicted using the Vector Builder database (https: / / en.vectorbuilder.com / tool / dna-secondary-structure.html).
[0059] Aptamer sequence:
[0060] WXY3: AAGGAGCAGC GTGGAGGATA AGCGGGTTGG TGGGCAAGAGGATGTTTATT TCATTGGTGTGCTGTTTAGG GTGTGTCGTC GTGGT, SEQ ID NO.6;
[0061] ts1: AAGGAGCAGC GTGGAGGATA AGCGGGTTGG TGGGCAAGAG GATGTTTATTTCATT, SEQID NO.7;
[0062] ts2: TGGGCAAGAG GATGTTTATT TCATTGGTGT GCTGTTTAGG GTGTGTCGTCGTGGT, SEQID NO.8;
[0063] ts3: AGCGGGTTGG TGGGCAAGAG GATGTTTATT TCATTGGTGT GCTGT, SEQ ID NO.9.
[0064] 2. Synthesis, purification and analysis of amino intermediates of nucleic acid aptamers
[0065] The synthesis steps of the nucleic acid aptamer intermediate, namely the amino intermediate (Amino-Apt), are as follows.
[0066] The dA, dG, dC, and dT phosphorus amide monomers, Amino-Modifier C7-TFA phosphorus amide monomer, acetonitrile, deprotecting agent, oxidizing agent, coupling agent, and capping agent were placed in their respective positions in an ABI 394 solid-phase synthesizer. Sequence information was input, and the synthesis program was started. Using the solid-phase synthesis method for phosphorus amides, starting with the attachment of the dT solid-phase support, phosphorus amide monomers were sequentially added from the 3'-5' direction according to the nucleotide arrangement sequence. Each phosphorus amide monomer attachment involved four steps: deprotection, coupling, oxidation, and capping, yielding a sequence with a solid-phase support and protecting group. The conditions for each reaction step are as follows:
[0067] (1) Deprotection: Add decapping agent and react for 3 minutes.
[0068] (2) Coupling reaction: Add activator 1 and couple for 12 min or add activator 2 and couple for 15 min.
[0069] (3) Oxidation reaction: Add 0.05M iodine solution and oxidize for 2 min or add 0.025M iodine solution and oxidize for 1 min.
[0070] (4) Capping reaction: Add capping agent A / capping agent B (1 / 1, v / v) solution, capping time 20s.
[0071] The sequence containing the solid support and protecting group was added to a 2 mL centrifuge tube, followed by 1 mL of 25%–28% ammonia solution. The mixture was reacted at 55 °C for 16 h, cooled, filtered, and then washed three times with 0.5 mL of 50% ethanol aqueous solution to remove the solid support. The filtrates were combined, concentrated, and dried to obtain the crude amino intermediate Amino-Apt.
[0072] The crude amino intermediate Amino-Apt was dissolved in 1 mL of RNase-free deionized water and purified by ion-pair reversed-phase high-performance liquid chromatography (IP-RP-HPLC, Waters 2545). A Waters X-Bridge C18 column (5 μm, 10 mm × 250 mm) was used for elution with a linear gradient of 5%–65% buffer B over 45 min at a flow rate of 5 mL / min (buffer A: 0.1 M TEAA, buffer B: ACN). The collected samples were analyzed by HPLC (Waters 2695) and MS (Thermo LTQXL) to confirm the accuracy and purity of the synthesis. The amino intermediate Amino-Apt was obtained after quantification with Nanodrop One and freeze-drying.
[0073] A schematic diagram illustrating the design and preparation of the SIGLEC15-targeted nucleic acid aptamer is shown below. Figure 2 As shown.
[0074] Example 3
[0075] Preparation and Identification of SIGLEC15 Targeted Nucleic Acid Aptamer Fluorescent Probes
[0076] 1. Fluorescent labels were added to the 5' end of the above-mentioned amino intermediate Amino-Apt, and then identified by high-performance liquid chromatography (HPLC). The fluorescent (FITC, CY5) labeled aptamer probes were prepared by Shangya Biotechnology Co., Ltd., and ts1-FITC, ts2-FITC, ts3-FITC, WYX3-FITC and ts3-CY5 were obtained.
[0077] 2. Indirect immunofluorescence assay (IFA)
[0078] The IFA procedure is briefly described as follows: After fixation, the tissues and cells were washed three times with PBS solution, and then blocked with 5% defatted emulsion for 1 hour at room temperature. Cells were incubated with the anti-SIGLEC15 fluorescent probe (diluted 1:2000 in ddw) at room temperature for 1 hour. Subsequently, the cells were washed three times each with PBS and ddw, for a total of five washes, and then observed using a fluorescence inverted microscope or a laser scanning confocal microscope.
[0079] Fixed tissue sections from tumor-bearing mice were provided by Professor Bao Dengke (Cancer Biomarkers and Liquid Biopsy Laboratory, School of Pharmacy, Henan University).
[0080] Screening and identification of fluorescent aptamer probes, such as Figure 3 As shown.
[0081] Example 4
[0082] Small animal fluorescence imaging and biodistribution of SIGLEC15 targeted nucleic acid aptamer fluorescent probe
[0083] 1. Establishment of a HeLa tumor-bearing mouse model of cervical cancer
[0084] BALB / c nude mice (4–5 weeks old, female, SPF grade) used in the experiment were purchased from Vital River Laboratory Animal Co., Ltd. To construct the xenograft model, cervical cancer (HeLa) cells were resuspended in PBS (1×10⁻⁶). 7 100 μL of cell suspension (cells / mL) was subcutaneously injected into the right shoulder of mice using an insulin needle. When the tumor volume reached 200–300 mm², the cells were inoculated. 3 At that time, the nucleic acid aptamer fluorescent probe and blocking reagent were injected via the tail vein, followed by fluorescence imaging of the small animals. Mouse housing environment: They were housed in an SPF-grade clean animal room with continuous constant temperature (25±2℃) and humidity (50%~70%), with a light-dark cycle of 12h light + 12h dark.
[0085] 2. Animal fluorescence imaging
[0086] Tumor-bearing nude mice (n=5) were injected with ts3-CY5 (2 μM) via the tail vein. For the blockade group, tumor-bearing mice were pretreated with a 100-fold overdose of ts3 (unlabeled, as a blocker) 1 h prior to injection. Mice were anesthetized with 3% (v / v) isoflurane and placed on an imaging table, with 1% (v / v) isoflurane continuously administered to maintain anesthesia during imaging. Fluorescence intensity of the in situ tumors was monitored using an IVIS200 imaging system at 2 and 4 h post-injection. Imaging data were analyzed using Living Image 4.7.3 software.
[0087] 3. Biological distribution research
[0088] Following injection, tumor-bearing nude mice were euthanized and dissected. Major organs, including the heart, lungs, liver, spleen, kidneys, muscles, and tumors, were collected for imaging, and the corresponding regions were recorded using the IVIS200 imaging system. The imaging data were analyzed using Living Image 4.7.3 software.
[0089] 4. Hematoxylin-eosin (H&E) staining
[0090] Tissues from major organs, including the heart, lungs, liver, spleen, kidneys, muscles, and tumors, were extracted from tumor-bearing nude mice. These tissues were fixed in 10% neutral buffer, embedded in paraffin, and cut into 4-micrometer-thick sections for further analysis. Tumor sections were stained with H&E for histological observation.
[0091] Example 5
[0092] Synthesis, purification and analysis of nuclear medicine probes
[0093] 1. Synthesis, purification and analysis of nuclear medicine probe precursors
[0094] Chemical synthesis of the probe precursor NOA-aptamer. TS3 (3.10 mg, 0.21 μmol) was dissolved in PBS (0.31 mL), followed by the addition of 77.50 μL of DMSO solution containing NOA-NHS activated ester (0.85 mg, 2.12 μmol). The reaction was carried out at 25 °C for 16 h to complete the coupling reaction. The crude NOA-TS3 probe precursor was obtained after precipitation with ethanol and centrifugation.
[0095] Further purification of the crude product was performed. The crude NOTA-ts3 probe precursor was dissolved in 1 mL of RNase-free deionized water and purified by ion-pair reversed-phase high-performance liquid chromatography (IP-RP-HPLC, Waters 2545). A linear gradient of 5%–85% buffer B was used, and elution was carried out over 60 min at a flow rate of 5 mL / min (Buffer A: 0.1 M TEAA, Buffer B: ACN). After purification, the collected samples were analyzed by HPLC and MS to verify their purity and structural accuracy. The qualified fraction was quantified using a Nanodrop One instrument, and after freeze-drying, the NOTA-ts3 nucleic acid aptamer nuclear medicine probe precursor targeting SIGLEC15 was finally obtained (1.50 mg, 0.10 μmol, yield 48.39%).
[0096] 2. Isotopes 68 Ga mark
[0097] Nuclear medicine probes 68Preparation steps of Ga-NOTA-ts3: First, use hydrochloric acid solution (4 mL, 0.05 M) from... 68 Ge / 68 Radioactive isotopes were leached out of the Ga generator. 68 Ge] 3+ Take the one with the highest radioactivity concentration. 68 Ga] 3+ The eluent (1.4 mL) was transferred to a reaction tube for subsequent experiments. The solution was then diluted with sodium acetate solution (0.25 M) to […]. 68 Ga] 3+ The pH of the eluent system was adjusted to 4, and finally the nucleic acid aptamer probe precursor Nota-ts3 (80 μg) was added. After thoroughly mixing the reaction solution, it was reacted at 37°C for 15 min, with the reaction system shaken every 5 min to ensure uniform mixing. 68 Ga] 3+ It fully binds with NOTA-TS3. The reaction solution was then diluted with 20 mL of water and purified using a PD-10 column (GE Healthcare, Boston, USA) to remove residual [[]. 68 Ga] 3+ The probe was obtained by elution with PBS. 68 Ga]Ga-NOTA-ts3. A small amount of purified sample was analyzed by radio-high performance liquid chromatography (radio-HPLC) and radio-thin-layer chromatography (radio-TLC) to detect the radiochemical purity (RCP) of the labeled product. HPLC was performed using a Waters 2695 pump equipped with a radiodetector, and the analytical conditions are shown in Table 1 below. Radio-TLC analysis was performed using a Mini-Scan TLC scanner with 10 mM citrate buffer as the developing solvent. A 2 μL sample of the reaction product was taken with a capillary tube and attached to the bottom 1 cm of a 1 cm wide and 10 cm long filter paper. The paper was then placed in a 10 mM citric acid aqueous solution. When the developing solvent front rose to approximately 1 cm from the top of the filter paper, the filter paper was removed and allowed to air dry before radio-TLC analysis. After attenuation correction, the probe [ 68 Final radiochemical yield (RCY) and molar activity of Ga]Ga-NOTA-ts3.
[0098] Table 1 Analytical conditions for radioactive high performance liquid chromatography
[0099]
[0100]
[0101] Example 6
[0102] PET imaging and biodistribution of SIGLEC15 targeted nucleic acid aptamer nuclear medicine probe
[0103] 1. Nuclear medicine animal models
[0104] BALB / c nude mice (4–5 weeks old, female, SPF grade) used in the experiment were purchased from Vital River Laboratory Animal Co., Ltd. To construct the xenograft model, U87 tumor cells were resuspended in PBS (1×10⁻⁶). 7 100 μL of cell suspension (cells / mL) was subcutaneously injected into the right shoulder of mice using an insulin needle. When the tumor volume reached 200–300 mm², the cells were inoculated. 3 PET imaging was performed at that time. Mouse housing environment: They were housed in an SPF-grade clean animal room with a constant temperature (25±2℃) and humidity (50%~70%), with a light-dark cycle of 12h light + 12h darkness.
[0105] 2. PET Imaging Experiment
[0106] When the average tumor volume reached 200–300 mm^3, PET imaging was performed on tumor-bearing mice. The probe [ 68 Ga]Ga-NOTA-ts3 (approximately 5×10 6 MBq was injected into mice via the tail vein. Static whole-body PET imaging was performed for 10 minutes using a Micro-PET scanner at 10, 30, 60, and 120 minutes after injection. ROIs were used to analyze the quantitative uptake of the radioactive probe in tumors, muscle, and other normal tissues, expressed as %ID / mL.
[0107] 3. Biological distribution
[0108] After imaging, mice with tumors inside the tumor were injected with drugs to […]. 68 The biodistribution of Ga-NOTA-ts3 in U87 tumor mice was characterized. Tumors and major organs were weighed, and radioactivity was measured using a gamma counter (PerkinElmer, USA) to calculate the average organ distribution. The uptake in tissues was then attenuated and expressed as %ID / g.
[0109] Prepare using the same steps described above. 68 Negative control for Ga-NOTA-TS3: Out-of-order aptamers 68 Ga]-NOTA-NNN serves as a negative contrast control for micro-PET / CT.
[0110] Application examples
[0111] 1. Expression of SIGLEC15
[0112] The expression levels of SIGLEC15 in all cancer types and tumor cell lines were analyzed using the HPA database. The results showed that SIGLEC15 was highly expressed in all cancer types, including brain cancer, thyroid cancer, pancreatic cancer, esophageal cancer, chondroma, breast cancer, and cervical cancer. Figure 1 A). Results from the HPA database indicate that SIGLEC15 is highly expressed in various tumor cell lines, with the highest expression level observed in U87 cells. Figure 1 B).
[0113] RT-qPCR results showed that the mRNA transcription level of SIGLEC15 in cervical cancer cells (HeLa) and lung cancer cells (PC9) was significantly higher than that in the non-tumor negative control cell line BEAS-2B (P<0.01). Figure 1 As shown in Figure C. The PC9 cell line was used as a positive control (PC), and the non-tumor cell line BEAS-2B was used as a negative control (NC).
[0114] Western blot results showed that SIGLEC15 protein expression in cervical cancer cells (HeLa) and lung cancer cells (PC9) was significantly higher than that in non-tumor negative control cells (BEAS-2B) (P<0.01). Figure 1 As shown in D.
[0115] Immunohistochemistry was used to select clinical samples from 32 cervical cancer patients to determine SIGLEC15 expression. Figure 1 E). These tumor samples were analyzed and evaluated by three pathologists to obtain a composite score IRS (Integrated Rating Scale). Figure 1 F). The final staining results are shown below: negative (score 0-3), low expression (score 3-6), moderate expression (score 6-9), high expression (score ≥9). The positive rate is shown below ( Figure 1 G): Negative (12.5%; 5 cases), low expression (28.125%; 9 cases), moderate expression (8%; 25 cases), high expression (34.375%; 11 / 32 cases).
[0116] 2. Preparation of SIGLEC15 aptamers
[0117] Based on the reported sequence of the SIGLEC15-targeting DNA aptamer WXY3, a series of overlapping truncated sequences (ts1, ts2, ts3) covering the entire region of WXY3 were designed and obtained using overlap technology. A schematic diagram is shown below. Figure 2A. All aptamers were synthesized by Shangya Biotechnology Co., Ltd. The secondary structures of these aptamers were predicted using the Vector Builder database (https: / / en.vectorbuilder.com / tool / dna-secondary-structure.html), and the results are as follows: Figure 2 As shown in B.
[0118] IFA results showed that WXY3-FITC and its truncated sequence ts3-FITC could effectively bind to tumor cells (HeLa) and exhibited strong fluorescence intensity. Conversely, the other two truncated sequences, ts1 and ts2, lost their ability to bind to tumor cells and exhibited extremely weak fluorescence signals. This may be because the truncating process disrupts the core structural domain that enables the aptamer to specifically bind to tumor cells, resulting in... Figure 2 As shown in C.
[0119] 3. Screening and identification of fluorescent aptamer probes
[0120] Fluorescent (FITC, CY5) labeled aptamer probes were prepared by Shangya Biotechnology Co., Ltd. Fluorescent labels were added to the 5' end of the aptamers, followed by identification by high-performance liquid chromatography (HPLC). Figure 3 ).
[0121] FITC-labeled aptamer probes (ts3-FITC) were used to detect their affinity for tumor tissues and cells in vitro. CY5-labeled aptamer probes (ts3-CY5) were used to detect their affinity for tumors in animal models of tumors in vivo.
[0122] To determine the binding ability of ts3-FITC to different tumor tissues and cells in vitro, the IFA method was used to detect the binding ability of ts3-FITC to tumor tissues (CC, HCC, ESCA, LIAD, GBM) and tumor cells (HeLa, PC9, Hepal-6). The results showed that ts3-FITC has a strong ability to bind to different tumor tissues and cells. Figure 4 A), but normal mouse muscle tissue could not be identified. We observed using laser confocal microscopy that SIGLEC15 expression was located on the cell membrane of tumor cells (HeLa, PC9, Hepal-6). Figure 4 B).
[0123] 4. Animal fluorescence imaging and biological distribution studies
[0124] Five tumor-bearing nude mice were injected intravenously with ts3-CY5 (2 μmol / L). For the blocking group, the mice were pretreated 1 hour prior to injection with a 100-fold overdose of ts3 (unlabeled, used as the blocking agent). The mice were anesthetized with 3% (v / v) isoflurane and placed on an imaging table. 1% (v / v) isoflurane was continuously administered to maintain anesthesia during imaging. One hour post-injection, the fluorescence intensity of the tumors was monitored using an IVIS200 imaging system. The results showed that ts3-CY5 could recognize tumors in nude mice (…). Figure 5 A).
[0125] Biological distribution study
[0126] Following injection, tumor-bearing nude mice were euthanized and dissected. Major organs (such as the kidneys and heart) were collected for imaging, and the corresponding regions of interest (ROIs) were recorded using the IVIS 200 imaging system. Results showed that ts3-CY5 was significantly enriched in the kidneys and tumors. Figure 5 B). Imaging data were analyzed using Living Image 4.7.3 software. The H&E and immunohistochemical staining results of major organs and tissues are as follows: Figure 5 As shown in C.
[0127] 5. [ 68 Preparation and Identification of Ga]-NOTA-ts3
[0128] Radionuclide labeling: p-SCN-bn-NOTA (2-(p-isothiocyanate-benzyl)-1,4,7-triazinecycloalkyl-1,4,7-triacetic acid, 5 mg / mL) was coupled to the 5' end of ts3 (5'-AGCGGGTTGGTGGGCAAGAGGATGTTTATT TCATTGGTGTGCTGT-3', SEQ ID NO.1) in a 5:1 molar ratio in NaHCO3 buffer (pH 9). The mixture was shaken overnight at 4 °C (220 rpm). Successful coupling of NOTA-ts3 was analyzed by HPLC and ESI-MS.
[0129] 68 GaCl3 from 68 Ge / 68 It was eluted in the Ga generator with 4 mL of 0.1 M HCl (432.9 MBq, 11.7 mCi / 4 mL). Used for in vitro experiments. 68 The GaCl3 activity is 37 MBq (1 mCi / 340 μL). The reaction mixture is prepared by reacting ts3-NOTA with... 68The GaCl3 mixture was adjusted to pH 6.5 with 0.2M Na2HPO4 / NaH2PO4 buffer (Sigma), and then incubated for 1 hour after brief shaking.
[0130] Disordered aptamer probes ([) served as a control group) 68 The preparation and identification process of Ge]-NOTA-NNN is the same as described above.
[0131] [ 68 Preparation of Ga]-NOTA-ts3 probes as follows Figure 6 As shown.
[0132] PET / CT imaging results as follows Figure 7 As shown, [ 68 Ga]-NOTA-NNN represents the imaging status of the out-of-order aptamer negative control. PET-CT imaging results of the U87 tumor model show that... 68 The Ga-NOTA-ts3 probe was highly concentrated in tumors, demonstrating high specificity, high affinity, and high targeting. However, the negative control group [ 68 The Ga]-NOTA-NNN probe cannot bind specifically to tumors in animal tumor models.
[0133] The synthesis method of the SIGLEC15-targeting nucleic acid aptamer and its molecular probe described in this invention is simple, with mild reaction conditions, high yield, and low cost. The aptamer and probe exhibit high affinity and specificity for SIGLEC15. In small animal PET / CT imaging experiments, high-resolution imaging of the tumor site can be observed within 10 minutes after probe injection, with a high target / sample ratio, demonstrating the advantages of high affinity and high specificity of the prepared nuclear medicine probe. This product is beneficial for real-time, non-invasive detection of tumor lesions highly expressing SIGLEC15.
[0134] The above description is merely a preferred embodiment of the present invention and should not be construed as limiting the scope of the invention. Any variations and improvements made to the present invention should be included within the scope of protection of the present invention.
Claims
1. The application of nucleic acid aptamers targeting SIGLEC15 in the preparation of molecular probes targeting SIGLEC15, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1; The molecular probes include nuclear medicine molecular probes and fluorescent probes.
2. The application of SIGLEC15-targeting nucleic acid aptamers in the preparation of SIGLEC15-targeting nuclear medicine molecular probes, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
3. The application of nucleic acid aptamers targeting SIGLEC15 in the preparation of fluorescent probes targeting SIGLEC15, characterized in that, The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
4. A molecular probe, characterized in that, The molecular probe includes a nucleic acid aptamer that targets SIGLEC15; The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.
1.
5. A nuclear medicine molecular probe, characterized in that, The nuclear medicine molecular probe includes a nucleic acid aptamer, a coupling agent, and a radionuclide targeting SIGLEC15; The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1; The coupling agents include DOTA, NOTA, HYNIC, and DTPA. The radionuclides include 99 Tc, 68 Ga、 18 F, 123 I, 125 I, 131 I, 111 In、 67 Ga、 64 Cu、 89 Zr、 11 C 177 Lu and 188 Re.
6. A fluorescent probe, characterized in that, The fluorescent probe includes a nucleic acid aptamer targeting SIGLEC15 and a labeling substance; The nucleotide sequence of the nucleic acid aptamer is shown in SEQ ID NO.1; The labeling substances include small organic molecule dyes, fluorescent proteins, and luminescent macromolecular complexes.
7. The application of the molecular probe of claim 4 and the fluorescent probe of claim 6 in in vitro detection.
8. The application of the nuclear medicine molecular probe according to claim 5 in imaging detection.
9. A biomaterial targeting SIGLEC15, characterized in that, The biomaterials include nucleic acid aptamers, antibodies, peptides, and small molecules.
10. The use of the molecular probe of claim 4, the nuclear medicine molecular probe of claim 5, the fluorescent probe of claim 6, and the biomaterial of claim 9 in the preparation of products for targeted screening, diagnosis, treatment, or prognostic assessment of diseases, characterized in that, The diseases mentioned include glioma, lung cancer, melanoma, pancreatic cancer, breast cancer, ovarian cancer, esophageal cancer, liver cancer, thyroid cancer, stomach cancer, colorectal cancer, and cervical cancer.