A molecular marker related to the lambing number of high mountain merino sheep and application thereof

Abstract

The present application belongs to the technical field of molecular biology detection, and particularly relates to a molecular marker related to lambing number of Gaomian Merino sheep and application thereof. The present application obtains the molecular marker related to lambing number of Gaomian Merino sheep through screening, which is located at the 1321332th base of the 23rd chromosome of the international sheep reference genome Oar_v4.0 version; the mutation base is C or A. There are three genotypes, the average lambing number of Gaomian Merino sheep individuals with genotype CC is significantly higher than that of individuals with genotypes CA and AA; the average lambing number of Gaomian Merino sheep individuals with genotype CA is significantly higher than that of individuals with genotype AA. The present application provides a new SNP molecular marker resource for detecting the reproductive performance of Gaomian Merino sheep for non-disease diagnosis purposes, and provides a basis for screening excellent new varieties with high reproductive performance for assisted breeding of Gaomian Merino sheep.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular biology detection, and particularly relates to a molecular marker related to the lambing number of high mountain merino sheep and application thereof. BACKGROUND

[0002] The high mountain merino sheep is suitable for living in the high mountain cold and arid ecological zone with an altitude of 2400-4070 meters, has excellent stress resistance and ecological difference advantage, and has a wool fineness of 19.1-21.5 µm, and is a fine sheep breed for animal husbandry.

[0003] In the breeding benefit of the high mountain merino sheep, the lambing number is a key influencing factor. The lambing number is directly related to the expansion of the breeding scale and the increase of the breeding benefit. A low lambing number not only limits the growth speed of the sheep population, but also relatively increases the breeding cost and reduces the economic benefit of the breeder.

[0004] In the research of improving the lambing number of the high mountain merino sheep, the traditional breeding technology has obvious limitations. The traditional breeding mainly relies on phenotypic selection, and selects breeding sheep by observing the external characteristics and production performance of the sheep. This method requires the breeder to have rich experience, and is easily affected by subjective factors in the judgment process, which finally affects the breeding result.

[0005] With the rapid development of molecular biology technology, the molecular marker technology has shown great potential in the breeding of livestock and poultry. The molecular marker is a genetic marker based on DNA polymorphism, and can directly reflect the genetic variation of the genome of an organism. Compared with traditional morphological markers, cell markers and biochemical markers, the molecular marker has many obvious advantages.

[0006] However, the research on the molecular marker related to the lambing number of the high mountain merino sheep is still in the relatively initial stage. The breeder and the breeding worker are difficult to select the breeding sheep with high reproductive performance through accurate molecular marker screening, which limits the effective improvement of the lambing number of the high mountain merino sheep population. Therefore, developing a new, accurate and stable molecular marker related to the lambing number of the high mountain merino sheep, and deeply revealing the genetic regulation mechanism of the lambing number have become key problems to be solved in the current breeding field of the high mountain merino sheep. SUMMARY

[0007] The purpose of the present application is to provide a molecular marker related to the lambing number of high mountain merino sheep and application thereof.

[0008] In order to achieve the above-mentioned purpose of the application, the present application provides the following technical solutions:

[0009] The application provides a molecular marker related to the lambing number of high mountain merino sheep, which is located at the 1321332th base of chromosome 23 in the international sheep reference genome Oar_v4.0 version; the mutant base is C or A.

[0010] Preferably, when the mutant base is C, the genotype is CC or CA;

[0011] When the mutant base is A, the genotype is AA;

[0012] The average lambing number of the high mountain merino sheep individual with the genotype CC is significantly higher than that of the individuals with the genotypes CA and AA;

[0013] The average lambing number of the high mountain merino sheep individual with the genotype CA is significantly higher than that of the individual with the genotype AA.

[0014] The application further provides application of the molecular marker in preparation of a product for detecting the reproductive performance of the high mountain merino sheep for non-disease diagnosis purposes.

[0015] The application further provides application of the molecular marker in preparation of a new variety of the high mountain merino sheep with excellent reproductive performance for screening in assisted breeding.

[0016] The application further provides a primer pair for amplifying the molecular marker gene fragment, and the primer pair is shown as SEQ ID NO. 2-3.

[0017] The application further provides application of the primer pair in preparation of a product for detecting the reproductive performance of the high mountain merino sheep for non-disease diagnosis purposes.

[0018] The application further provides application of the primer pair in preparation of a new variety of the high mountain merino sheep with excellent reproductive performance for screening in assisted breeding.

[0019] The application further provides application of a reagent for detecting a molecular marker in preparation of a product for detecting the reproductive performance of the high mountain merino sheep for non-disease diagnosis purposes, and the reagent is a primer pair, and the primer pair is shown as SEQ ID NO. 2-3;

[0020] The molecular marker is located at the 1321332th base of chromosome 23 in the international sheep reference genome Oar_v4.0 version; the mutant base is C or A;

[0021] When the mutant base is C, the genotype is CC or CA;

[0022] When the mutant base is A, the genotype is AA;

[0023] The average lambing number of the high mountain merino sheep individual with the genotype CC is significantly higher than that of the individuals with the genotypes CA and AA;

[0024] The average number of lambs born of the alpaca individuals with the genotype CA is significantly higher than that of the individuals with the genotype AA.

[0025] The application further provides a use of a reagent for detecting a molecular marker in preparation of a new breed of alpaca for screening breeding performance in assisted breeding, wherein the reagent is a primer pair, and the primer pair is shown as SEQ ID NO. 2-3.

[0026] The molecular marker is located at the 1321332th base on the 23rd chromosome of the international sheep reference genome Oar_v4.0 version; the mutation base is C or A;

[0027] When the mutation base is C, the genotype is CC or CA;

[0028] When the mutation base is A, the genotype is AA;

[0029] The average number of lambs born of the alpaca individuals with the genotype CC is significantly higher than that of the individuals with the genotype CA and AA.

[0030] The average number of lambs born of the alpaca individuals with the genotype CA is significantly higher than that of the individuals with the genotype AA.

[0031] The application further provides a method for detecting the breeding performance of alpaca for non-disease diagnosis purposes, comprising the following steps:

[0032] (1) extracting genomic DNA of alpaca;

[0033] (2) using the genomic DNA obtained in step (1) as a template, performing amplification by using the primer pair to obtain a PCR amplification product;

[0034] (3) performing genotype analysis on the PCR amplification product to obtain individuals with different genotypes, associating the individuals with different genotypes with the average number of lambs born to obtain the relationship between the genotype and the number of lambs born, and further obtaining the breeding performance of alpaca;

[0035] The PCR amplification product is shown as SEQ ID NO. 1;

[0036] The molecular marker is located at the 294th position of SEQ ID NO. 1;

[0037] When the molecular marker is C, the genotype is CC or CA;

[0038] When the molecular marker is A, the genotype is AA;

[0039] The average number of lambs born of the alpaca individuals with the genotype CC is significantly higher than that of the individuals with the genotype CA and AA.

[0040] The average number of lambing of the high mountain merino sheep individual with the genotype of CA is significantly higher than that of the individual with the genotype of AA.

[0041] The present application has the following beneficial effects:

[0042] The present application provides a molecular marker related to the number of lambing of high mountain merino sheep and application thereof, the molecular marker is located at the 1321332th base of the 23rd chromosome in the international sheep reference genome Oar_v4.0 version; the mutation type is C / A, named as g1321332C>A, there are three genotypes, when the 1321332th base of the 23rd chromosome is C, the genotype is CC or CA; when the 1321332th base of the 23rd chromosome is A, the genotype is AA; through correlation analysis of different genotypes and average number of lambing, it is found that the average number of lambing of the high mountain merino sheep individual with the CC genotype is significantly higher than that of the individuals with the CA and AA genotypes (p<0.05), the average number of lambing of the high mountain merino sheep individual with the CA genotype is significantly higher than that of the individual with the AA genotype (p<0.05), which indicates that the base of the g1321332C>A SNP site of the 23rd chromosome of the high mountain merino sheep is the related SNP molecular marker of the average number of lambing of the high mountain merino sheep, by detecting the base of the 1321332th nucleotide site of the 23rd chromosome of the high mountain merino sheep, the average number of lambing of the high mountain merino sheep individual can be determined, which provides a new SNP molecular marker resource for the detection of the reproductive performance of the high mountain merino sheep for non-disease diagnosis purpose, and provides a basis for screening excellent new varieties with high reproductive performance for the high mountain merino sheep assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0043] Figure 1 It is an agarose gel electrophoresis diagram of PCR amplification products;

[0044] Figure 2 It is a sequencing peak diagram of the PCR amplification products after purification. DETAILED DESCRIPTION

[0045] The technical solutions provided by the present application are described in detail below in combination with examples, but they should not be understood as limitations to the protection scope of the present application.

[0046] Example 1

[0047] 1 Sample collection

[0048] The samples were from Gansu Sheep Breeding Technology Promotion Station, and blood samples of 143 high mountain merino sheep with lambing records were collected. Each sheep was intravenously sampled 5 mL into an EDTA-K2 anticoagulant blood collection tube. After the blood sample was collected, it was quickly mixed and stored in a sampling box containing an ice bag, and then transported back to the laboratory and stored in a -20°C refrigerator for DNA extraction. The lambing record of each sheep was provided by Gansu Sheep Breeding Technology Promotion Station, and the average number of lambs per sheep was calculated.

[0049] 2Main reagents and instruments

[0050] EDTA-K2 vacuum blood collection tube was purchased from Jiangsu Yuli Medical Instrument Co., Ltd.; blood genome extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; NanoDrop2000 spectrophotometer was purchased from Thermo Fisher Scientific Company, USA; DL1000 Marker, agarose, and nucleic acid dye were purchased from Beijing Solabio Technology Co., Ltd.; green Mix was purchased from Beijing Jingke Biological Technology Co., Ltd.; electrophoresis instrument was purchased from Beijing Liyi Instrument Factory; PCR instrument was purchased from BioRad Company.

[0051] 3Method

[0052] 3.1Extraction of blood genomic DNA

[0053] The blood genomic extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd. was used to extract genomic DNA from blood samples. The extracted DNA was placed under ultraviolet spectrophotometer to detect concentration and purity. The concentration was >20 ng / μL, and OD260 / OD280 was between 1.7~1.9, which met the experimental requirements. It was stored at -20℃ for standby.

[0054] 3.2Primer design

[0055] Referring to the 23rd chromosome gene sequence (GenBank accession number: NC_019480.2) of international sheep genome Oar_v4.0 version, a pair of specific primers containing g1321332C>A SNP site was designed by primer premier5.0 software.

[0056] Primer sequence:

[0057] F: 5'-AGGGAGAACCTCGCCACA-3' (SEQ ID NO. 2);

[0058] R: 5'-GAGGGTCATCCGCAGAAT-3' (SEQ ID NO. 3).

[0059] The length of the amplified fragment is 513 bp (shown in SEQ ID NO. 1), and the primers are synthesized by Beijing Encke Biotechnology Co., Ltd.

[0060] 3.3 PCR amplification and sequencing

[0061] The PCR amplification system is 25 μL: green 22 μL, 1 μL of upstream and downstream primers, 1 μL of template DNA.

[0062] The PCR amplification program is 98℃ for 2 min; 98℃ for 10 s, 58℃ for 10 s, 72℃ for 10 s, for a total of 40 cycles; 72℃ for 2 min.

[0063] The PCR product is detected by 1.5% agarose gel electrophoresis, and after the PCR product is detected by agarose gel electrophoresis, direct sequencing method is used for sequencing, and sequencing is completed by Beijing Encke Biotechnology Co., Ltd. The amplified nucleotide sequence is shown in SEQ ID NO. 1, and the SNP molecular marker is located at position 294 of the nucleotide sequence shown in SEQ ID NO. 1.

[0064] SEQ ID NO. 1: AGGGAGAACCTCGCCACACAGGGGCCAAAGCCCAGCAGAACTGTGTCCTGCAGTTACGTAACAAGTAGAATCATAAGACTAGACATTTAGCTGAAGAGACTTCCAAGCAACGTGTACAGCAGTAAAATGCAAGAGGTGAAAGGTAAACGGAGAGGAGGACTGTTTACTGAAAGGATTTGGGACTGTTTACTAAAAGGATGATTGCCGGCCGATCTAGATTACAAAACACGCCAAATTACGAGATGCACACATAGAAGAGTGTTCTAGAGGAAAGCCAAGGGTGGGGCTAGACCCTCTGTTAATACCTTAGACAGATCAAACGGTCGGAGTAGGTAGTCACACAGCTGGCTCTTGGAAGAGATTCAGGGTGTGACATAGAGAGCTTGTTCTGAGAGAGTTTGTTCTCAGTCAAACCAGAGAACAGCCAGCGAGCTGACTGCATTGTCCCTCAGGCATCTCAGCAAGAGCCCAGGATCGGATGGTGCTGGGCAGGAAATTCTGCGGATGACCCTC.

[0065] The sequencing results of PCR products were compared and analyzed by using bioinformatics software MEGA 6.0.

[0066] 3.4 Statistical analysis

[0067] According to the genotyping results, the number of individuals with different genotypes at each locus was counted. The g1321332C>A gene frequency, genotype frequency, effective allele number (Ne), locus heterozygosity (He), and Hardy-Weinberg equilibrium test were calculated using Popgen32 software. The polymorphism information content (PIC) was calculated using PIC software. The association between different genotypes of high mountain merino sheep and average lambing number was analyzed using the general linear model in IBM SPSS Statistics 22 software, and the results were expressed as "mean ± standard error".

[0068] 4 Results

[0069] 4.1 PCR amplification and sequencing results

[0070] The g1321332C>A SNP site on chromosome 23 of the international sheep genome Oar_v4.0 version of high mountain merino sheep was detected by 1.5% agarose gel (see Figure 1 ), the band was clear without impurity, and the specificity was good. The PCR product fragment size was 513 bp, which met the expected size and could be used for further experiments.

[0071] The peak chart and sequence obtained after purification and sequencing of the PCR product are shown in Figure 2 . It can be seen from Figure 2 that the g1321332C>A SNP site has C-A mutation, and there are three genotypes of CC, CA, and AA.

[0072] 4.2 Statistical analysis results

[0073] The genotype and allele frequency of the g1321332C>A SNP site on chromosome 23 of high mountain merino sheep were analyzed from the perspective of population genetics. As shown in Table 1, the CA genotype frequency was the highest at the g1321332C>A SNP site, which was the dominant genotype, and the C allele frequency was 52.1%, which was the dominant allele. The χ2 fitness test showed that the SNP site significantly deviated from the Hardy-Weinberg equilibrium state (P<0.05) (Table 1). The expected heterozygosity of the site was 0.499, and the PIC was 0.375, which belonged to moderate polymorphism.

[0074] Table 1 Polymorphism of g1321332C>A SNP site on chromosome 23 of Gaoyan Merino

[0075]

[0076] 4.3 Association analysis of different genotypes and average number of lambing

[0077] The association of different genotypes of Gaoyan Merino and average number of lambing was analyzed by general linear model in IBM SPSS Statistics 22 software, and the results showed that the average number of lambing of Gaoyan Merino individuals with CC genotype was significantly higher than that of individuals with CA and AA genotypes (p<0.05), and the average number of lambing of Gaoyan Merino individuals with CA genotype was significantly higher than that of individuals with AA genotype (p<0.05), indicating that the base of g1321332C>A SNP site on chromosome 23 of Gaoyan Merino is a related SNP marker of the average number of lambing of Gaoyan Merino. The results are shown in Table 2.

[0078] Table 2 Correlation analysis of different genotypes and average number of lambing

[0079]

[0080] Note: Different lowercase letters in the same row represent significant differences (P<0.05).

[0081] In summary, the SNP molecular marker described in the present application is located at the 1321332th base on chromosome 23 of the international sheep reference genome Oar_v4.0 version; the variation type is C / A, named g1321332C>A, and there are three genotypes. When the 1321332th base on chromosome 23 is C, the genotype is CC or CA; when the 1321332th base on chromosome 23 is A, the genotype is AA. Through association analysis of different genotypes and average number of lambing, it is found that the average number of lambing of Gaoyan Merino individuals with CC genotype is significantly higher than that of individuals with CA and AA genotypes (p<0.05), and the average number of lambing of Gaoyan Merino individuals with CA genotype is significantly higher than that of individuals with AA genotype (p<0.05), indicating that the base of g1321332C>A SNP site on chromosome 23 of Gaoyan Merino is a related SNP marker of the average number of lambing of Gaoyan Merino. By detecting the base of the 1321332th nucleotide site on chromosome 23 of Gaoyan Merino, the average number of lambing of Gaoyan Merino individuals can be determined, which provides a new SNP molecular marker resource for detecting the reproductive performance of Gaoyan Merino for non-disease diagnosis purposes, and provides a basis for screening excellent new varieties with high reproductive performance for Gaoyan Merino assisted breeding.

[0082] The above merely describes the preferred embodiments of the present application, and it should be pointed out that, for those skilled in the art, several improvements and refinements can be made without departing from the principles of the present application, and these improvements and refinements should also be considered as falling within the protection scope of the present application.

Claims

1. The application of a reagent for detecting molecular markers in the preparation of products for non-disease diagnostic purposes to assess the reproductive performance of alpine Merino sheep, characterized in that, The reagent is a primer pair, as shown in SEQ ID NO.2~3; The molecular marker is located at position 1321332 on chromosome 23 of the international sheep reference genome Oar_v4.0; the mutated base is C or A; When the mutated base is C, the genotype is CC or CA; When the mutated base is A, the genotype is AA; The average number of lambs born to individuals with the CC genotype was significantly higher than that of individuals with the CA and AA genotypes; The average number of lambs born to individuals with the CA genotype was significantly higher than that of individuals with the AA genotype.

2. The application of a reagent for detecting molecular markers in the preparation of new breeds of high-altitude Merino sheep with excellent reproductive performance through assisted breeding screening, characterized in that... The reagent is a primer pair, as shown in SEQ ID NO.2~3; The molecular marker is located at position 1321332 on chromosome 23 of the international sheep reference genome Oar_v4.0; the mutated base is C or A; When the mutated base is C, the genotype is CC or CA; When the mutated base is A, the genotype is AA; The average number of lambs born to individuals with the CC genotype was significantly higher than that of individuals with the CA and AA genotypes; The average number of lambs born to individuals with the CA genotype was significantly higher than that of individuals with the AA genotype.

3. A method for detecting the reproductive performance of alpine Merino sheep in a non-disease diagnostic destination, characterized in that, Includes the following steps: (1) Extracting genomic DNA from alpine Merino sheep; (2) Using the genomic DNA obtained in step (1) as a template, amplification was performed using the primer pairs shown in SEQ ID NO.2~3 to obtain PCR amplification products; (3) Genotyping of PCR amplification products was performed to obtain individuals with different genotypes. Individuals with different genotypes were correlated with the average number of lambs to obtain the relationship between genotype and number of lambs, and thus the reproductive performance of Alpine Merino sheep was obtained. The PCR amplification product is shown in SEQ ID NO.1; The molecular marker is located at position 294 of SEQ ID NO.1; When the molecular marker is C, the genotype is CC or CA; When the molecular marker is A, the genotype is AA; The average number of lambs born to individuals with the CC genotype was significantly higher than that of individuals with the CA and AA genotypes; The average number of lambs born to individuals with the CA genotype was significantly higher than that of individuals with the AA genotype.

Images